You are currently viewing a new version of our website. To view the old version click .
Toxins
  • Article
  • Open Access

25 December 2020

Virulence Factors Found in Nasal Colonization and Infection of Methicillin-Resistant Staphylococcus aureus (MRSA) Isolates and Their Ability to Form a Biofilm

,
,
,
,
,
,
,
,
and
1
Biotechnology and Molecular Epidemiology Laboratory, Fluminense Federal University, Niteroi, 24220-900 Rio de Jeneiro, Brazil
2
Pathology Postgraduate Program, Fluminense Federal University, Niteroi, 24220-900 Rio de Janeiro, Brazil
3
Applied Microbiology and Parasitology Postgraduate Program, Fluminense Federal University, Niteroi, 24220-900 Rio de Janeiro, Brazil
4
Santa Martha Hospital, Department of Clinical Pathology, Niterói, 24241-265 Rio de Janeiro, Brazil
This article belongs to the Special Issue Resistance to Staphylococcus aureus Toxins

Abstract

Hospitalizations related to Methicillin-resistant Staphylococcus aureus (MRSA) are frequent, increasing mortality and health costs. In this way, this study aimed to compare the genotypic and phenotypic characteristics of MRSA isolates that colonize and infect patients seen at two hospitals in the city of Niterói—Rio de Janeiro, Brazil. A total of 147 samples collected between March 2013 and December 2015 were phenotyped and genotyped to identify the protein A (SPA) gene, the mec staphylococcal chromosomal cassette (SCCmec), mecA, Panton-Valentine Leucocidin (PVL), icaC, icaR, ACME, and hla virulence genes. The strength of biofilm formation has also been exploited. The prevalence of SCCmec type IV (77.1%) was observed in the colonization group; however, in the invasive infection group, SCCmec type II was prevalent (62.9%). The Multilocus Sequence Typing (MLST), ST5/ST30, and ST5/ST239 analyses were the most frequent clones in colonization, and invasive infection isolates, respectively. Among the isolates selected to assess the ability to form a biofilm, 51.06% were classified as strong biofilm builders. Surprisingly, we observed that isolates other than the Brazilian Epidemic Clone (BEC) have appeared in Brazilian hospitals. The virulence profile has changed among these isolates since the ACME type I and II genes were also identified in this collection.
Key Contribution:
We identify for the first time in Brazil the presence of ACME type I and the truncated form of ACME type II.

1. Introduction

More than 30% of the healthy population is colonized by Staphylococcus aureus, making these subjects vehicles of dissemination of this pathogen [1]. For the past few years, studies conducted in Brazil have shown an increased number of colonizing Methicillin-resistant S. aureus (MRSA) isolates, in different age groups and with a marked antimicrobial resistance profile, pointing to the importance of monitoring this pathogen frequency and its particular characteristics, such as antimicrobial resistance patterns [2,3,4,5,6]. A high degree of similarity between nasal colonization and invasive infection isolates collected from the same patient has already been demonstrated [7,8,9], reinforcing the importance of detecting the presence of the nasal colonization and particular characteristics that could be responsible for this pathogen success and future infection development. Besides these observations, invasive nosocomial infections caused by multidrug-resistant microorganisms have been growing in recent years and account for approximately 15.5% of cases recorded worldwide [10]. Among S. aureus resistance mechanisms, the one related to beta-lactam antibiotics is highlighted [11]. It occurs due to modifications of its binding site for the altered Penicillin Binding Protein (PBP2a) encoded by the mecA gene, inserted in the Staphylococcal Cassette Chromosome mec (SCCmec) [12,13]. In addition to antimicrobial resistance, S. aureus is capable of producing a large number of virulence factors, such as toxins and enzymes, hemolysins (α, β, γ, and δ), Panton-Valentine Leucocidin (PVL), Staphylococcal Enterotoxins (SEs), exfoliative toxins A and B (ETA and ETB), toxic shock syndrome toxin (TSST-1), as well as the ACME gene, formed by the cluster arc and opp3, responsible for increasing the pathogenicity of strains by improving their fitness and conferring the ability to survive in an acidic environment [14,15,16,17,18,19].
A virulence factor, which also contributes to resistance, is used by these pathogens to form a biofilm, defined as a complex community of microorganisms surrounded by an extracellular matrix of polysaccharides adhered to each other and a surface [20]. The bacteria in biofilms can resist antimicrobials in concentrations up to 1000 times higher than those active in the same bacteria in the planktonic state [21].
An increasing number of MRSA strains are circulating in different hospitals and communities in Brazil, as well as worldwide [22,23,24,25,26]. Although the Brazilian Epidemic Clone (BEC) (ST239 SCCmec III) remains circulating in different hospitals and the community in our country [27,28], previous studies have shown the substitution of this clone for others, such as the New York/Japan clone (USA100/ST5/CC5/SCCmecII), community-acquired MRSA (USA300/ST8/CC8/SCCmecIV), and pediatric clone (USA800/ST5/CC5/SCCmecIV) [2,3,4,29]. This fact has evidenced the need for studies on the epidemiological, microbiological, and genetic characteristics of these microorganisms to improve and better understand the pathogen evolution, the scenario changes, and update control measures. This study compares the genotypic characteristics, besides comparing the resistance profile and ability to form biofilm among colonization and invasive MRSA isolates collected from patients attending a private and a public University Hospital in Niteroi/Rio de Janeiro, Brazil.

2. Results

A total of 147 samples were collected and assessed. Sixty-two samples, the majority retrieved from invasive infections (51, 83, 87%), were collected from 57 different patients from Santa Martha Hospital, and eighty-five collected from active surveillance from patients attending Santa Martha Hospital and Antonio Pedro University Hospital (HUAP). The median age of colonized patients was 47.20 ± 31.20 and 73.05 ± 19.31 for patients with invasive infections. The age range of more than 60 years old was the group with the most colonization samples (39 samples—45.88%) and invasive infection (46 samples—80.70%). Forty-six (54.12%) of the colonized patients were male, while females were prevalent among patients with invasive infection (32 patients—56.14%).
It was possible to access the complete medical records of 122 patients (65 colonized and 57 with invasive infection). Among them, the largest number of samples has been collected from the Intensive Care Unit (ICU), followed by the infection ward and Neonatal Intensive Care Unit (NICU) (Figure 1A).
Figure 1. Characteristics and risk factors of colonized and invasive infection patients. (A) Isolates according to the hospital sectors in % values; * MMC = Male Medical Clinic; ICU = Intensive Care Unit; ICC = Intensive Care center; (B) cause of admission in % values for colonization and invasive infection; UTI = Urinary Tract Infection. (C) Associated comorbidities in % values; *COCPD = Chronic Obstructive Pulmonary Disease; CHF = Congestive Heart Failure. (D) Respiratory devices associated colonization and invasive infection in % values, (E) Clinical specimen; BAL = Bronchoalveolar lavage.
Pneumonia was the main cause of admission in both groups being 10 (15.38%) in the colonization group and 19 (33.93%) in the invasive infection group, followed by sepsis (nine isolates—13.85% in colonization group and nine isolates—16.07% in the invasive infection group) (Figure 1B). Hypertension was the prevalent comorbidity in both groups, with a total of 24 (36.92%) in the colonization group and 20 (35.71%) in the invasive infection group, followed by diabetes mellitus with 13 (20.00%) and 15 (26.79%) respectively (Figure 1C). Twenty-four (36.92%) colonized patients did not have to use any respiratory devices, while tracheostomy was the respiratory procedure most used by patients presenting invasive infection (21 patients—37.50%). (Figure 1D).
Regarding the invasive infection group, most isolates (51.61%) were from tracheal secretion, nine (14.52%) from blood samples, six (9.68%) from urine samples, three (4.84%) from catheter tips, three (4.84%) from Broncho Alveolar Aspirates, five (8.06%) from diverse secretions, and four (6.45%) samples from other clinical specimens (Figure 1E).
All isolates were confirmed as S. aureus by MALDI-TOF analysis. The disk-diffusion method showed oxacillin and penicillin resistance for all isolates, and only two were resistant to vancomycin. The isolates from invasive infections presented a wider range of resistance to antimicrobial agents than the colonization group. The majority of 55 (88.71%) of invasive infection isolates were resistant to two or more classes of non-beta lactam antibiotics whereas, in the colonization group, only 41.18% were multi-drug resistant (MDR) (p ≤ 0.01) (Table 1).
Table 1. Resistance profile among nasal colonization and invasive infection samples.
Among the 85 colonization isolates, 57 (67.06%) carried the SCCmec IV, 27 (31.87%) the SCCmec II, and 1 (1.18%) the SCCmec III. In the 62 isolates retrieved from invasive infections, the most prevalent was the SCCmec type II 39 (62.90%), followed by 14 (22.6%) SCCmec type IV and nine (14.58%) SCCmec type III. None of them carried SCCmec type I or SCCmec type V (Table 2).
Table 2. Genetic profile of nasal colonization and invasive infection isolates.
Eighteen Spa types were assessed among eight Sequence Types (MLST). The sequence type 5 (ST5) was prevalent among both colonization 58 (68.24%) and 46 (74.19%) invasive infection isolates. Thirteen (15.29%) colonization isolates belonged to ST30, the second most found sequence type in this group. Seven (11.29%) invasive infection isolates were typed as ST239. According to the Spa typing, t002 (ST5), 40 (47.07%) was prevalent among colonization isolates, while invasive infection samples were typed as t539 (ST5), 31(50.00%) (Table 2).
Regarding the presence of virulence factors within the colonization group, 83 samples (97.65%) carried icaC, 85 (100%) carried icaR, and 85 (100%) had hla genes. Similar results were observed in the invasive infection group, as 62 samples (100%) carried icaC and icaR, and 61 (98.39%) tested positive for the presence of hla genes. PVL genes were detected in 12 (14.12%) colonization and 4 (6.45) invasive infection isolates, without statistical significance (p = 0.140). PVL genes were detected in 15 isolates carrying the SCCmec IV and in one SCCmec III. All four ST8-t008 were typed as PVL positive. The ACME cluster arcA was mostly identified in invasive infection isolates when compared to colonization isolates (p < 0.01). All isolates positive for ACME cluster opp3AB were also positive for arcA. The arcA gene was detected in 15 isolates belonging to ST5, in the invasive infection group. In contrast, in the colonization group, this gene was found in isolates belonging to ST5 (five isolates), ST8 (one isolate), and ST239 (one isolate). Two isolates, positive for both genes, were characterized as ST8 and ST239. Only one isolate carrying SCCmec IV, ST8-t008, presented all genes tested within the colonization group. This isolate was also resistant to oxacillin, erythromycin, and penicillin (Table 2).
The classification of bacteria’s ability to form biofilm is related to the capacity of bacteria strain to adhere to a surface and form a layer, so the density of this layer was directly related to the strength of the biofilm produced. To analyze biofilm formation’s strength, 94 (63.95%) samples presented a complete genotypic identification profile, including the presence of genes related to biofilm formation, icaC and icaR, virulence genes pvl, hla, and ACME, spa typing, MLST, and SCCmec typing. It was possible to observe that among 51 samples of SCCmec II, 24 (25.53%) were considered strong, 14 (14.89%) moderate, and 13 (13.83%) weak biofilm formers. Among 8 SCCmec III carriers isolates, 6 (6.38%) were considered strong, and 2 (2.12%) weak biofilm formers (no moderate biofilm-forming isolate was found). Finally, among 35 carriers of SCCmec IV, 18 (19.15%) were strong, 13 (13.83%) moderate, and 4 (4.25%) weak biofilm formers (Figure 2).
Figure 2. Comparative distribution between the mec staphylococcal chromosomal cassette (SCCmec) II, III, and IV isolates and their ability to form biofilms.
Of these 94 isolates, one considered strong biofilm-forming, one moderate, and one weak were selected for analysis using a scanning electron microscopy (SEM). Cell morphology was compared with that of isolate S. aureus HU25, a strong biofilm former (Figure 3D). The weak biofilm-forming isolate (SM003) presented low cell density, small cell clusters, and no microchannels. The bacterial cells showed normal morphology, with no changes in their cell wall (Figure 3E).
Figure 3. Number of colony-forming units per milliliter (CFU/mL) in S. aureus HU25 strong biofilm-forming strain used as the control, SM003 (A), SM011 (B), and SM130-2 (C) biofilms. Results are presented as the mean ± standard error mean (SEM) from 5-7 samples per group. SEM images of biofilm information of (D) S. aureus HU25, (E) SM003, (F) SM011, (G) SM130-2.
The isolate considered moderate biofilm-former (SM011—Figure 3F) presented a significant increase in cell density, and it is possible to observe different layers of cells overlapping each other. Microchannels and the absence of lesions are observed in the cell walls with a smooth and homogeneous appearance. The strong biofilm-forming isolate (SM130-2—Figure 3G) presented high cell density, where several cell clusters with several overlapping cells were observed, as well as communicating microchannels. This isolate also presented a significantly higher (p-value < 0.05) number of colony-forming units. In contrast, the tests performed with the samples considered moderate (SM011) and weak (SM003) biofilm-formers did not demonstrate statistical significance in the cell count when compared to the control (Figure 3A–C). However, the strains’ ability to adhere to the substrate may vary, suggesting that a good part of the colony-forming units (CFU) remained adhered to glass slide covers (GC) after washing, which may justify this difference (Figure 3A–C). However, the strength of the adhesion of the strains to the substrate may vary, suggesting that a good part of the CFU remained adhered to glass slide covers (GC), which may justify this observed difference. The weak biofilm-former tends to detach to GC in greater numbers than moderate and strong biofilm former. These observations are reflected in SEM images, where weak biofilms are less structured than moderate and strong (Figure 3A–C).

3. Discussion

Patients admitted to the Intensive Care Units represent 20% of the colonization group and 39.29% of the invasive infection group. This observation agrees with a report from the World Health Organization that says that the endemic burden of MRSA invasive infections is significantly higher in patients admitted to ICUs [30]. On the other hand, the same report mentions newborns as the most compromised age group. In the present study, 45.88% of colonization and 80.70% invasive infection isolates were collected from patients over 60 years old. In a 1500 sample study carried out with children from the same geographical area, MRSA isolates were responsible for colonizing 151 (10.00%) subjects [31]. A recent study showed that the prevalence of high-income children colonized by MRSA in Brazil is similar to the rates found worldwide. However, when analyzing low and middle-income or slum resident children, the prevalence is slightly higher than that found in these same countries [32]. Despite these MRSA strains having a lower virulence profile, colonization is more widespread because it poses a public health risk in cases of outbreaks since the most colonized population represents a more vulnerable portion of the population.
The use of breathing devices by colonized patients increases the chances of developing invasive infections. It is an invasive procedure and can become a vehicle of transmission through manipulation by health care professionals. Stulik et al. 2014 [33] showed the use of mechanical ventilation by patients colonized by S. aureus increases the risk of progression to respiratory infections such as tracheobronchitis and pneumonia associated with mechanical ventilation [33,34]. In this study, we observed 22 (33.85%) colonized patients associated with some type of respiratory device.
The most used antimicrobial agents for the treatment of MRSA invasive infections in this study were clindamycin (53/62), rifampin (19/62), sulfamethoxazole-trimethoprim (8/62), and tetracycline (5/62). It was also observed a high ciprofloxacin resistance rate (56/62) in isolates retrieved from colonized subjects. The high prevalence of multidrug-resistant strains could be explained because some of these antibiotics are the drugs of choice to treat MRSA invasive infections, leading to selective pressure from these microorganisms, justifying the antimicrobial resistance pattern found in our study [35,36].
Comparing the antimicrobial resistance burden found herein, with other studies conducted in different regions in our country, both colonization and invasive infection isolates seem to present a similar antimicrobial resistance profile. Studies conducted in the southern Brazilian region, such as Santa Catarina [37], the northern region, such as Piauí [38], Bahia [39], and Paraíba [40], and the southeastern region [2,3] with invasive infection and colonization isolates, present antimicrobial resistance profiles similar to ours. These isolates present mainly resistance to erythromycin, clindamycin, and ciprofloxacin. Although similar patterns of antimicrobial resistance are observed, the resistance frequency among the isolates in relation to tetracycline (8.06% in invasive infections and 4.7% in colonization), for example, presents a lower frequency when compared to others studies conducted in our region and other regions of Brazil [2,3,37,38,40]. Thus, showing that regional characteristics such as measures for the control and treatment of MRSA infections can influence the particularities found in circulating strains, reinforcing the need for active surveillance of circulating strains and the treatment procedure must be tailored based on the specific region of Brazil.
It seems that the pattern of high multi-drug resistance among invasive infection isolates in this study occurs by the prevalence of SCCmec type II (39 samples or 62.9%), normally observed as multidrug-resistant [16,41]. Colonization isolates were mainly characterized by SCCmec IV (57 samples or 67.1%), normally resistant only to beta-lactam antimicrobial agents [16,41]. In the present study, however, it was observed that samples carrying the SCCmec IV element were resistant to ciprofloxacin, erythromycin, clindamycin, and nitrofurantoin, in addition to beta-lactam.
Vieira et al. 2016 [42] observed that t002/ST5 and t318/ST30 were prevalent among HIV-positive patients and their caregivers from Rio de Janeiro and Niteroi. Similarly, in the present study, ST5 and ST30 were the most frequent, substituting the Brazilian Epidemic clone (BEC-t037-ST239).
The pvI genes were detected in 15 samples carrying SCCmecIV and one SCCmecIII, confirming these virulence genes are not exclusive to SCCmecIV carriers, as generally cited [43,44,45]. On the other hand, the ACME gene formed by the arc and opp3 clusters might be responsible for the growing pathogenicity of strains circulating in Brazil. This gene is known to increase bacteria fitness, allowing for fast growth and propagating the strain [18]. Though ACME is rare among strains other than USA300, this was identified in our study in one strain USA300 and one ST239-t037-SCCmecIII, characterized as ACME II.
No statistical significance was found indicating sample isolation site influences the ability to form biofilm and neither the presence of Panton-Valentine Leukocidin (PVL) genes (LUKF-PV and LUKS-PV). Cakir Aktas et al. 2013, Emaneini et al. 2015 and Gogoi-Tiwari et al. 2017 [46,47,48] point to a synergistic effect of these genes in increased virulence, but not directly on the strength of biofilm formation. However, when investigating the presence of the ACME gene clusters, a tendency to form strong biofilms can be observed with statistical relevance [49]. This information was corroborated by this study, since the colonization sample SM130-2, the only carrier of the two clusters of the ACME genes (arcA and opp3AB), showed an increased ability to form biofilm when compared to the other strains.
We identified 22 ST5 samples carrying only the arcA cluster and were characterized as having a truncated form of ACME I, called ACME II, identified by other studies [18,50,51,52]. Identifying many ST5 isolates causing invasive infection by carrying the ACME gene is of great concern. These strains are multidrug-resistant, and the presence of this gene might increase their pathogenicity, allowing them to grow faster [50,52,53].
Only one sample was positive for all of the genes tested in this study. It was typed as USA300 (ST8/t008), an endemic clone in the United States [54]. Although this strain is resistant only to erythromycin and beta-lactam antibiotics, the ACME gene’s presence increases its pathogenicity. It may increase the risk of invasive infections, both in the community and hospital environments.
Analyzing the strength of biofilm formation, non-biofilm-forming strains were not observed, which could be explained by the presence of different genes regulating biofilm formation, commonly carried by these strains, such as poly-β(1-6)-N-acetylglucosamine/polysaccharide intercellular adhesin (PNAG/PIA). On the other hand, SCCmec II carrier strains have a greater tendency to produce strong biofilms, as observed by Pozzi et al. 2012 [55].
We observed a higher cell density in strains considered moderate biofilm-formers through image analysis compared to those classified as strong. This may suggest that these analyses are important for developing strategies to fight infections, but not following clinical damage they may cause.

4. Conclusions

Invasive infection isolates have a higher resistance to the antimicrobial agents tested when compared to nasal colonization samples. Several different SCCmec types among nasal colonization and invasive infection samples were also observed. New clones seem to be substituting the Brazilian Epidemic Clone in hospital and community environments. The PVL genes were not found only in SCCmecIV isolates, but also in strains carrying SCCmecIII. ACME type I and the truncated form of ACME type II were identified for the first time in Brazil. Invasive infection isolates presented more pathogenicity-related genes when compared to nasal colonization samples.
A total of 94 (51.06%) isolates were classified as strong biofilm formers. No relationship has been observed between the presence of PVL genes and biofilm formation. However, ACME gene carriers were all in the group of strong biofilm formers. The relation of the ACME genes and staphylococci biofilms remains unclear and new studies should be carried out to investigate this. S. aureus carrying SCCmecII also tended to form stronger biofilms. The ability to form a biofilm, as a resistance factor, draws our attention because it makes infections more difficult to treat. Strong biofilm-forming strains, which are also MDR, associate the difficulty of eradicating planktonic cells and also the sessile ones.
There was no relationship between the sample’s anatomical site of origin with the strain’s ability to form a biofilm, nor significant differences between the ability to form biofilm among samples of invasive infection or colonization.

5. Materials and Methods

5.1. Data Collection

This cross-sectional cohort study covers colonizing and invasive or/and non-invasive isolates from Santa Martha Hospital and Antonio Pedro University Hospital, collected from March 2013 to December 2015. Patient data, including gender, age, hospital ward, cause of admission, comorbidities, type of sample, and use of respiratory devices, were collected from patient medical records.

5.2. Samples Acquisition and Characterization

Samples were collected using a dry swab in infected sites and stored in the Stuart transport medium (Labor import-Brazil, Sāo Paulo- Brazil). Swabs were also collected from both nostrils of inpatients for MRSA colonization surveillance. Characterization, phenotypic tests, and species confirmation was performed by the VITEK® system (bioMérieux Inc., Lyon, France) and Matrix-Assisted Laser Desorption Ionization—Time of flight (MALDI-TOF) (Bruker Billerica, MA, USA), According to Sogawa et al., 2017 [56], with slight modifications.

5.3. Antimicrobial Susceptibility Test

The antimicrobial profile was confirmed by antimicrobial susceptibility test using the disk-diffusion method Kirby-Bauer, as recommended by the Clinical and Laboratory Standards Institute [57], to confirm the resistance profile. The antimicrobial agents tested were: ciprofloxacin (5 μg), chloramphenicol (30 μg), clindamycin (2 μg), erythromycin (15 μg), nitrofurantoin (300 μg), gentamicin (10 μg), cefoxitin (30 μg), oxacillin (1 μg), rifampin ( 5 μg), sulfamethoxazole-trimethoprim (23.75 μg/1.25 μg), tetracycline (30 μg), vancomycin (30 μg), and penicillin (10 I.U..) and S. aureus HU25 as a positive control [31].

5.4. Genotyping

DNA extraction from Methicillin-Resistant S. aureus (MRSA) was performed using the QIAamp® DNA mini kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions. SCCmec typing, Spa typing, and Multilocus Sequence Typing (MLST) were performed in all isolates as described previously [31,43,58,59,60]. To detect β-lactam resistance (mecA), virulence factors [PVL, α-hemolysin, and ACME clusters (arcA and opp3AB)] and biofilm-related (icaC and icaR) genes, samples were tested by PCR, as previously described [18,43,61,62]. The presence of icaC e icaR was confirmed by PCR, using the primers icaC179F- TGTCACAGTTACTGACAACCT and icaC986R- CGCAATATCATGCCGACACC, and icaR40F-TCAGAGAAGGGGTATGACGGT and icaR496R- CCACTGCTCCAAATTTTTGCG, respectively. The control strains used for the genotyping reactions are listed in Table S1 (Supplementary Material). The PCR was performed as follows: Buffer 5 × 1 (Promega, WI, USA), 25 mM MgCl2 (Promega Biosciences Inc., Madison, WI, USA), 2 mM dNTP (Promega, WI, USA), 10 µM of each primer, Ampli Taq Gold DNA polymerase (Promega, WI, USA), DNA and Milli-Q water with a total volume of 25 µL. DNA was amplified in a Nexus Gradient Mastercycler (Eppendorf, Hamburg, Germany), with an initial denaturation step (94 °C for 5 min), 30 cycles of denaturation (95 °C for 30 s), annealing (55 °C for 30 s) and extension (72 °C, 1 min), and a final extension step (72 °C for 7 min). Amplicons were analyzed on 1% agarose gel in TBE 0.5×. (Controls were shown on ST1).

5.5. Evaluation of Biofilm Strength

Isolated colonies were inoculated into 5 mL of sterile NaCl 0,9% solution to match a 0.5 McFarland scale (~1.5 × 108 CFU) and incubated at 37 °C for 24 h. A total of 200 µL of the sample diluted 1:100 on Brain Heart Infusion (BHI) supplemented with glucose 1% has been transferred to a 96-well polystyrene NUNC plate (Thermo Fisher Scientific, Waltham, MA, USA) in triplicates, following another 37 °C/24 h incubation. Plates were then washed with distilled water following fixation by heat for 1 h at 60 °C, stained with crystal violet 0.1% for 15 min at Room Temperature, washed with running tap water, air-dried, and finally re-solubilized with 150 µL of ethanol 99% P.A. for 30 min. The optical density (OD) was measured at 570 nm using a microtiter plate reader with a wet plate [63]. Biofilms were classified as comparing the cut-off (the mean optical density of the blank plus three times the standard deviation (Cut Off (CO) = Optical Density OD × Blank (BK) + 3 × Standard Deviation (SD) and values of samples OD. Values below the cut-off were considered to belong to a group of non-biofilm-forming isolates. Strains with absorbance values up to twice the cut-off were considered weak biofilm formers. In contrast, those presenting two and four times the cut-off were defined as moderate biofilm formers, and four times the cut-off were considered to be related to a strong biofilm-forming group [63].

5.6. Biofilm Scanning Electron Microscopy (SEM) and CFU Counting

The inoculum was adjusted to 0.5 McFarland standard. A total of 36 sterilized disks of glass slide covers (GC) were used to measure and visualize the biofilm growth. After sterilization, the GCs were randomly assigned to four different groups: S. aureus HU25 (a strong biofilm-forming strain used as the control), SM003, SM011, and SM130-2 (n = 9 GC for each group). GCs were placed in a 24-well polystyrene plate (Techno Plastic Products AG-TPP, Trasadingen, Switzerland) with 1 mL of BHI-g broth and 0.1 mL of the inoculum. The plates were incubated for 24 h at 37 °C, and then, from each group, two (2) GCs were assigned to perform SEM, and the remaining seven (7) GCs were selected for colony-forming units (CFU) counting. For SEM assessment, each GC went through a sequence of preparation steps. First, they were aseptically washed with 3 mL of sterile 0.9% saline, fixed in 2.5% glutaraldehyde for 1 h, and dehydrated in several washes with different concentrations of ethanol (10, 25, 50, 75, and 90% for 20 min and 99.5% for 1 h). Samples were dried overnight in a bacteriological incubator at 37 °C and then coated with gold in a low-pressure atmosphere with ion sputter. The biofilms’ topographies were visualized and photographed using a scanning electron microscope (Carl Zeiss EVO® MA15 or Shimadzu, SS-550 SUPERSACAN, Kyoto, Japan). To count colony-forming units, a total of seven (7) GC samples were aseptically washed with 3 mL of sterile 0.9% saline, placed in tubes with 10 mL of sterile 0.9% saline, and sonicated (USC -1400A, Unique-Indaiatuba, Sao Paulo, Brazil) for 10 min to disperse the biofilms from glass slide covers. The original bacterial suspension recovered was diluted from 10-2 to 10-8 by adding sterile 0.9% saline. Aliquots of 10 µL were seeded on BHI agar plates and incubated at 37 °C for 24 h. The number of colony-forming units per milliliter (CFU/mL) was determined, and the results were presented in a log (log10) chart [64].

5.7. Statistical Analysis

Bivariate analysis was performed using the Chi-square test (χ2), and values of p ≤ 0.05 were considered statistically significant. For the biofilm strength classification, analyzes of the standard deviation of the mean per sample and Chi-square test and Fisher’s exact test were used to define the relationship between the strength of biofilm formation and virulence factors among all tested isolates. The t-test was also performed to assess biofilm formation’s strength based on the detection of virulence genes.

5.8. Ethical Statement

The study was conducted following the Declaration of Helsinki of 1975, and the protocol was approved by the Ethics Committee in Human Research at Federal Fluminense University (108.042) under the number: 01097412.6.0000.5243. The approval date is 26 September 2012. As data analysis was retrospective, and after patient discharge, no signed consent, apart from the general one for hospitalization, was obtained.

Supplementary Materials

The following are available online at https://www.mdpi.com/2072-6651/13/1/14/s1, Table S1: Control strains.

Author Contributions

Conceptualization, F.A.A. and R.F.A.P.; methodology, F.A.A., T.S.M., R.F.A.P., F.R.P.; formal analysis, T.S.M., F.R.P., D.S.; investigation, T.S.M., F.R.P., L.S.P.A., R.F.C., G.C.d.M., T.A.N.R.; resources, F.A.A.; data curation, T.S.M.; writing—original draft preparation, T.S.M. and F.R.P.; writing—review and editing, F.A.A., R.F.A.P., F.R.P. and B.A.P.; supervision, F.A.A. and R.F.A.P.; project administration, F.A.A.; funding acquisition, F.A.A and B.A.P. All authors have read and agreed to the published version of the manuscript.

Funding

This work has been supported by CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior), CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico), FAPERJ (Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro), and UFF (Universidade Federal Fluminense).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and ap-proved by the Institutional Ethics Committee of Fluminense Federal university (protocol code 108.042 and date of approval (06 September 2012).

Acknowledgments

We would like to thank the DNA Sequencing Platform of Fluminense Federal University, Santa Martha Hospital and Matheus José da Silva from LAMEV of Itajuba Federal University for the SEM images.

Conflicts of Interest

The authors have no conflict of interest to declare.

References

  1. Sakr, A.; Brégeon, F.; Mège, J.-L.; Rolain, J.-M.; Blin, O. Staphylococcus aureus Nasal Colonization: An Update on Mechanisms, Epidemiology, Risk Factors, and Subsequent Infections. Front. Microbiol. 2018, 9. [Google Scholar] [CrossRef] [PubMed]
  2. Muzy Dias, A.P.; Guimarães, L.C.; Petrucci, L.B.D.V.; Pinheiro, J.A.Z.; Pinheiro, M.G.; Silva, F.R.E.; Póvoa, H.C.C.; Aguiar-Alves, F. Prevalence of oxacillin-susceptible methicillin-resistant Staphylococcus aureus nasal carriage and their clonal diversity among patients attending public health-care facilities. Indian J. Med. Microbiol. 2020, 38, 192–199. [Google Scholar] [CrossRef]
  3. Rodrigues, D.C.S.; Lima, D.F.; Cohen, R.W.F.; Marques, E.A.; Leão, R.S. Molecular characterization of methicillin-resistant Staphylococcus aureus from chronically colonized cystic fibrosis paediatric patients in Brazil. Epidemiol. Infect. 2020, 148. [Google Scholar] [CrossRef] [PubMed]
  4. Salgueiro, V.C.; Seixas, M.D.L.; Guimarães, L.C.; de Ferreira, D.C.; Da Cunha, D.C.; Nouér, S.A.; dos Santos, K.R.N. High rate of neonates colonized by methicillin-resistant Staphylococcus species in an Intensive Care Unit. J. Infect. Dev. Ctries. 2019, 13, 810–816. [Google Scholar] [CrossRef]
  5. De Oliveira, P.M.N.; Buonora, S.N.; Souza, C.L.P.; Simões Júnior, R.; da Silva, T.C.; Bom, G.J.T.; Da Teixeira, C.H.S.; Da Silva, A.R.A. Surveillance of multidrug-resistant bacteria in pediatric and neonatal intensive care units in Rio de Janeiro State, Brazil. Rev. Soc. Bras. Med. Trop. 2019, 52. [Google Scholar] [CrossRef]
  6. Bes, T.M.; Martins, R.R.; Perdigão, L.; Mongelos, D.; Moreno, L.; Moreno, A.; de Oliveira, G.S.; Costa, S.F.; Levin, A.S. Prevalence of methicillin-resistant Staphylococcus aureus colonization in individuals from the community in the city of Sao Paulo, Brazil. Rev. Inst. Med. Trop. Sao Paulo 2018, 60, e58. [Google Scholar] [CrossRef] [PubMed]
  7. Thakkar, V.; Ghobrial, G.M.; Maulucci, C.M.; Singhal, S.; Prasad, S.K.; Harrop, J.S.; Vaccaro, A.R.; Behrend, C.; Sharan, A.D.; Jallo, J. Nasal MRSA colonization: Impact on surgical site infection following spine surgery. Clin. Neurol. Neurosurg. 2014, 125, 94–97. [Google Scholar] [CrossRef]
  8. Kao, K.-C.; Chen, C.-B.; Hu, H.-C.; Chang, H.-C.; Huang, C.-C.; Huang, Y.-C. Risk Factors of Methicillin-Resistant Staphylococcus aureus Infection and Correlation With Nasal Colonization Based on Molecular Genotyping in Medical Intensive Care Units: A Prospective Observational Study. Medicine 2015, 94, e1100. [Google Scholar] [CrossRef]
  9. Tilahun, B.; Faust, A.C.; McCorstin, P.; Ortegon, A. Nasal colonization and lower respiratory tract infections with methicillin-resistant Staphylococcus aureus. Am. J. Crit. Care Off. Public Am. Assoc. Crit. Care Nurses 2015, 24, 8–12. [Google Scholar] [CrossRef]
  10. Mulani, M.S.; Kamble, E.E.; Kumkar, S.N.; Tawre, M.S.; Pardesi, K.R. Emerging Strategies to Combat ESKAPE Pathogens in the Era of Antimicrobial Resistance: A Review. Front. Microbiol. 2019, 10. [Google Scholar] [CrossRef]
  11. Hamilton, S.M.; Alexander, J.A.N.; Choo, E.J.; Basuino, L.; da Costa, T.M.; Severin, A.; Chung, M.; Aedo, S.; Strynadka, N.C.J.; Tomasz, A.; et al. High-Level Resistance of Staphylococcus aureus to β-Lactam Antibiotics Mediated by Penicillin-Binding Protein 4 (PBP4). Antimicrob. Agents Chemother. 2017, 61. [Google Scholar] [CrossRef]
  12. Song, M.D.; Wachi, M.; Doi, M.; Ishino, F.; Matsuhashi, M. Evolution of an inducible penicillin-target protein in methicillin-resistant Staphylococcus aureus by gene fusion. FEBS Lett. 1987, 221, 167–171. [Google Scholar] [CrossRef]
  13. Martins, A.; Riboli, D.F.M.; Pereira, V.C.; de Lourdes Ribeiro de Souza da Cunhaa, M. Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from a Brazilian university hospital. Braz. J. Infect. Dis. 2014, 18, 331–335. [Google Scholar] [CrossRef]
  14. Diep, B.A.; Gill, S.R.; Chang, R.F.; Phan, T.H.; Chen, J.H.; Davidson, M.G.; Lin, F.; Lin, J.; Carleton, H.A.; Mongodin, E.F.; et al. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet Lond. Engl. 2006, 367, 731–739. [Google Scholar] [CrossRef]
  15. Lim, K.T.; Hanifah, Y.A.; Mohd Yusof, M.Y.; Thong, K.L. Investigation of toxin genes among methicillin-resistant Staphylococcus aureus strains isolated from a tertiary hospital in Malaysia. Trop. Biomed. 2012, 29, 212–219. [Google Scholar]
  16. De Oliveira, C.F.; Morey, A.T.; Santos, J.P.; Gomes, L.V.P.; Cardoso, J.D.; Pinge-Filho, P.; Perugini, M.R.E.; Yamauchi, L.M.; Yamada-Ogatta, S.F. Molecular and phenotypic characteristics of methicillin-resistant Staphylococcus aureus isolated from hospitalized patients. J. Infect. Dev. Ctries. 2015, 9, 743–751. [Google Scholar] [CrossRef]
  17. De Souza, C.S.M.; Fortaleza, C.M.C.B.; Witzel, C.L.; Silveira, M.; Bonesso, M.F.; Marques, S.A.; de Lourdes Ribeiro de Souza da Cunhaa, M. Toxigenic profile of methicillin-sensitive and resistant Staphylococcus aureus isolated from special groups. Ann. Clin. Microbiol. Antimicrob. 2016, 15. [Google Scholar] [CrossRef]
  18. Diep, B.A.; Stone, G.G.; Basuino, L.; Graber, C.J.; Miller, A.; des Etages, S.; Jones, A.; Palazzolo-Ballance, A.M.; Perdreau-Remington, F.; Sensabaugh, G.F.; et al. The Arginine Catabolic Mobile Element and Staphylococcal Chromosomal Cassette mec Linkage: Convergence of Virulence and Resistance in the USA300 Clone of Methicillin-Resistant Staphylococcus aureus. J. Infect. Dis. 2008, 197, 1523–1530. [Google Scholar] [CrossRef] [PubMed]
  19. Thurlow, L.R.; Joshi, G.S.; Clark, J.R.; Spontak, J.S.; Neely, C.J.; Maile, R.; Richardson, A.R. Functional modularity of the arginine catabolic mobile element contributes to the success of USA300 methicillin-resistant Staphylococcus aureus. Cell Host Microbe 2013, 13, 100–107. [Google Scholar] [CrossRef]
  20. Costerton, J.W.; Lewandowski, Z.; Caldwell, D.E.; Korber, D.R.; Lappin-Scott, H.M. Microbial biofilms. Annu. Rev. Microbiol. 1995, 49, 711–745. [Google Scholar] [CrossRef]
  21. Ceri, H.; Olson, M.E.; Stremick, C.; Read, R.R.; Morck, D.; Buret, A. The Calgary Biofilm Device: New Technology for Rapid Determination of Antibiotic Susceptibilities of Bacterial Biofilms. J. Clin. Microbiol. 1999, 37, 1771. [Google Scholar] [CrossRef]
  22. Brites, C.; Silva, N.; Sampaio-Sá, M. Temporal evolution of the prevalence of methicillin-resistant Staphylococcus aureus in a tertiary hospital in Bahia, Brazil: A nine-year evaluation study. Braz. J. Infect. Dis. Off. Public Braz. Soc. Infect. Dis. 2006, 10, 235–238. [Google Scholar] [CrossRef] [PubMed]
  23. Braga, E.D.V.; Aguiar-Alves, F.; de Freitas, M.D.F.N.; de e Silva, M.O.; Correa, T.V.; Snyder, R.E.; de Araújo, V.A.; Marlow, M.A.; Riley, L.W.; Setúbal, S.; et al. High prevalence of Staphylococcus aureus and methicillin-resistant S. aureus colonization among healthy children attending public daycare centers in informal settlements in a large urban center in Brazil. BMC Infect. Dis. 2014, 14, 538. [Google Scholar] [CrossRef] [PubMed]
  24. Bunnueang, N.; Kongpheng, S.; Yadrak, P.; Rattanachuay, P.; Khianngam, S.; Sukhumungoon, P. Methicillin-resistant staphylococcus aureus: 1-year collection and characterization from patients in two tertiary hospitals, southern Thailand. Southeast Asian J. Trop. Med. Public Health 2016, 47, 234–244. [Google Scholar]
  25. Ilczyszyn, W.M.; Sabat, A.J.; Akkerboom, V.; Szkarlat, A.; Klepacka, J.; Sowa-Sierant, I.; Wasik, B.; Kosecka-Strojek, M.; Buda, A.; Miedzobrodzki, J.; et al. Clonal Structure and Characterization of Staphylococcus aureus Strains from Invasive Infections in Paediatric Patients from South Poland: Association between Age, spa Types, Clonal Complexes, and Genetic Markers. PLoS ONE 2016, 11, e0151937. [Google Scholar] [CrossRef]
  26. Aung, M.S.; Urushibara, N.; Kawaguchiya, M.; Sumi, A.; Shinagawa, M.; Takahashi, S.; Kobayashi, N. Clonal Diversity and Genetic Characteristics of Methicillin-Resistant Staphylococcus aureus Isolates from a Tertiary Care Hospital in Japan. Microb. Drug Resist. (Larchmt. N. Y.) 2019, 25, 1164–1175. [Google Scholar] [CrossRef]
  27. Brust, T.; da Costa, T.M.; Amorim, J.C.; Asensi, M.D.; Fernandes, O.; Aguiar-Alves, F. Hospital-associated methicillin-resistant Staphylococcus aureus carrying the PVL gene outbreak in a Public Hospital in Rio de Janeiro, Brazil. Braz. J. Microbiol. Public Braz. Soc. Microbiol. 2013, 44, 865–868. [Google Scholar] [CrossRef][Green Version]
  28. Cavalcante, F.S.; Ferreira, D.C.; Chamon, R.C.; da Costa, T.M.; Maia, F.; Barros, E.M.; Dantas, T.S.; dos Santos, K.R.N. Daptomycin and methicillin-resistant Staphylococcus aureus isolated from a catheter-related bloodstream infection: A case report. BMC Res. Notes 2014, 7, 759. [Google Scholar] [CrossRef]
  29. Chamon, R.C.; Ribeiro, S.D.S.; da Costa, T.M.; Nouér, S.A.; dos Santos, K.R.N.; Chamon, R.C.; Ribeiro, S.D.S.; da Costa, T.M.; Nouér, S.A.; dos Santos, K.R.N. Complete substitution of the Brazilian endemic clone by other methicillin-resistant Staphylococcus aureus lineages in two public hospitals in Rio de Janeiro, Brazil. Braz. J. Infect. Dis. 2017, 21, 185–189. [Google Scholar] [CrossRef]
  30. WHO. Health Care-Associated Infections Fact Sheet; WHO: Geneva, Switzerland, 2014. [Google Scholar]
  31. Neto, E.D.A.; Guerrero, J.; Snyder, R.E.; Pereira, R.F.A.; de Fátima Nogueira de Freitas, M.; Silva-Santana, G.; Riley, L.W.; Aguiar-Alves, F. Genotypic distribution of Staphylococcus aureus colonizing children and adolescents in daycare centers, an outpatient clinic, and hospitals in a major Brazilian urban setting. Diagn. Microbiol. Infect. Dis. 2020, 97, 115058. [Google Scholar] [CrossRef]
  32. Neves, F.P.G.; Marlow, M.A.; Rezende-Pereira, G.; Pinheiro, M.G.; Dos Santos, A.F.M.; de Fátima Nogueira de Freitas, M.; Barros, R.R.; Aguiar-Alves, F.; Cardoso, C.A.A.; Riley, L.W. Differences in gram-positive bacterial colonization and antimicrobial resistance among children in a high income inequality setting. BMC Infect. Dis. 2019, 19, 478. [Google Scholar] [CrossRef]
  33. Stulik, L.; Malafa, S.; Hudcova, J.; Rouha, H.; Henics, B.Z.; Craven, D.E.; Sonnevend, A.M.; Nagy, E. α-Hemolysin activity of methicillin-susceptible Staphylococcus aureus predicts ventilator-associated pneumonia. Am. J. Respir. Crit. Care Med. 2014, 190, 1139–1148. [Google Scholar] [CrossRef]
  34. Rabelo, M.A.; Bezerra Neto, A.M.; Loibman, S.O.; da Costa Lima, J.L.; Ferreira, E.L.; Leal, N.C.; Maciel, M.A.V.; Rabelo, M.A.; Bezerra Neto, A.M.; Loibman, S.O.; et al. The occurrence and dissemination of methicillin and vancomycin-resistant Staphylococcus in samples from patients and health professionals of a university hospital in Recife, State of Pernambuco, Brazil. Rev. Soc. Bras. Med. Trop. 2014, 47, 437–446. [Google Scholar] [CrossRef] [PubMed][Green Version]
  35. Luna, C.M.; Rodríguez-Noriega, E.; Bavestrello, L.; Gotuzzo, E. Tratamento de Staphylococcus aureus resistente à meticilina na América Latina. Braz. J. Infect. Dis. 2010, 14, 119–127. [Google Scholar] [CrossRef]
  36. Peyrani, P.; Ramirez, J. What is the best therapeutic approach to methicillin-resistant Staphylococcus aureus pneumonia? Curr. Opin. Infect. Dis. 2015, 28, 164–170. [Google Scholar] [CrossRef] [PubMed]
  37. Silveira, A.C.O.; Cunha, G.R.; Caierão, J.; de Cordova, C.M.; d’Azevedo, P.A. MRSA from Santa Catarina State, Southern Brazil: Intriguing epidemiological differences compared to other Brazilian regions. Braz. J. Infect. Dis. 2015, 19, 384–389. [Google Scholar] [CrossRef] [PubMed]
  38. Oliveira, D.M.D.S.; de Andrade, D.F.R.; Ibiapina, A.R.D.S.; Gomes, H.M.D.S.; Nolêto, I.R.D.S.G.; Magalhães, R.D.L.B.; Barreto, H.M.; de Oliveira, I.P.; dos Santos, P.C.; de Freitas, D.R.J.; et al. High rates of methicillin-resistant Staphylococcus aureus colonization in a Brazilian Intensive Care Unit. Intensive Crit. Care Nurs. 2018, 49, 51–57. [Google Scholar] [CrossRef]
  39. De Carvalho, S.P.; de Almeida, J.B.; Andrade, Y.M.F.S.; da Silva, L.S.C.; de Oliveira, A.C.; Nascimento, F.S.; Campos, G.B.; Oliveira, M.V.; Timenetsky, J.; Marques, L.M. Community-acquired methicillin-resistant Staphylococcus aureus carrying SCCmec type IV and V isolated from healthy children attending public daycares in northeastern Brazil. Braz. J. Infect. Dis. Off. Public Braz. Soc. Infect. Dis. 2017, 21, 464–467. [Google Scholar] [CrossRef]
  40. Catão, R.M.R.; Pimentel, C. Artigo original prevalência de infecções hospitalares por staphylococcus aureus e perfil de suscetibilidade aos antimicrobianos. J. Nurs. UFPE 2013, 7, 5257–5264. [Google Scholar]
  41. Caboclo, R.M.F.; Cavalcante, F.S.; Iorio, N.L.P.; Schuenck, R.P.; Olendzki, A.N.; Felix, M.J.; Chamon, R.C.; dos Santos, K.R.N. Methicillin-resistant Staphylococcus aureus in Rio de Janeiro hospitals: Dissemination of the USA400/ST1 and USA800/ST5 SCCmec type IV and USA100/ST5 SCCmec type II lineages in a public institution and polyclonal presence in a private one. Am. J. Infect. Control 2013, 41, 21–26. [Google Scholar] [CrossRef]
  42. Vieira, M.T.C.; Marlow, M.A.; Aguiar-Alves, F.; Pinheiro, M.G.; de Freitas Alves, M.d.F.N.; Santos Cruz, M.L.; Saavedra Gaspar, M.C.; Rocha, R.; Velarde, L.G.C.; Araújo Cardoso, C.A. Living Conditions as a Driving Factor in Persistent Methicillin-resistant Staphylococcus aureus Colonization Among HIV-infected Youth. Pediatr. Infect. Dis. J. 2016, 35, 1126–1131. [Google Scholar] [CrossRef] [PubMed]
  43. Oliveira, D.C.; de Lencastre, H. Multiplex PCR Strategy for Rapid Identification of Structural Types and Variants of the mec Element in Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2002, 46, 2155–2161. [Google Scholar] [CrossRef] [PubMed]
  44. Scribel, L.V.; Silva-Carvalho, M.C.; Souza, R.R.; Superti, S.V.; Kvitko, C.H.C.; Figueiredo, A.M.S.; Zavascki, A.P. Clinical and molecular epidemiology of methicillin-resistant Staphylococcus aureus carrying SCCmecIV in a university hospital in Porto Alegre, Brazil. Diagn. Microbiol. Infect. Dis. 2009, 65, 457–461. [Google Scholar] [CrossRef]
  45. Cavalcante, F.S.; Abad, E.D.; Lyra, Y.C.; Saintive, S.B.; Ribeiro, M.; Ferreira, D.C.; dos Santos, K.R.N. High prevalence of methicillin resistance and PVL genes among Staphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis. Braz. J. Med. Biol. Res. 2015, 48, 588–594. [Google Scholar] [CrossRef] [PubMed]
  46. Cakır Aktas, N.; Erturan, Z.; Karatuna, O.; Karahasan Yagci, A. Panton-Valentine leukocidin and biofilm production of Staphylococcus aureus isolated from respiratory tract. J. Infect. Dev. Ctries. 2013, 7, 888–891. [Google Scholar] [CrossRef]
  47. Emaneini, M.; Khoramrooz, S.S.; Shahsavan, S.; Dabiri, H.; Jabalameli, F. Prevalence of Panton-Valentine leucocidin and phenotypic and genotypic characterization of biofilm formation among Staphylococcus aureus strains isolated from children with adenoid hypertrophy. Microb. Pathog. 2015, 89, 150–153. [Google Scholar] [CrossRef]
  48. Gogoi-Tiwari, J.; Williams, V.; Waryah, C.B.; Costantino, P.; Al-Salami, H.; Mathavan, S.; Wells, K.; Tiwari, H.K.; Hegde, N.; Isloor, S.; et al. Mammary Gland Pathology Subsequent to Acute Infection with Strong versus Weak Biofilm Forming Staphylococcus aureus Bovine Mastitis Isolates: A Pilot Study Using Non-Invasive Mouse Mastitis Model. PLoS ONE 2017, 12. [Google Scholar] [CrossRef]
  49. Vanhommerig, E.; Moons, P.; Pirici, D.; Lammens, C.; Hernalsteens, J.-P.; Greve, H.D.; Kumar-Singh, S.; Goossens, H.; Malhotra-Kumar, S. Comparison of Biofilm Formation between Major Clonal Lineages of Methicillin Resistant Staphylococcus aureus. PLoS ONE 2014, 9, e104561. [Google Scholar] [CrossRef]
  50. Urushibara, N.; Kawaguchiya, M.; Kobayashi, N. Two novel arginine catabolic mobile elements and staphylococcal chromosome cassette mec composite islands in community-acquired methicillin-resistant Staphylococcus aureus genotypes ST5-MRSA-V and ST5-MRSA-II. J. Antimicrob. Chemother. 2012, 67, 1828–1834. [Google Scholar] [CrossRef][Green Version]
  51. Hon, P.Y.; Chan, K.S.; Holden, M.T.; Harris, S.R.; Tan, T.Y.; Zu, Y.-B.; Krishnan, P.; Oon, L.L.; Koh, T.H.; Hsu, L.Y. Arginine catabolic mobile element in methicillin-resistant Staphylococcus aureus (MRSA) clonal group ST239-MRSA-III isolates in Singapore: Implications for PCR-based screening tests. Antimicrob. Agents Chemother. 2013, 57, 1563–1564. [Google Scholar] [CrossRef][Green Version]
  52. Kawaguchiya, M.; Urushibara, N.; Ghosh, S.; Kuwahara, O.; Morimoto, S.; Ito, M.; Kudo, K.; Kobayashi, N. Genetic diversity of emerging Panton-Valentine leukocidine/arginine catabolic mobile element (ACME)-positive ST8 SCCmec-IVa methicillin-resistant Staphylococcus aureus (MRSA) strains and ACME-positive CC5 (ST5/ST764) MRSA strains in Northern Japan. J. Med. Microbiol. 2013, 62, 1852–1863. [Google Scholar] [CrossRef] [PubMed]
  53. Diep, B.A.; Chan, L.; Tattevin, P.; Kajikawa, O.; Martin, T.R.; Basuino, L.; Mai, T.T.; Marbach, H.; Braughton, K.R.; Whitney, A.R.; et al. Polymorphonuclear leukocytes mediate Staphylococcus aureus Panton-Valentine leukocidin-induced lung inflammation and injury. Proc. Natl. Acad. Sci. USA 2010, 107, 5587–5592. [Google Scholar] [CrossRef] [PubMed]
  54. Diep, B.A.; Le, V.T.M.; Visram, Z.C.; Rouha, H.; Stulik, L.; Dip, E.C.; Nagy, G.; Nagy, E. Improved Protection in a Rabbit Model of Community-Associated Methicillin-Resistant Staphylococcus aureus Necrotizing Pneumonia upon Neutralization of Leukocidins in Addition to Alpha-Hemolysin. Antimicrob. Agents Chemother. 2016, 60, 6333–6340. [Google Scholar] [CrossRef]
  55. Pozzi, C.; Waters, E.M.; Rudkin, J.K.; Schaeffer, C.R.; Lohan, A.J.; Tong, P.; Loftus, B.J.; Pier, G.B.; Fey, P.D.; Massey, R.C.; et al. Methicillin resistance alters the biofilm phenotype and attenuates virulence in Staphylococcus aureus device-associated infections. PLoS Pathog. 2012, 8, e1002626. [Google Scholar] [CrossRef]
  56. Sogawa, K.; Watanabe, M.; Ishige, T.; Segawa, S.; Miyabe, A.; Murata, S.; Saito, T.; Sanda, A.; Furuhata, K.; Nomura, F. Rapid Discrimination between Methicillin-Sensitive and Methicillin-Resistant Staphylococcus aureus Using MALDI-TOF Mass Spectrometry. Biocontrol Sci. 2017, 22, 163–169. [Google Scholar] [CrossRef] [PubMed]
  57. CLSI M100-S23. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2013. [Google Scholar]
  58. Shopsin, B.; Gomez, M.; Montgomery, S.O.; Smith, D.H.; Waddington, M.; Dodge, D.E.; Bost, D.A.; Riehman, M.; Naidich, S.; Kreiswirth, B.N. Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J. Clin. Microbiol. 1999, 37, 3556–3563. [Google Scholar] [CrossRef]
  59. Enright, M.C.; Day, N.P.; Davies, C.E.; Peacock, S.J.; Spratt, B.G. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef]
  60. Deurenberg, R.H.; Vink, C.; Kalenic, S.; Friedrich, A.W.; Bruggeman, C.A.; Stobberingh, E.E. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin. Microbiol. Infect. Off. Public Eur. Soc. Clin. Microbiol. Infect. Dis. 2007, 13, 222–235. [Google Scholar] [CrossRef]
  61. Lina, G.; Piémont, Y.; Godail-Gamot, F.; Bes, M.; Peter, M.O.; Gauduchon, V.; Vandenesch, F.; Etienne, J. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. Off. Public Infect. Dis. Soc. Am. 1999, 29, 1128–1132. [Google Scholar] [CrossRef]
  62. Hoseini Alfatemi, S.M.; Motamedifar, M.; Hadi, N.; Sedigh Ebrahim Saraie, H. Analysis of Virulence Genes Among Methicillin-Resistant Staphylococcus aureus (MRSA) Strains. Jundishapur J. Microbiol. 2014, 7, e10741. [Google Scholar] [CrossRef]
  63. Stepanović, S.; Vuković, D.; Hola, V.; Di Bonaventura, G.; Djukić, S.; Cirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS Acta Pathol. Microbiol. Immunol. Scand. 2007, 115, 891–899. [Google Scholar] [CrossRef] [PubMed]
  64. Pereira, C.A.; Romeiro, R.L.; Costa, A.C.B.P.; Machado, A.K.S.; Junqueira, J.C.; Jorge, A.O.C. Susceptibility of Candida albicans, Staphylococcus aureus, and Streptococcus mutans biofilms to photodynamic inactivation: An in vitro study. Lasers Med. Sci. 2011, 26, 341–348. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.