Gut Microbiota-Derived Tryptophan Metabolite Indole-3-aldehyde Ameliorates Aortic Dissection
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Tissue Fixation and Paraffin Embedding
2.3. Hematoxylin and Eosin (HE) Staining, Elastic Van Gieson (EVG) Staining, and Immunofluorescence Staining (IF)
2.4. Blood Pressure Measurement
2.5. Gelatin Zymography Assay
2.6. Cell Culture
2.7. Western Blot
2.8. Real-Time Quantitative PCR (Q-PCR)
2.9. Statistical Analysis
3. Results
3.1. Indole-3-aldehyde (3-IAId) Significantly Mitigates β-Aminopropionitrile Monofumarate (BAPN)-Induced Aortic Dissection (AD) Development in Mice
3.2. 3-IAId Inhibits the Transition of Contractile VSMCs to Synthetic VSMCs
3.3. 3-IAId Blunts Extracellular Matrix Degradation of the Aorta
3.4. 3-IAId Alleviates Inflammation in the Aorta
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nienaber, C.A.; Clough, R.E.; Sakalihasan, N.; Suzuki, T.; Gibbs, R.; Mussa, F.; Jenkins, M.P.; Thompson, M.M.; Evangelista, A.; Yeh, J.S.; et al. Aortic dissection. Nat. Rev. Dis. Primers 2016, 2, 16053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hagan, P.G.; Nienaber, C.A.; Isselbacher, E.M.; Bruckman, D.; Karavite, D.J.; Russman, P.L.; Evangelista, A.; Fattori, R.; Suzuki, T.; Oh, J.K.; et al. The International Registry of Acute Aortic Dissection (IRAD): New insights into an old disease. JAMA 2000, 283, 897–903. [Google Scholar] [CrossRef] [Scilit]
- Clough, R.E.; Nienaber, C.A. Management of acute aortic syndrome. Nat. Rev. Cardiol. 2015, 12, 103–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gurung, R.; Choong, A.M.; Woo, C.C.; Foo, R.; Sorokin, V. Genetic and Epigenetic Mechanisms Underlying Vascular Smooth Muscle Cell Phenotypic Modulation in Abdominal Aortic Aneurysm. Int. J. Mol. Sci. 2020, 21, 6334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez-Infantes, D.; Nus, M.; Navas-Madronal, M.; Fite, J.; Perez, B.; Barros-Membrilla, A.J.; Soto, B.; Martinez-Gonzalez, J.; Camacho, M.; Rodriguez, C.; et al. Oxidative Stress and Inflammatory Markers in Abdominal Aortic Aneurysm. Antioxidants 2021, 10, 602. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owens, G.K.; Kumar, M.S.; Wamhoff, B.R. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol. Rev. 2004, 84, 767–801. [Google Scholar] [CrossRef] [Scilit]
- Panda, D.; Kundu, G.C.; Lee, B.I.; Peri, A.; Fohl, D.; Chackalaparampil, I.; Mukherjee, B.B.; Li, X.D.; Mukherjee, D.C.; Seides, S.; et al. Potential roles of osteopontin and alphaVbeta3 integrin in the development of coronary artery restenosis after angioplasty. Proc. Natl. Acad. Sci. USA 1997, 94, 9308–9313. [Google Scholar] [CrossRef] [Scilit]
- Palmberg, L.; Sjolund, M.; Thyberg, J. Phenotype modulation in primary cultures of arterial smooth-muscle cells: Reorganization of the cytoskeleton and activation of synthetic activities. Differentiation 1985, 29, 275–283. [Google Scholar] [CrossRef] [Scilit]
- Worth, N.F.; Rolfe, B.E.; Song, J.; Campbell, G.R. Vascular smooth muscle cell phenotypic modulation in culture is associated with reorganisation of contractile and cytoskeletal proteins. Cell Motil. Cytoskelet. 2001, 49, 130–145. [Google Scholar] [CrossRef] [Scilit]
- Witkowski, M.; Weeks, T.L.; Hazen, S.L. Gut Microbiota and Cardiovascular Disease. Circ. Res. 2020, 127, 553–570. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.; Rigatto, K.; Gazzana, M.B.; Knorst, M.M.; Richards, E.M.; Pepine, C.J.; Raizada, M.K. Altered Gut Microbiome Profile in Patients With Pulmonary Arterial Hypertension. Hypertension 2020, 75, 1063–1071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Ding, Y.; Song, P.; Zhu, H.; Okon, I.; Ding, Y.N.; Chen, H.Z.; Liu, D.P.; Zou, M.H. Tryptophan-Derived 3-Hydroxyanthranilic Acid Contributes to Angiotensin II-Induced Abdominal Aortic Aneurysm Formation in Mice In Vivo. Circulation 2017, 136, 2271–2283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramprasath, T.; Han, Y.M.; Zhang, D.; Yu, C.J.; Zou, M.H. Tryptophan Catabolism and Inflammation: A Novel Therapeutic Target For Aortic Diseases. Front. Immunol. 2021, 12, 731701. [Google Scholar] [CrossRef] [Scilit]
- Paeslack, N.; Mimmler, M.; Becker, S.; Gao, Z.; Khuu, M.P.; Mann, A.; Malinarich, F.; Regen, T.; Reinhardt, C. Microbiota-derived tryptophan metabolites in vascular inflammation and cardiovascular disease. Amino Acids 2022, 54, 1339–1356. [Google Scholar] [CrossRef] [Scilit]
- Nakano, T.; Katsuki, S.; Chen, M.; Decano, J.L.; Halu, A.; Lee, L.H.; Pestana, D.V.S.; Kum, A.S.T.; Kuromoto, R.K.; Golden, W.S.; et al. Uremic Toxin Indoxyl Sulfate Promotes Proinflammatory Macrophage Activation Via the Interplay of OATP2B1 and Dll4-Notch Signaling. Circulation 2019, 139, 78–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Z.H.; Xin, F.Z.; Xue, Y.; Hu, Z.; Han, Y.; Ma, F.; Zhou, D.; Liu, X.L.; Cui, A.; Liu, Z.; et al. Indole-3-propionic acid inhibits gut dysbiosis and endotoxin leakage to attenuate steatohepatitis in rats. Exp. Mol. Med. 2019, 51, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langan, D.; Perkins, D.J.; Vogel, S.N.; Moudgil, K.D. Microbiota-Derived Metabolites, Indole-3-aldehyde and Indole-3-acetic Acid, Differentially Modulate Innate Cytokines and Stromal Remodeling Processes Associated with Autoimmune Arthritis. Int. J. Mol. Sci. 2021, 22, 2017. [Google Scholar] [CrossRef] [Scilit]
- Huc, T.; Konop, M.; Onyszkiewicz, M.; Podsadni, P.; Szczepanska, A.; Turlo, J.; Ufnal, M. Colonic indole, gut bacteria metabolite of tryptophan, increases portal blood pressure in rats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2018, 315, R646–R655. [Google Scholar] [CrossRef] [Scilit]
- Konopelski, P.; Chabowski, D.; Aleksandrowicz, M.; Kozniewska, E.; Podsadni, P.; Szczepanska, A.; Ufnal, M. Indole-3-propionic acid, a tryptophan-derived bacterial metabolite, increases blood pressure via cardiac and vascular mechanisms in rats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2021, 321, R969–R981. [Google Scholar] [CrossRef] [Scilit]
- Pedersen, E.R.; Tuseth, N.; Eussen, S.J.; Ueland, P.M.; Strand, E.; Svingen, G.F.; Midttun, O.; Meyer, K.; Mellgren, G.; Ulvik, A.; et al. Associations of plasma kynurenines with risk of acute myocardial infarction in patients with stable angina pectoris. Arterioscler. Thromb. Vasc. Biol. 2015, 35, 455–462. [Google Scholar] [CrossRef] [Scilit]
- Pan, L.; Bai, P.; Weng, X.; Liu, J.; Chen, Y.; Chen, S.; Ma, X.; Hu, K.; Sun, A.; Ge, J. Legumain Is an Endogenous Modulator of Integrin alphavbeta3 Triggering Vascular Degeneration, Dissection, and Rupture. Circulation 2022, 145, 659–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swimm, A.; Giver, C.R.; DeFilipp, Z.; Rangaraju, S.; Sharma, A.; Ulezko Antonova, A.; Sonowal, R.; Capaldo, C.; Powell, D.; Qayed, M.; et al. Indoles derived from intestinal microbiota act via type I interferon signaling to limit graft-versus-host disease. Blood 2018, 132, 2506–2519. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krege, J.H.; Hodgin, J.B.; Hagaman, J.R.; Smithies, O. A noninvasive computerized tail-cuff system for measuring blood pressure in mice. Hypertension 1995, 25, 1111–1115. [Google Scholar] [CrossRef] [Scilit]
- Ma, G.; Mason, D.P.; Young, D.B. Inhibition of vascular smooth muscle cell migration by elevation of extracellular potassium concentration. Hypertension 2000, 35, 948–951. [Google Scholar] [CrossRef] [Scilit]
- Ailawadi, G.; Moehle, C.W.; Pei, H.; Walton, S.P.; Yang, Z.; Kron, I.L.; Lau, C.L.; Owens, G.K. Smooth muscle phenotypic modulation is an early event in aortic aneurysms. J. Thorac. Cardiovasc. Surg. 2009, 138, 1392–1399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanematsu, Y.; Kanematsu, M.; Kurihara, C.; Tsou, T.L.; Nuki, Y.; Liang, E.I.; Makino, H.; Hashimoto, T. Pharmacologically induced thoracic and abdominal aortic aneurysms in mice. Hypertension 2010, 55, 1267–1274. [Google Scholar] [CrossRef] [Scilit]
- Lu, G.; Su, G.; Davis, J.P.; Schaheen, B.; Downs, E.; Roy, R.J.; Ailawadi, G.; Upchurch, G.R., Jr. A novel chronic advanced stage abdominal aortic aneurysm murine model. J. Vasc. Surg. 2017, 66, 232–242.e4. [Google Scholar] [CrossRef] [Scilit]
- Lee, V.S.; Halabi, C.M.; Hoffman, E.P.; Carmichael, N.; Leshchiner, I.; Lian, C.G.; Bierhals, A.J.; Vuzman, D.; Brigham Genomic, M.; Mecham, R.P.; et al. Loss of function mutation in LOX causes thoracic aortic aneurysm and dissection in humans. Proc. Natl. Acad. Sci. USA 2016, 113, 8759–8764. [Google Scholar] [CrossRef] [Scilit]
- Pinard, A.; Jones, G.T.; Milewicz, D.M. Genetics of Thoracic and Abdominal Aortic Diseases. Circ. Res. 2019, 124, 588–606. [Google Scholar] [CrossRef] [Scilit]
- Rensen, S.S.; Doevendans, P.A.; van Eys, G.J. Regulation and characteristics of vascular smooth muscle cell phenotypic diversity. Neth. Heart J. 2007, 15, 100–108. [Google Scholar] [CrossRef] [Scilit]
- Milewicz, D.M.; Braverman, A.C.; De Backer, J.; Morris, S.A.; Boileau, C.; Maumenee, I.H.; Jondeau, G.; Evangelista, A.; Pyeritz, R.E. Marfan syndrome. Nat. Rev. Dis. Primers 2021, 7, 64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, R.; Guo, D.C.; Sun, W.; Papke, C.L.; Duraisamy, S.; Estrera, A.L.; Safi, H.J.; Ahn, C.; Buja, L.M.; Arnett, F.C.; et al. Characterization of the inflammatory cells in ascending thoracic aortic aneurysms in patients with Marfan syndrome, familial thoracic aortic aneurysms, and sporadic aneurysms. J. Thorac. Cardiovasc. Surg. 2008, 136, 922–929.e1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Del Porto, F.; Proietta, M.; Tritapepe, L.; Miraldi, F.; Koverech, A.; Cardelli, P.; Tabacco, F.; de Santis, V.; Vecchione, A.; Mitterhofer, A.P.; et al. Inflammation and immune response in acute aortic dissection. Ann. Med. 2010, 42, 622–629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshida, S.; Yamamoto, M.; Aoki, H.; Fukuda, H.; Akasu, K.; Takagi, K.; Shojima, T.; Fukumoto, Y.; Akashi, H.; Tanaka, H. STAT3 Activation Correlates with Adventitial Neutrophil Infiltration in Human Aortic Dissection. Ann. Vasc. Dis. 2019, 12, 187–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, Y.L.; Wang, Z.W. The expression and significance of IL-6, IFN-gamma, SM22alpha, and MMP-2 in rat model of aortic dissection. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 560–568. [Google Scholar] [PubMed]
- Palego, L.; Betti, L.; Rossi, A.; Giannaccini, G. Tryptophan Biochemistry: Structural, Nutritional, Metabolic, and Medical Aspects in Humans. J. Amino Acids 2016, 2016, 8952520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Floc’h, N.; Otten, W.; Merlot, E. Tryptophan metabolism, from nutrition to potential therapeutic applications. Amino Acids 2011, 41, 1195–1205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zelante, T.; Iannitti, R.G.; Cunha, C.; De Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [Google Scholar] [CrossRef] [Scilit]
- Rothhammer, V.; Mascanfroni, I.D.; Bunse, L.; Takenaka, M.C.; Kenison, J.E.; Mayo, L.; Chao, C.C.; Patel, B.; Yan, R.; Blain, M.; et al. Type I interferons and microbial metabolites of tryptophan modulate astrocyte activity and central nervous system inflammation via the aryl hydrocarbon receptor. Nat. Med. 2016, 22, 586–597. [Google Scholar] [CrossRef] [Scilit]
- Alexeev, E.E.; Lanis, J.M.; Kao, D.J.; Campbell, E.L.; Kelly, C.J.; Battista, K.D.; Gerich, M.E.; Jenkins, B.R.; Walk, S.T.; Kominsky, D.J.; et al. Microbiota-Derived Indole Metabolites Promote Human and Murine Intestinal Homeostasis through Regulation of Interleukin-10 Receptor. Am. J. Pathol. 2018, 188, 1183–1194. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.; Luo, Y.; Zhu, Z.; Zhou, Y.; Sun, L.; Gao, J.; Sun, J.; Wang, G.; Yao, X.; Li, W. A tryptophan metabolite of the skin microbiota attenuates inflammation in patients with atopic dermatitis through the aryl hydrocarbon receptor. J. Allergy Clin. Immunol. 2019, 143, 2108–2119.e12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sadik, A.; Somarribas Patterson, L.F.; Ozturk, S.; Mohapatra, S.R.; Panitz, V.; Secker, P.F.; Pfander, P.; Loth, S.; Salem, H.; Prentzell, M.T.; et al. IL4I1 Is a Metabolic Immune Checkpoint that Activates the AHR and Promotes Tumor Progression. Cell 2020, 182, 1252–1270.e34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Erbel, R.; Aboyans, V.; Boileau, C.; Bossone, E.; Bartolomeo, R.D.; Eggebrecht, H.; Evangelista, A.; Falk, V.; Frank, H.; Gaemperli, O.; et al. 2014 ESC Guidelines on the diagnosis and treatment of aortic diseases: Document covering acute and chronic aortic diseases of the thoracic and abdominal aorta of the adult. The Task Force for the Diagnosis and Treatment of Aortic Diseases of the European Society of Cardiology (ESC). Eur. Heart J. 2014, 35, 2873–2926. [Google Scholar] [CrossRef] [Scilit]
- He, R.; Guo, D.C.; Estrera, A.L.; Safi, H.J.; Huynh, T.T.; Yin, Z.; Cao, S.N.; Lin, J.; Kurian, T.; Buja, L.M.; et al. Characterization of the inflammatory and apoptotic cells in the aortas of patients with ascending thoracic aortic aneurysms and dissections. J. Thorac. Cardiovasc. Surg. 2006, 131, 671–678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schachner, T.; Golderer, G.; Sarg, B.; Lindner, H.H.; Bonaros, N.; Mikuz, G.; Laufer, G.; Werner, E.R. The amounts of alpha 1 antitrypsin protein are reduced in the vascular wall of the acutely dissected human ascending aorta. Eur. J. Cardiothorac. Surg. 2010, 37, 684–690. [Google Scholar] [CrossRef] [Scilit]
- Allaire, E.; Schneider, F.; Saucy, F.; Dai, J.; Cochennec, F.; Michineau, S.; Zidi, M.; Becquemin, J.P.; Kirsch, M.; Gervais, M. New insight in aetiopathogenesis of aortic diseases. Eur. J. Vasc. Endovasc. Surg. 2009, 37, 531–537. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.L.; Liu, O.; Qin, Y.W.; Zhang, H.J.; Lv, Y. Association of the polymorphisms of MMP-9 and TIMP-3 genes with thoracic aortic dissection in Chinese Han population. Acta Pharmacol. Sin. 2014, 35, 351–355. [Google Scholar] [CrossRef] [Scilit]
- Wortmann, M.; Peters, A.S.; Erhart, P.; Korfer, D.; Bockler, D.; Dihlmann, S. Inflammasomes in the Pathophysiology of Aortic Disease. Cells 2021, 10, 2433. [Google Scholar] [CrossRef] [Scilit]
- Rombouts, K.B.; van Merrienboer, T.A.R.; Ket, J.C.F.; Bogunovic, N.; van der Velden, J.; Yeung, K.K. The role of vascular smooth muscle cells in the development of aortic aneurysms and dissections. Eur. J. Clin. Investig. 2022, 52, e13697. [Google Scholar] [CrossRef] [Scilit]
- Frismantiene, A.; Philippova, M.; Erne, P.; Resink, T.J. Smooth muscle cell-driven vascular diseases and molecular mechanisms of VSMC plasticity. Cell. Signal. 2018, 52, 48–64. [Google Scholar] [CrossRef] [Scilit]
- Li, G.; Wang, M.; Caulk, A.W.; Cilfone, N.A.; Gujja, S.; Qin, L.; Chen, P.Y.; Chen, Z.; Yousef, S.; Jiao, Y.; et al. Chronic mTOR activation induces a degradative smooth muscle cell phenotype. J. Clin. Investig. 2020, 130, 1233–1251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bax, M.; Romanov, V.; Junday, K.; Giannoulatou, E.; Martinac, B.; Kovacic, J.C.; Liu, R.; Iismaa, S.E.; Graham, R.M. Arterial dissections: Common features and new perspectives. Front. Cardiovasc. Med. 2022, 9, 1055862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adam, M.; Kooreman, N.G.; Jagger, A.; Wagenhauser, M.U.; Mehrkens, D.; Wang, Y.; Kayama, Y.; Toyama, K.; Raaz, U.; Schellinger, I.N.; et al. Systemic Upregulation of IL-10 (Interleukin-10) Using a Nonimmunogenic Vector Reduces Growth and Rate of Dissecting Abdominal Aortic Aneurysm. Arterioscler. Thromb. Vasc. Biol. 2018, 38, 1796–1805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.; Ye, J.; Cai, W.; Yang, X.; Zou, Q.; Lin, J.; Zheng, H.; Wang, C.; Chen, L.; Li, Y. LDHA mediated degradation of extracellular matrix is a potential target for the treatment of aortic dissection. Pharmacol. Res. 2022, 176, 106051. [Google Scholar] [CrossRef] [Scilit]





| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| IL-10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
| MCP-1 | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
| TNF-α | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
| TNFSF10 | ATGGTGATTTGCATAGTGCTCC | GCAAGCAGGGTCTGTTCAAGA |
| TNFSF9 | CGGCGCTCCTCAGAGATAC | ATCCCGAACATTAACCGCAGG |
| TNFRSF1A | CCGGGAGAAGAGGGATAGCTT | TCGGACAGTCACTCACCAAGT |
| TNFAIP3 | GAACAGCGATCAGGCCAGG | GGACAGTTGGGTGTCTCACATT |
| MMP2 | CAAGTTCCCCGGCGATGTC | TTCTGGTCAAGGTCACCTGTC |
| MMP9 | CTGGACAGCCAGACACTAAAG | CTCGCGGCAAGTCTTCAGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, S.-S.; Liu, R.; Chang, S.; Li, X.; Weng, X.; Ge, J. Gut Microbiota-Derived Tryptophan Metabolite Indole-3-aldehyde Ameliorates Aortic Dissection. Nutrients 2023, 15, 4150. https://doi.org/10.3390/nu15194150
Huang S-S, Liu R, Chang S, Li X, Weng X, Ge J. Gut Microbiota-Derived Tryptophan Metabolite Indole-3-aldehyde Ameliorates Aortic Dissection. Nutrients. 2023; 15(19):4150. https://doi.org/10.3390/nu15194150
Chicago/Turabian StyleHuang, Sui-Shane, Rongle Liu, Shufu Chang, Xiao Li, Xinyu Weng, and Junbo Ge. 2023. "Gut Microbiota-Derived Tryptophan Metabolite Indole-3-aldehyde Ameliorates Aortic Dissection" Nutrients 15, no. 19: 4150. https://doi.org/10.3390/nu15194150
APA StyleHuang, S.-S., Liu, R., Chang, S., Li, X., Weng, X., & Ge, J. (2023). Gut Microbiota-Derived Tryptophan Metabolite Indole-3-aldehyde Ameliorates Aortic Dissection. Nutrients, 15(19), 4150. https://doi.org/10.3390/nu15194150

