Oat Fiber Alleviates Loperamide-Induced Constipation in Mice by Modulating Intestinal Barrier Function
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Instruments
2.2. Experimental Methods
2.2.1. Solution Preparation
2.2.2. Grouping of Animals
2.2.3. Determination of Fecal Water Content
2.2.4. Determination of the Time of First Melena
2.2.5. Determination of the Intestinal Propulsive Rate
2.2.6. Determination of Serum Gastrointestinal Hormone Levels
2.2.7. HE Staining Method of Small Intestine
2.2.8. Determination of Intestinal Aquaporin-Related Gene Transcription Levels
2.2.9. Determination of Gut Microbiota in Mice
2.3. Data Processing
3. Results
3.1. Effects of Oat Fiber on Body Weight in Mice
3.2. Effects of Oat Fiber on Defecation in Mice
3.3. Effect of Oat Fiber on Small Intestinal Propulsion Rate in Mice
3.4. Effects of Oat Fiber on Gastrointestinal Regulatory Peptides in Mice
3.5. Effect of Oat Fiber on Serum 5-HT in Mice
3.6. Oat Fiber Alleviated Intestinal Tissue Cell Damage and Colonic Tissue Inflammation in Constipated Mice
3.7. Effect of Oat Fiber on Aquaporin Gene Transcript Levels in the Intestine of Constipated Mice
3.8. Effect of Oat Fiber on the Diversity of Gut Microbiota in Mice
3.8.1. Alpha Diversity Analysis
3.8.2. Beta Diversity Analysis
3.8.3. Analysis of Phylum Level
3.8.4. Analysis of Genus Level
3.8.5. Correlation Analysis of Intestinal Flora with Serum Indexes and Intestinal Aquaporins
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bharucha, A.E.; Lacy, B.E. Mechanisms, Evaluation, and Management of Chronic Constipation. Gastroenterology 2020, 158, 1232–1249.e3. [Google Scholar] [CrossRef]
- Aziz, I.; Whitehead, W.E.; Palsson, O.S.; Törnblom, H.; Simrén, M. An Approach to the Diagnosis and Management of Rome IV Functional Disorders of Chronic Constipation. Expert. Rev. Gastroenterol. Hepatol. 2020, 14, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Forootan, M.; Bagheri, N.; Darvishi, M. Chronic Constipation: A Review of Literature. Medicine 2018, 97, e10631. [Google Scholar] [CrossRef] [PubMed]
- Corsetti, M.; Brown, S.; Chiarioni, G.; Dimidi, E.; Dudding, T.; Emmanuel, A.; Fox, M.; Ford, A.C.; Giordano, P.; Grossi, U.; et al. Chronic Constipation in Adults: Contemporary Perspectives and Clinical Challenges. 2: Conservative, Behavioural, Medical and Surgical Treatment. Neurogastroenterol. Motil. 2021, 33, e14070. [Google Scholar] [CrossRef] [PubMed]
- Korczak, R.; Slavin, J.L. Definitions, Regulations, and New Frontiers for Dietary Fiber and Whole Grains. Nutr. Rev. 2020, 78, 6–12. [Google Scholar] [CrossRef]
- Bellini, M.; Tonarelli, S.; Barracca, F.; Rettura, F.; Pancetti, A.; Ceccarelli, L.; Ricchiuti, A.; Costa, F.; De Bortoli, N.; Marchi, S.; et al. Chronic Constipation: Is a Nutritional Approach Reasonable? Nutrients 2021, 13, 3386. [Google Scholar] [CrossRef]
- Portincasa, P.; Bonfrate, L.; Vacca, M.; De Angelis, M.; Farella, I.; Lanza, E.; Khalil, M.; Wang, D.Q.-H.; Sperandio, M.; Di Ciaula, A. Gut Microbiota and Short Chain Fatty Acids: Implications in Glucose Homeostasis. Int. J. Mol. Sci. 2022, 23, 1105. [Google Scholar] [CrossRef]
- Li, G.; Wang, Q.; Qian, Y.; Zhou, Y.; Wang, R.; Zhao, X. Component Analysis of Pu-Erh and Its Anti-Constipation Effects. Mol. Med. Rep. 2014, 9, 2003–2009. [Google Scholar] [CrossRef]
- Yin, J.; Liang, Y.; Wang, D.; Yan, Z.; Yin, H.; Wu, D.; Su, Q. Naringenin Induces Laxative Effects by Upregulating the Expression Levels of C-Kit and SCF, as Well as Those of Aquaporin 3 in Mice with Loperamide-Induced Constipation. Int. J. Mol. Med. 2017, 41, 649–658. [Google Scholar] [CrossRef]
- Thies, F.; Masson, L.F.; Boffetta, P.; Kris-Etherton, P. Oats and Bowel Disease: A Systematic Literature Review. Br. J. Nutr. 2014, 112, S31–S43. [Google Scholar] [CrossRef]
- Wang, L.; Chai, M.; Wang, J.; Yu, Q.; Wang, G.; Zhang, H.; Zhao, J.; Chen, W. Bifidobacterium longum Relieves Constipation by Regulating the Intestinal Barrier of Mice. Food Funct. 2022, 13, 5037–5049. [Google Scholar] [CrossRef]
- Elisei, W.; Tursi, A. The Pathophysiology of Colonic Diverticulosis: Inflammation versus Constipation? Inflamm. Intest. Dis. 2018, 3, 55–60. [Google Scholar] [CrossRef]
- Di Rosa, C.; Altomare, A.; Terrigno, V.; Carbone, F.; Tack, J.; Cicala, M.; Guarino, M. Constipation-Predominant Irritable Bowel Syndrome (IBS-C): Effects of Different Nutritional Patterns on Intestinal Dysbiosis and Symptoms. Nutrients 2023, 15, 1647. [Google Scholar] [CrossRef]
- Gao, H.; Song, R.-J.; Jiang, H.; Zhang, W.; Han, S.-F. Oat Fiber Supplementation Alleviates Intestinal Inflammation and Ameliorates Intestinal Mucosal Barrier via Acting on Gut Microbiota-Derived Metabolites in LDLR–/– Mice. Nutrition 2022, 95, 111558. [Google Scholar] [CrossRef] [PubMed]
- Huo, R.; Zhang, M.; Zhang, Y.; Bai, X.; Zhang, Y.; Guo, X. Effects of Oat Complex High-Fiber Formula Powder on the Composition of Intestinal Microbiota and Enzyme Activities in Mice Induced by a High-Fat Diet. Front. Nutr. 2022, 9, 871556. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Wang, Q.; Niu, M.; Yang, H.; Zhao, S. Protective Effects of Insoluble Dietary Fiber from Cereal Bran against DSS-Induced Chronic Colitis in Mice: From Inflammatory Responses, Oxidative Stress, Intestinal Barrier, and Gut Microbiota. Int. J. Biol. Macromol. 2024, 283, 137846. [Google Scholar] [CrossRef] [PubMed]
- Holscher, H.D. Dietary Fiber and Prebiotics and the Gastrointestinal Microbiota. Gut Microbes 2017, 8, 172–184. [Google Scholar] [CrossRef]
- Guan, Z.-W.; Yu, E.-Z.; Feng, Q. Soluble Dietary Fiber, One of the Most Important Nutrients for the Gut Microbiota. Molecules 2021, 26, 6802. [Google Scholar] [CrossRef]
- Tanes, C.; Bittinger, K.; Gao, Y.; Friedman, E.S.; Nessel, L.; Roy Paladhi, U.; Chau, L.; Panfen, E.; Fischbach, M.A.; Braun, J.; et al. Role of Dietary Fiber in the Recovery of the Human Gut Microbiome and Its Metabolome. Cell Host Microbe 2021, 29, 394–407.e5. [Google Scholar] [CrossRef]
- Cronin, P.; Joyce, S.A.; O’Toole, P.W.; O’Connor, E.M. Dietary Fibre Modulates the Gut Microbiota. Nutrients 2021, 13, 1655. [Google Scholar] [CrossRef]
- Feng, C.; Gao, G.; Wu, K.; Weng, X. Causal Relationship between Gut Microbiota and Constipation: A Bidirectional Mendelian Randomization Study. Front. Microbiol. 2024, 15, 1438778. [Google Scholar] [CrossRef]
- Ma, T.; Yang, N.; Xie, Y.; Li, Y.; Xiao, Q.; Li, Q.; Jin, H.; Zheng, L.; Sun, Z.; Zuo, K.; et al. Effect of the Probiotic Strain, Lactiplantibacillus Plantarum P9, on Chronic Constipation: A Randomized, Double-Blind, Placebo-Controlled Study. Pharmacol. Res. 2023, 191, 106755. [Google Scholar] [CrossRef] [PubMed]
- Tuohongerbieke, A.; Wang, H.; Wu, J.; Wang, Z.; Dong, T.; Huang, Y.; Zhu, D.; Sun, D.; Tsim, K.W.K. Xiao Cheng Qi Decoction, an Ancient Chinese Herbal Mixture, Relieves Loperamide-Induced Slow-Transit Constipation in Mice: An Action Mediated by Gut Microbiota. Pharmaceuticals 2024, 17, 153. [Google Scholar] [CrossRef] [PubMed]
- Hao, M.; Song, J.; Zhai, X.; Cheng, N.; Xu, C.; Gui, S.; Chen, J. Improvement of Loperamide-Hydrochloride-Induced Intestinal Motility Disturbance by Platycodon Grandiflorum Polysaccharides through Effects on Gut Microbes and Colonic Serotonin. Front. Cell. Infect. Microbiol. 2023, 13, 1105272. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zu, Q.; Zhang, J.; Liu, S.; Zhang, G.; Chang, X.; Li, X. Soluble Dietary Fiber of Hawthorn Relieves Constipation Induced by Loperamide Hydrochloride by Improving Intestinal Flora and Inflammation, Thereby Regulating the Aquaporin Ion Pathway in Mice. Foods 2024, 13, 2220. [Google Scholar] [CrossRef]
- Li, X.; Liu, Y.; Guan, W.; Xia, Y.; Zhou, Y.; Yang, B.; Kuang, H. Physicochemical Properties and Laxative Effects of Polysaccharides from Anemarrhena Asphodeloides Bge. in Loperamide-Induced Rats. J. Ethnopharmacol. 2019, 240, 111961. [Google Scholar] [CrossRef]
- Mori, H.; Verbeure, W.; Tanemoto, R.; Sosoranga, E.R.; Tack, J. Physiological Functions and Potential Clinical Applications of Motilin. Peptides 2023, 160, 170905. [Google Scholar] [CrossRef]
- Liu, Z.; Luo, Y.; Cheng, Y.; Zou, D.; Zeng, A.; Yang, C.; Xu, J.; Zhan, H. Gastrin Attenuates Ischemia-Reperfusion-Induced Intestinal Injury in Rats. Exp. Biol. Med. 2016, 241, 873–881. [Google Scholar] [CrossRef]
- Zhang, C.; Wang, L.; Liu, X.; Wang, G.; Guo, X.; Liu, X.; Zhao, J.; Chen, W. The Different Ways Multi-Strain Probiotics with Different Ratios of Bifidobacterium and Lactobacillus Relieve Constipation Induced by Loperamide in Mice. Nutrients 2023, 15, 4230. [Google Scholar] [CrossRef]
- Wu, Y.; Li, Q.; Cao, J.; Fan, F.; Gan, L.; Wu, R.; Jin, J.; Chen, R.; Sun, L.; Zhang, Z.; et al. Aged Black Tea Alleviates Constipation in Mice by Modulating Intestinal Neurotransmitters and Decreasing AQP3 and AQP9 Expression. Food Nutr. Res. 2023, 67, 10–29219. [Google Scholar] [CrossRef]
- Wang, J.; Liang, Q.; Zhao, Q.; Tang, Q.; Ahmed, A.F.; Zhang, Y.; Kang, W. The Effect of Microbial Composition and Proteomic on Improvement of Functional Constipation by Chrysanthemum Morifolium Polysaccharide. Food Chem. Toxicol. 2021, 153, 112305. [Google Scholar] [CrossRef] [PubMed]
- O’Mahony, S.M.; Clarke, G.; Borre, Y.E.; Dinan, T.G.; Cryan, J.F. Serotonin, Tryptophan Metabolism and the Brain-Gut-Microbiome Axis. Behav. Brain Res. 2015, 277, 32–48. [Google Scholar] [CrossRef] [PubMed]
- Guzel, T.; Mirowska-Guzel, D. The Role of Serotonin Neurotransmission in Gastrointestinal Tract and Pharmacotherapy. Molecules 2022, 27, 1680. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Sun, S.; Wang, P.; Sun, Y.; Hu, Q.; Wang, X. The Mechanism of Secretion and Metabolism of Gut-Derived 5-Hydroxytryptamine. Int. J. Mol. Sci. 2021, 22, 7931. [Google Scholar] [CrossRef]
- Chen, J.-Q.; Li, D.-W.; Chen, Y.-Y.; Tao, H.-J.; Pu, Z.-J.; Zhang, J.; Tan, Y.-J.; Shi, X.-Q.; Yue, S.-J.; Zhou, G.-S.; et al. Elucidating Dosage-Effect Relationship of Different Efficacy of Rhubarb in Constipation Model Rats by Factor Analysis. J. Ethnopharmacol. 2019, 238, 111868. [Google Scholar] [CrossRef]
- Jones, L.A.; Sun, E.W.; Martin, A.M.; Keating, D.J. The Ever-Changing Roles of Serotonin. Int. J. Biochem. Cell Biol. 2020, 125, 105776. [Google Scholar] [CrossRef]
- Gao, H.; He, C.; Hua, R.; Liang, C.; Wang, B.; Du, Y.; Xin, S.; Guo, Y.; Gao, L.; Zhang, L.; et al. Underlying Beneficial Effects of Rhubarb on Constipation-Induced Inflammation, Disorder of Gut Microbiome and Metabolism. Front. Pharmacol. 2022, 13, 1048134. [Google Scholar] [CrossRef]
- Gao, C.; Gao, Z.; Greenway, F.L.; Burton, J.H.; Johnson, W.D.; Keenan, M.J.; Enright, F.M.; Martin, R.J.; Chu, Y.; Zheng, J. Oat Consumption Reduced Intestinal Fat Deposition and Improved Health Span in Caenorhabditis Elegans Model. Nutr. Res. 2015, 35, 834–843. [Google Scholar] [CrossRef]
- Zhou, C.Z.C.; Anderson, G.H.; Fan, W.; Vien, S.; Ai, Y.; Tulbek, M.; Fabek, H. Increasing Particle Size of Oat Flours Decreases Postprandial Glycemia and Increases Appetite in Healthy Adults. Nutr. Res. 2024, 130, 81–94. [Google Scholar] [CrossRef]
- Amerizadeh, A.; Ghaheh, H.S.; Vaseghi, G.; Farajzadegan, Z.; Asgary, S. Effect of Oat (Avena sativa L.) Consumption on Lipid Profile with Focus on Triglycerides and High-Density Lipoprotein Cholesterol (HDL-C): An Updated Systematic Review. Curr. Probl. Cardiol. 2023, 48, 101153. [Google Scholar] [CrossRef]












| Component | Volume |
|---|---|
| 5 × SweScript All-in-One SuperMix for qPCR | 4 μL |
| gDNA Remover | 1 μL |
| Total RNA * | 10 μL |
| Nuclease-Free Water | Add to 20 μL |
| Target Gene | Primer Sequence (5′−3′) | |
|---|---|---|
| Forward | Reverse | |
| AQP4 | CAGCATCGCTAAGTCCGTCT | GACTCCCAATCCTCCAACCA |
| AQP8 | GAATAGTCCGAATACTGGGCTCCT | GTTGAAGTGTCCACCGCTGATG |
| Groups | Before Modeling | After Modeling | After Intervention |
|---|---|---|---|
| CON | 23.13 ± 0.61 a | 25.53 ± 0.73 a | 27.37 ± 1.08 a |
| MODEL | 22.68 ± 0.80 a | 21.32 ± 0.88 b | 18.82 ± 1.39 b |
| LOW | 23.32 ± 1.14 a | 22.10 ± 1.19 b | 23.37 ± 1.33 c |
| MIDDLE | 22.92 ± 0.58 a | 21.92 ± 0.56 b | 23.98 ± 0.39 c |
| HIGH | 23.20 ± 0.72 a | 22.08 ± 0.73 b | 24.83 ± 0.76 c |
| Groups | Number of Fecal Pellets (Pellets/3 H) | Fecal Moisture Content (%) | Time to First Black Stool (min) |
|---|---|---|---|
| CON | 20.17 ± 2.23 a | 60.17 ± 1.21 a | 140.33 ± 6.56 d |
| MODEL | 3.50 ± 1.05 c | 40.33 ± 2.78 d | 301.83 ± 20.61 a |
| LOW | 10.67 ± 2.50 b | 48.45 ± 0.79 c | 230.33 ± 14.25 b |
| MIDDLE | 13.50 ± 2.26 b | 50.25 ± 1.13 c | 214.67 ± 4.72 b |
| HIGH | 14.67 ± 2.50 b | 55.59 ± 0.56 b | 193.50 ± 4.85 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, Y.; Han, Y.; Jiang, J.; Wang, D.; Li, Z.; Sun, G.; Wang, S.; Liao, W.; Xia, H.; Pan, D.; et al. Oat Fiber Alleviates Loperamide-Induced Constipation in Mice by Modulating Intestinal Barrier Function. Nutrients 2025, 17, 2481. https://doi.org/10.3390/nu17152481
Shi Y, Han Y, Jiang J, Wang D, Li Z, Sun G, Wang S, Liao W, Xia H, Pan D, et al. Oat Fiber Alleviates Loperamide-Induced Constipation in Mice by Modulating Intestinal Barrier Function. Nutrients. 2025; 17(15):2481. https://doi.org/10.3390/nu17152481
Chicago/Turabian StyleShi, Yufei, Yuchao Han, Jie Jiang, Di Wang, Zhongxia Li, Guiju Sun, Shaokang Wang, Wang Liao, Hui Xia, Da Pan, and et al. 2025. "Oat Fiber Alleviates Loperamide-Induced Constipation in Mice by Modulating Intestinal Barrier Function" Nutrients 17, no. 15: 2481. https://doi.org/10.3390/nu17152481
APA StyleShi, Y., Han, Y., Jiang, J., Wang, D., Li, Z., Sun, G., Wang, S., Liao, W., Xia, H., Pan, D., & Yang, L. (2025). Oat Fiber Alleviates Loperamide-Induced Constipation in Mice by Modulating Intestinal Barrier Function. Nutrients, 17(15), 2481. https://doi.org/10.3390/nu17152481

