Protective Role of Hydrogen Gas on Oxidative Damage and Apoptosis in Intestinal Porcine Epithelial Cells (IPEC-J2) Induced by Deoxynivalenol: A Preliminary Study
Abstract
:1. Introduction
2. Results
2.1. The Effects of DON on the Growth of IPEC-J2 Cells
2.2. Effects of H2 on Cell Viability and Apoptosis in DON-Induced IPEC-J2 Cells
2.3. Effects of H2 on Oxidant and Antioxidant Status in DON-Induced IPEC-J2 Cells
2.4. Effects of H2 on the Expression of Antioxidant and Apoptosis Genes in IPEC-J2 Cells Exposed to DON
2.5. H2 Reduces DON-Induced Increase of Pro-Apoptosis Caspase-3 and Bax Protein Expression in IPEC-J2 Cells
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Cell Culture
5.2. Preparation of H2-Saturated Medium
5.3. Preparation of DON
5.4. Estimation of Cytotoxic Effects of DON on IPEC-J2 Cells
5.5. Cell Treatments
5.6. Cell Viability Assay
5.7. LDH Activity Measurement
5.8. 8-OHdG and 3-NT Concentration Detection
5.9. Determination of Cellular MDA Level, and T-SOD and CAT Activities
5.10. Total RNA Isolation and Quantitative Real-Time PCR
5.11. Western Blot Analysis
5.12. Data Presentation and Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Oswald, I.; Marin, D.; Bouhet, S.; Pinton, P.; Taranu, I.; Accensi, F. Immunotoxicological risk of mycotoxins for domestic animals. Food Addit. Contam. 2005, 22, 354–360. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Jiang, L.; Geng, C.; Cao, J.; Zhong, L. The role of oxidative stress in deoxynivalenol-induced DNA damage in HepG2 cells. Toxicon 2009, 54, 513–518. [Google Scholar] [CrossRef] [PubMed]
- Dänicke, S.; Brosig, B.; Klunker, L.R.; Kahlert, S.; Kluess, J.; Döll, S.; Valenta, H.; Rothkötter, H.J. Systemic and local effects of the Fusarium toxin deoxynivalenol (DON) are not alleviated by dietary supplementation of humic substances (HS). Food Chem. Toxicol. 2012, 50, 979–988. [Google Scholar] [CrossRef] [PubMed]
- Ma, R.; Zhang, L.; Liu, M.; Su, Y.-T.; Xie, W.-M.; Zhang, N.-Y.; Dai, J.-F.; Wang, Y.; Rajput, S.A.; Qi, D.S. Individual and combined occurrence of mycotoxins in feed ingredients and complete feeds in China. Toxins 2018, 10, 113. [Google Scholar] [CrossRef] [Green Version]
- Pestka, J.J. Mechanisms of deoxynivalenol-induced gene expression and apoptosis. Food Addit. Contam. 2008, 25, 1128–1140. [Google Scholar] [CrossRef]
- Prelusky, D.; Hartin, K.; Trenholm, H.; Miller, J. Pharmacokinetic fate of 14C-labeled deoxynivalenol in swine. Toxicol. Sci. 1988, 10, 276–286. [Google Scholar] [CrossRef]
- Wu, Q.H.; Wang, X.; Yang, W.; Nüssler, A.K.; Xiong, L.Y.; Kuča, K.; Dohnal, V.; Zhang, X.J.; Yuan, Z.H. Oxidative stress-mediated cytotoxicity and metabolism of T-2 toxin and deoxynivalenol in animals and humans: An update. Arch. Toxicol. 2014, 88, 1309–1326. [Google Scholar] [CrossRef]
- Osselaere, A.; Santos, R.; Hautekiet, V.; De Backer, P.; Chiers, K.; Ducatelle, R.; Croubels, S. Deoxynivalenol impairs hepatic and intestinal gene expression of selected oxidative stress, tight junction and inflammation proteins in broiler chickens, but addition of an adsorbing agent shifts the effects to the distal parts of the small intestine. PLoS ONE 2013, 8, e69014. [Google Scholar] [CrossRef] [Green Version]
- Diesing, A.K.; Nossol, C.; Ponsuksili, S.; Wimmers, K.; Kluess, J.; Walk, N.; Post, A.; Rothkötter, H.J.; Kahlert, S. Gene regulation of intestinal porcine epithelial cells IPEC-J2 is dependent on the site of deoxynivalenol toxicological action. PLoS ONE 2012, 7, e34136. [Google Scholar] [CrossRef] [Green Version]
- Ostojic, S.M. Non-gut microbiota as a source of bioactive hydrogen. Postgrad. Med. J. 2017, 93, 170. [Google Scholar] [CrossRef]
- Ohsawa, I.; Ishikawa, M.; Takahashi, K.; Watanabe, M.; Nishimaki, K.; Yamagata, K.; Katsura, K.I.; Katayama, Y.; Asoh, S.; Ohta, S. Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals. Nat. Med. 2007, 13, 688. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.-S.; Kawamura, T.; Toyoda, Y.; Nakao, A. Recent advances in hydrogen research as a therapeutic medical gas. Free Radic. Res. 2010, 44, 971–982. [Google Scholar] [CrossRef] [PubMed]
- Ohta, S. Molecular hydrogen as a preventive and therapeutic medical gas: Initiation, development and potential of hydrogen medicine. Pharmacol. Ther. 2014, 144, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, J.; Xiong, S.; Zhang, J.; Wang, J.; Sun, A.; Mei, X.; Sun, X.; Zhang, C.; Wang, Q. Protective effects of hydrogen-rich saline on ulcerative colitis rat model. J. Surg. Res. 2013, 185, 174–181. [Google Scholar] [CrossRef]
- Kajiya, M.; Silva, M.J.; Sato, K.; Ouhara, K.; Kawai, T. Hydrogen mediates suppression of colon inflammation induced by dextran sodium sulfate. Biochem. Biophys. Res. Commun. 2009, 386, 11–15. [Google Scholar] [CrossRef]
- Zheng, X.; Zheng, X.; Mao, Y.; Cai, J.; Li, Y.; Liu, W.; Sun, P.; Zhang, J.H.; Sun, X.; Yuan, H. Hydrogen-rich saline protects against intestinal ischemia/reperfusion injury in rats. Free Radic. Res. 2009, 43, 478–484. [Google Scholar] [CrossRef]
- Yu, Y.; Ma, X.; Yang, T.; Li, B.; Xie, K.; Liu, D.; Wang, G.; Yu, Y. Protective effect of hydrogen-rich medium against high glucose-induced apoptosis of Schwann cells in vitro. Mol. Med. Rep. 2015, 12, 3986–3992. [Google Scholar] [CrossRef] [Green Version]
- Yu, P.; Wang, Z.; Sun, X.; Chen, X.; Zeng, S.; Chen, L.; Li, S. Hydrogen-rich medium protects human skin fibroblasts from high glucose or mannitol induced oxidative damage. Biochem. Biophys. Res. Commun. 2011, 409, 350–355. [Google Scholar] [CrossRef]
- Xie, Q.; Li, X.X.; Zhang, P.; Li, J.C.; Cheng, Y.; Feng, Y.L.; Huang, B.S.; Zhuo, Y.F.; Xu, G.H. Hydrogen gas protects against serum and glucose deprivation-induced myocardial injury in H9c2 cells through activation of the NF-E2-related factor 2/heme oxygenase 1 signaling pathway. Mol. Med. Rep. 2014, 10, 1143–1149. [Google Scholar] [CrossRef]
- Brosnahan, A.J.; Brown, D.R. Porcine IPEC-J2 intestinal epithelial cells in microbiological investigations. Vet. Microbiol. 2012, 156, 229–237. [Google Scholar] [CrossRef] [Green Version]
- Diesing, A.K.; Nossol, C.; Panther, P.; Walk, N.; Post, A.; Kluess, J.; Kreutzmann, P.; Dänicke, S.; Rothkötter, H.J.; Kahlert, S. Mycotoxin deoxynivalenol (DON) mediates biphasic cellular response in intestinal porcine epithelial cell lines IPEC-1 and IPEC-J2. Toxicol. Lett. 2011, 200, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Springler, A.; Hessenberger, S.; Reisinger, N.; Kern, C.; Nagl, V.; Schatzmayr, G.; Mayer, E. Deoxynivalenol and its metabolite deepoxy-deoxynivalenol: Multi-parameter analysis for the evaluation of cytotoxicity and cellular effects. Mycotoxin Res. 2017, 33, 25–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, X.; Zhang, Q.; Zheng, W.; Yao, W. Morphological and molecular response of small intestine to lactulose and hydrogen-rich water in female piglets fed Fusarium mycotoxins contaminated diet. J. Anim. Sci. Biotechnol. 2019, 10, 9. [Google Scholar] [CrossRef] [PubMed]
- Zheng, W.; Ji, X.; Zhang, Q.; Du, W.; Wei, Q.; Yao, W. Hydrogen-rich water and lactulose protect against growth suppression and oxidative stress in female piglets fed Fusarium toxins contaminated diets. Toxins 2018, 10, 228. [Google Scholar] [CrossRef] [Green Version]
- Gutierrez-Pajares, J.L.; Iturrieta, J.; Dulam, V.; Wang, Y.; Pavlides, S.; Malacari, G.; Lisanti, M.P.; Frank, P.G. Caveolin-3 promotes a vascular smooth muscle contractile phenotype. Front. Cardiovasc. Med. 2015, 2, 27. [Google Scholar] [CrossRef] [Green Version]
- Awad, W.; Aschenbach, J.; Zentek, J. Cytotoxicity and metabolic stress induced by deoxynivalenol in the porcine intestinal IPEC-J2 cell line. J. Anim. Physiol. Anim. Nutr. 2012, 96, 709–716. [Google Scholar] [CrossRef]
- Clevers, H. The intestinal crypt, a prototype stem cell compartment. Cell 2013, 154, 274–284. [Google Scholar] [CrossRef] [Green Version]
- Van De Walle, J.; Sergent, T.; Piront, N.; Toussaint, O.; Schneider, Y.-J.; Larondelle, Y. Deoxynivalenol affects in vitro intestinal epithelial cell barrier integrity through inhibition of protein synthesis. Toxicol. Appl. Pharmacol. 2010, 245, 291–298. [Google Scholar] [CrossRef]
- Maresca, M. From the gut to the brain: Journey and pathophysiological effects of the food-associated trichothecene mycotoxin deoxynivalenol. Toxins 2013, 5, 784–820. [Google Scholar] [CrossRef]
- Maresca, M.; Pinton, P.; Ajandouz, E.H.; Menard, S.; Ferrier, L.; Oswald, I.P. Overview and comparison of intestinal organotypic models, intestinal cells, and intestinal explants used for toxicity studies. In Current Topics in Microbiology and Immunology; Ahmed, R., Akira, S., Aktories, K., Casadevall, A., Compans, R.W., Galan, J.E., Garcia-Sastre, A., Malissen, B., Rappuoli, R., Eds.; Springer: Heidelberg, Germany, 2018; pp. 1–18. Available online: https://link.springer.com/chapter/10.1007/82_2018_142 (accessed on 28 September 2018).
- Li, R.; Li, Y.; Su, Y.; Shen, D.; Dai, P.; Li, C. Short-term ingestion of deoxynivalenol in naturally contaminated feed alters piglet performance and gut hormone secretion. Anim. Sci. J. 2018, 89, 1134–1143. [Google Scholar] [CrossRef]
- Murakami, Y.; Ito, M.; Ohsawa, I. Molecular hydrogen protects against oxidative stress-induced SH-SY5Y neuroblastoma cell death through the process of mitohormesis. PLoS ONE 2017, 12, e0176992. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.; Yang, G.; Kim, Y.-J.; Tran, Q.H.; Choe, W.; Kang, I.; Kim, S.S.; Ha, J. Hydrogen-rich medium protects mouse embryonic fibroblasts from oxidative stress by activating LKB1-AMPK-FoxO1 signal pathway. Biochem. Biophys. Res. Commun. 2017, 491, 733–739. [Google Scholar] [CrossRef] [PubMed]
- Hara, F.; Tatebe, J.; Watanabe, I.; Yamazaki, J.; Ikeda, T.; Morita, T. Molecular hydrogen alleviates cellular senescence in endothelial cells. Circ. J. 2016, 80, 2037–2046. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dänicke, S.; Valenta, H.; Döll, S. On the toxicokinetics and the metabolism of deoxynivalenol (DON) in the pig. Arch. Anim. Nutr. 2004, 58, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Sergent, T.; Parys, M.; Garsou, S.; Pussemier, L.; Schneider, Y.-J.; Larondelle, Y. Deoxynivalenol transport across human intestinal Caco-2 cells and its effects on cellular metabolism at realistic intestinal concentrations. Toxicol. Lett. 2006, 164, 167–176. [Google Scholar] [CrossRef]
- Wu, Q.; Wang, X.; Nepovimova, E.; Wang, Y.; Yang, H.; Li, L.; Zhang, X.; Kuca, K. Antioxidant agents against trichothecenes: New hints for oxidative stress treatment. Oncotarget 2017, 8, 110708. [Google Scholar] [CrossRef] [Green Version]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef]
- Rai, B.; Kaur, J.; Jacobs, R.; Singh, J. Possible action mechanism for curcumin in pre-cancerous lesions based on serum and salivary markers of oxidative stress. J. Oral Sci. 2010, 52, 251–256. [Google Scholar] [CrossRef] [Green Version]
- Teixeira, D.; Fernandes, R.; Prudêncio, C.; Vieira, M. 3-Nitrotyrosine quantification methods: Current concepts and future challenges. Biochimie 2016, 125, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef]
- Kouadio, J.H.; Mobio, T.A.; Baudrimont, I.; Moukha, S.; Dano, S.D.; Creppy, E.E. Comparative study of cytotoxicity and oxidative stress induced by deoxynivalenol, zearalenone or fumonisin B1 in human intestinal cell line Caco-2. Toxicology 2005, 213, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.L.; Zhang, K.; Chen, G. Hydrogen therapy: From mechanism to cerebral diseases. Med. Gas Res. 2016, 6, 48. [Google Scholar] [PubMed]
- Zheng, X.F.; Sun, X.J.; Xia, Z.F. Hydrogen resuscitation, a new cytoprotective approach. Clin. Exp. Pharmacol. Physiol. 2011, 38, 155–163. [Google Scholar] [CrossRef] [PubMed]
- Ohsawa, I.; Nishimaki, K.; Yamagata, K.; Ishikawa, M.; Ohta, S. Consumption of hydrogen water prevents atherosclerosis in apolipoprotein E knockout mice. Biochem. Biophys. Res. Commun. 2008, 377, 1195–1198. [Google Scholar] [CrossRef] [PubMed]
- Ning, Y.; Shang, Y.; Huang, H.; Zhang, J.; Dong, Y.; Xu, W.; Li, Q. Attenuation of cigarette smoke-induced airway mucus production by hydrogen-rich saline in rats. PLoS ONE 2013, 8, e83429. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Fu, Z.; Wei, Y.; Liu, J.; Cui, X.; Yang, W.; Ding, W.; Pan, P.; Li, W. Hydrogen inhalation decreases lung graft injury in brain-dead donor rats. J. Heart Lung Transplant. 2013, 32, 251–258. [Google Scholar] [CrossRef]
- Yu, J.; Zhang, W.; Zhang, R.; Jiang, G.; Tang, H.; Ruan, X.; Ren, P.; Lu, B. Molecular hydrogen attenuates hypoxia/reoxygenation injury of intrahepatic cholangiocytes by activating Nrf2 expression. Toxicol. Lett. 2015, 238, 11–19. [Google Scholar] [CrossRef]
- Wang, J.L.; Zhang, Q.S.; Kai-di Zhu, J.F.; Zhang, Z.P.; Sun, J.W.; Zhang, K.X. Hydrogen-rich saline injection into the subarachnoid cavity within 2 weeks promotes recovery after acute spinal cord injury. Neural Regen. Res. 2015, 10, 958. [Google Scholar]
- Bensassi, F.; Gallerne, C.; El Dein, O.S.; Lemaire, C.; Hajlaoui, M.R.; Bacha, H. Involvement of mitochondria-mediated apoptosis in deoxynivalenol cytotoxicity. Food Chem. Toxicol. 2012, 50, 1680–1689. [Google Scholar] [CrossRef]
- Bianco, G.; Fontanella, B.; Severino, L.; Quaroni, A.; Autore, G.; Marzocco, S. Nivalenol and deoxynivalenol affect rat intestinal epithelial cells: A concentration related study. PLoS ONE 2012, 7, e52051. [Google Scholar] [CrossRef]
- Jiang, H.; Yu, P.; Qian, D.H.; Qin, Z.X.; Sun, X.J.; Yu, J.; Huang, L. Hydrogen-rich medium suppresses the generation of reactive oxygen species, elevates the Bcl-2/Bax ratio and inhibits advanced glycation end product-induced apoptosis. Int. J. Mol. Med. 2013, 31, 1381–1387. [Google Scholar] [CrossRef] [PubMed]
- Zheng, W.; Ji, X.; Zhang, Q.; Yao, W. Intestinal microbiota ecological response to oral administrations of hydrogen-rich water and lactulose in female piglets fed a Fusarium toxin-contaminated diet. Toxins 2018, 10, 246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xing, Y.; Li, Q.Z.; Jian, L.; Qing, H.Y.; Qian, Y. Doxycycline induces mitophagy and suppresses production of interferon-β in IPEC-J2 cells. Front. Cell. Infect. Microbiol. 2017, 7, 21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Target Genes | Primer Sequence (5′–3′) | Accession Number | Size |
---|---|---|---|
CAT | CTTGGAACATTGTACCCGCT | NM_214301.2 | 241 |
GTCCAGAAGAGCCTGAATGC | |||
Mn-SOD | GGACAAATCTGAGCCCTAACG | NM_214127.2 | 159 |
CCTTGTTGAAACCGAGCC | |||
CuZn-SOD | CAGGTCCTCACTTCAATCC | NM_001190422 | 255 |
CCAAACGACTTCCASCAT | |||
Caspase-3 | GTGGGACTGAAGATGACA | NM_214131.1 | 190 |
ACCCGAGTAAGAATGTG | |||
Bcl-2 | TCCAGAACCTCCTTGGTCCT | XM_021099593.1 | 187 |
AACTACAGCGAGGTGCTTCC | |||
Bax | TTTCTGACGGCAACTTCAACTG | XM_003127290.5 | 236 |
AGCCACAAAGATGGTCACTGTCT | |||
β-actin | GGACTTCGAGCAGGAGATGG | XM_003357928.4 | 233 |
GCACCGTGTTGGCGTAGAGG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ji, X.; Zheng, W.; Yao, W. Protective Role of Hydrogen Gas on Oxidative Damage and Apoptosis in Intestinal Porcine Epithelial Cells (IPEC-J2) Induced by Deoxynivalenol: A Preliminary Study. Toxins 2020, 12, 5. https://doi.org/10.3390/toxins12010005
Ji X, Zheng W, Yao W. Protective Role of Hydrogen Gas on Oxidative Damage and Apoptosis in Intestinal Porcine Epithelial Cells (IPEC-J2) Induced by Deoxynivalenol: A Preliminary Study. Toxins. 2020; 12(1):5. https://doi.org/10.3390/toxins12010005
Chicago/Turabian StyleJi, Xu, Weijiang Zheng, and Wen Yao. 2020. "Protective Role of Hydrogen Gas on Oxidative Damage and Apoptosis in Intestinal Porcine Epithelial Cells (IPEC-J2) Induced by Deoxynivalenol: A Preliminary Study" Toxins 12, no. 1: 5. https://doi.org/10.3390/toxins12010005