Effect of Vitamin K-Mediated PXR Activation on Drug-Metabolizing Gene Expression in Human Intestinal Carcinoma LS180 Cell Line
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Proliferation Assay
2.3. RNA Isolation and Quantitative RT-PCR Analysis
2.4. Western Blotting
2.5. Transient Transfection and Luciferase Assay
2.6. RNA Interference
2.7. High-Performance Liquid Chromatography (HPLC) Analysis of VK in LS180 Cells
2.8. Statistical Analysis
3. Results
3.1. Effect of MK-4 on Drug Metabolism-Related Gene Expression in LS180 Cells
3.2. Analysis of PXR Transcriptional Activation by MK-4
3.3. Effects of Different Forms of VK on Drug Metabolism-Related Gene Expression in LS180 Cells
3.4. Effects of Drug–Nutrient Interaction on Drug Metabolism-Related Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Suttie, J.W. The importance of menaquinones in human nutrition. Annu. Rev. Nutr. 1995, 15, 399–417. [Google Scholar] [CrossRef]
- Ferland, G. The discovery of vitamin K and its clinical applications. Ann. Nutr. Metab. 2012, 61, 213–218. [Google Scholar] [CrossRef]
- Azuma, K.; Inoue, S. Vitamin K, SXR, and GGCX. In Vitamin K2—Vital for Health and Wellbeing; InTechOpen: London, UK, 2017; pp. 21–32. ISBN 978-953-51-3020-8. [Google Scholar]
- Tabb, M.M.; Sun, A.; Zhou, C.; Grun, F.; Errandi, J.; Romero, K.; Pham, H.; Inoue, S.; Mallick, S.; Lin, M.; et al. Vitamin K2 regulation of bone homeostasis is mediated by the steroid and xenobiotic receptor SXR. J. Biol. Chem. 2003, 278, 43919–43927. [Google Scholar] [CrossRef]
- Ohsaki, Y.; Shirakawa, H.; Miura, A.; Giriwono, P.E.; Sato, S.; Ohashi, A.; Iribe, M.; Goto, T.; Komai, M. Vitamin K suppresses the lipopolysaccharide-induced expression of inflammatory cytokines in cultured macrophage-like cells via the inhibition of the activation of nuclear factor κB through the repression of IKKα/β phosphorylation. J. Nutr. Biochem. 2010, 21, 1120–1126. [Google Scholar] [CrossRef] [PubMed]
- Ito, A.; Shirakawa, H.; Takumi, N.; Minegishi, Y.; Ohashi, A.; Howlader, Z.H.; Ohsaki, Y.; Sato, T.; Goto, T.; Komai, M. Menaquinone-4 enhances testosterone production in rats and testis-derived tumor cells. Lipids Health Dis. 2011, 10, 158. [Google Scholar] [CrossRef]
- Lamson, D.W.; Plaza, S.M. The anticancer effects of vitamin K. Altern. Med. Rev. 2003, 8, 303–318. [Google Scholar]
- Farhadi, M.B.; Fereidoni, M. Neuroprotective effect of menaquinone-4 (MK-4) on transient global cerebral ischemia/reperfusion injury in rat. PLoS ONE 2020, 15, e0229769. [Google Scholar] [CrossRef]
- Sultana, H.; Watanabe, K.; Rana, M.M.; Takashima, R.; Ohashi, A.; Komai, M.; Shirakawa, H. Effects of vitamin K₂ on the expression of genes involved in bile acid synthesis and glucose homeostasis in mice with humanized PXR. Nutrients 2018, 10, 982. [Google Scholar] [CrossRef] [PubMed]
- Beulens, J.W.; Grobbee, D.E.; Sluijs, I.; Spijkerman, A.M.; van der Schouw, Y.T. Dietary phylloquinone and menaquinones intakes and risk of type 2 diabetes. Diabetes Care 2010, 33, 1699–1705. [Google Scholar] [CrossRef]
- Kliewer, S.A.; Moore, J.T.; Wade, L.; Staudinger, J.L.; Watson, M.A.; Jones, S.A.; McKee, D.D.; Oliver, B.B.; Willson, T.M.; Zetterstrom, R.H.; et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 1998, 92, 73–82. [Google Scholar] [CrossRef]
- Bertilsson, G.; Heidrich, J.; Svensson, K.; Asman, M.; Jendeberg, L.; Sydow-Backman, M.; Ohlsson, R.; Postlind, H.; Blomquist, P.; Berkenstam, A. Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc. Natl. Acad. Sci. USA 1998, 95, 12208–12213. [Google Scholar] [CrossRef] [PubMed]
- Blumberg, B.; Sabbagh, W., Jr.; Juguilon, H.; Bolado, J., Jr.; van Meter, C.M.; Ong, E.S.; Evans, R.M. SXR, a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 1998, 12, 3195–3205. [Google Scholar] [CrossRef]
- Pavek, P. Pregnane X Receptor (PXR)-Mediated Gene Repression and Cross-Talk of PXR with Other Nuclear Receptors via Coactivator Interactions. Front. Pharmacol. 2016, 7, 456. [Google Scholar] [CrossRef] [PubMed]
- Chrencik, J.E.; Orans, J.; Moore, L.B.; Xue, Y.; Peng, L.; Collins, J.L.; Wisely, G.B.; Lambert, M.H.; Kliewer, S.A.; Redinbo, M.R. Structural disorder in the complex of human pregnane X receptor and the macrolide antibiotic rifampicin. Mol. Endocrinol. 2005, 19, 1125–1134. [Google Scholar] [CrossRef] [PubMed]
- Watkins, R.E.; Davis-Searles, P.R.; Lambert, M.H.; Redinbo, M.R. Coactivator binding promotes the specific interaction between ligand and the pregnane X receptor. J. Mol. Biol. 2003, 331, 815–828. [Google Scholar] [CrossRef]
- Watkins, R.E.; Wisely, G.B.; Moore, L.B.; Collins, J.L.; Lambert, M.H.; Williams, S.P.; Willson, T.M.; Kliewer, S.A.; Redinbo, M.R. The human nuclear xenobiotic receptor PXR: Structural determinants of directed promiscuity. Science 2001, 292, 2329–2333. [Google Scholar] [CrossRef]
- Watkins, R.E.; Maglich, J.M.; Moore, L.B.; Wisely, G.B.; Noble, S.M.; Davis-Searles, P.R.; Lambert, M.H.; Kliewer, S.A.; Redinbo, M.R. 2.1 Å crystal structure of human PXR in complex with the St. John’s wort compound hyperforin. Biochemistry 2003, 42, 1430–1438. [Google Scholar] [CrossRef]
- Zhou, C.; Verma, S.; Blumberg, B. The steroid and xenobiotic receptor (SXR), beyond xenobiotic metabolism. Nucl. Recept. Signal. 2009, 7, e001. [Google Scholar] [CrossRef]
- Staudinger, J.L.; Goodwin, B.; Jones, S.A.; Hawkins-Brown, D.; MacKenzie, K.I.; LaTour, A.; Liu, Y.; Klaassen, C.D.; Brown, K.K.; Reinhard, J.; et al. The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc. Natl. Acad. Sci. USA 2001, 98, 3369–3374. [Google Scholar] [CrossRef]
- Jung, D.; Mangelsdorf, D.J.; Meyer, U.A. Pregnane X receptor is a target of farnesoid X receptor. J. Biol. Chem. 2006, 281, 19081–19091. [Google Scholar] [CrossRef]
- Guengerich, F.P. Cytochrome P-450 3A4: Regulation and role in drug metabolism. Annu. Rev. Pharmacol. Toxicol. 1999, 39, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Kliewer, S.A.; Willson, T.M. Regulation of xenobiotic and bile acid metabolism by the nuclear pregnane X receptor. J. Lipid Res. 2002, 43, 359–364. [Google Scholar] [CrossRef]
- Lehmann, J.M.; McKee, D.D.; Watson, M.A.; Willson, T.M.; Moore, J.T.; Kliewer, S.A. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J. Clin. Investig. 1998, 102, 1016–1023. [Google Scholar] [CrossRef] [PubMed]
- Geick, A.; Eichelbaum, M.; Burk, O. Nuclear receptor response elements mediate induction of intestinal MDR1 by rifampin. J. Biol. Chem. 2001, 276, 14581–14587. [Google Scholar] [CrossRef]
- Azuma, K.; Inoue, S. Multiple modes of vitamin k actions in aging-related musculoskeletal disorders. Int. J. Mol. Sci. 2019, 20, 2844. [Google Scholar] [CrossRef]
- Ichikawa, T.; Horie-Inoue, K.; Ikeda, K.; Blumberg, B.; Inoue, S. Steroid and xenobiotic receptor SXR mediates vitamin K2-activated transcription of extracellular matrix-related genes and collagen accumulation in osteoblastic cells. J. Biol. Chem. 2006, 281, 16927–16934. [Google Scholar] [CrossRef]
- Azuma, K.; Urano, T.; Ouchi, Y.; Inoue, S. Vitamin K2 suppresses proliferation and motility of hepatocellular carcinoma cells by activating steroid and xenobiotic receptor. Endocr. J. 2009, 56, 843–849. [Google Scholar] [CrossRef]
- Avior, Y.; Levy, G.; Zimerman, M.; Kitsberg, D.; Schwartz, R.; Sadeh, R.; Moussaieff, A.; Cohen, M.; Itskovitz-Eldor, J.; Nahmias, Y. Microbial-derived lithocholic acid and vitamin K2 drive the metabolic maturation of pluripotent stem cells-derived and fetal hepatocytes. Hepatology 2015, 62, 265–278. [Google Scholar] [CrossRef]
- Ernst, E. Second thoughts about safety of St John’s wort. Lancet 1999, 354, 2014–2016. [Google Scholar] [CrossRef]
- Ohsaki, Y.; Shirakawa, H.; Hiwatashi, K.; Furukawa, Y.; Mizutani, T.; Komai, M. Vitamin K suppresses lipopolysaccharide induced inflammation in the rat. Biosci. Biotechnol. Biochem. 2006, 70, 926–932. [Google Scholar] [CrossRef]
- Gupta, A.; Mugundu, G.M.; Desai, P.B.; Thummel, K.E.; Unadkat, J.D. Intestinal human colon adenocarcinoma cell line LS180 is an excellent model to study pregnane X receptor, but not constitutive androstane receptor, mediated CYP3A4 and multidrug resistance transporter 1 induction: Studies with anti-human immunodeficiency virus protease inhibitors. Drug Metab. Dispos. 2008, 36, 1172–1180. [Google Scholar] [CrossRef]
- Thelen, K.; Dressman, J.B. Cytochrome P450-mediated metabolism in the human gut wall. J. Pharm. Pharmacol. 2009, 61, 541–558. [Google Scholar] [CrossRef]
- von Richter, O.; Burk, O.; Fromm, M.F. Cytochrome P450 3A4 and P-glycoprotein expression in human small intestinal enterocytes and hepatocytes: A comparative analysis in paired tissue specimens. Clin. Pharmacol. Ther. 2004, 75, 172–183. [Google Scholar] [CrossRef] [PubMed]
- Tom, B.H.; Rutzky, L.P.; Jakstys, M.M.; Oyasu, R.; Kaye, C.I.; Kahan, B.D. Human colonic adenocarcinoma cells. I. Establishment and description of a new line. In Vitro 1976, 12, 180–191. [Google Scholar] [CrossRef]
- Pfrunder, A.; Gutmann, H.; Beglinger, C.; Drewe, J. Gene expression of CYP3A4, ABC-transporters (MDR1 and MRP1-MRP5) and hPXR in three different human colon carcinoma cell lines. J. Pharm. Pharmacol. 2003, 55, 59–66. [Google Scholar] [CrossRef]
- Zhang, Q.Y.; Dunbar, D.; Ostrowska, A.; Zeisloft, S.; Yang, J.; Kaminsky, L.S. Characterization of human small intestinal cytochromes P-450. Drug Metab. Dispos. 1999, 27, 804–809. [Google Scholar]
- Synold, T.W.; Dussault, I.; Forman, B.M. The orphan nuclear receptor SXR coordinately regulates drug metabolism and efflux. Nat. Med. 2001, 7, 584–590. [Google Scholar] [CrossRef] [PubMed]
- Yamasaki, Y.; Kobayashi, K.; Chiba, K. Effect of pregnenolone 16α-carbonitrile on the expression of P-glycoprotein in the intestine, brain and liver of mice. Biol. Pharm. Bull. 2018, 41, 972–977. [Google Scholar] [CrossRef]
- Greiner, B.; Eichelbaum, M.; Fritz, P.; Kreichgauer, H.P.; von Richter, O.; Zundler, J.; Kroemer, H.K. The role of intestinal P-glycoprotein in the interaction of digoxin and rifampin. J. Clin. Investig. 1999, 104, 147–153. [Google Scholar] [CrossRef]
- Dürr, D.; Stieger, B.; Kullak-Ublick, G.A.; Rentsch, K.M.; Steinert, H.C.; Meier, P.J.; Fattinger, K. St. John’s Wort induces intestinal P-glycoprotein/MDR1 and intestinal and hepatic CYP3A4. Clin. Pharmacol. Ther. 2000, 68, 598–604. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Tam, D.; Chen, X.; Pang, K.S. P-glycoprotein and an unstirred water layer barring digoxin absorption in the vascularly perfused rat small intestine preparation: Induction studies with pregnenolone-16alpha-carbonitrile. Drug Metab. Dispos. 2006, 34, 1468–1479. [Google Scholar] [CrossRef]
- Cheng, X.; Klaassen, C.D. Regulation of mRNA expression of xenobiotic transporters by the pregnane X receptor in mouse liver, kidney, and intestine. Drug Metab. Dispos. 2006, 34, 1863–1867. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, U.I.; Hanso, H.; Oertel, R.; Miehlke, S.; Kuhlisch, E.; Glaeser, H.; Hitzl, M.; Dresser, G.K.; Kim, R.B.; Kirch, W. Induction of intestinal P-glycoprotein by St John’s wort reduces the oral bioavailability of talinolol. Clin. Pharmacol. Ther. 2007, 81, 669–678. [Google Scholar] [CrossRef] [PubMed]
- Suhara, Y.; Hanada, N.; Okitsu, T.; Sakai, M.; Watanabe, M.; Nakagawa, K.; Wada, A.; Takeda, K.; Takahashi, K.; Tokiwa, H.; et al. Structure-activity relationship of novel menaquinone-4 analogues: Modification of the side chain affects their biological activities. J. Med. Chem. 2012, 55, 1553–1558. [Google Scholar] [CrossRef]
- Suhara, Y.; Watanabe, M.; Nakagawa, K.; Wada, A.; Ito, Y.; Takeda, K.; Takahashi, K.; Okano, T. Synthesis of novel vitamin K2 analogues with modification at the ω-terminal position and their biological evaluation as potent steroid and xenobiotic receptor (SXR) agonists. J. Med. Chem. 2011, 54, 4269–4273. [Google Scholar] [CrossRef]
- Suhara, Y.; Watanabe, M.; Motoyoshi, S.; Nakagawa, K.; Wada, A.; Takeda, K.; Takahashi, K.; Tokiwa, H.; Okano, T. Synthesis of new vitamin K analogues as steroid and xenobiotic receptor (SXR) agonists: Insights into the biological role of the side chain part of vitamin K. J. Med. Chem. 2011, 54, 4918–4922. [Google Scholar] [CrossRef] [PubMed]
- Masuyama, H.; Suwaki, N.; Tateishi, Y.; Nakatsukasa, H.; Segawa, T.; Hiramatsu, Y. The pregnane X receptor regulates gene expression in a ligand- and promoter-selective fashion. Mol. Endocrinol. 2005, 19, 1170–1180. [Google Scholar] [CrossRef]
- Zhou, C.; Tabb, M.M.; Sadatrafiei, A.; Grün, F.; Blumberg, B. Tocotrienols activate the steroid and xenobiotic receptor, SXR and selectively regulate expression of its target genes. Drug. Metab. Dispos. 2004, 32, 1075–1082. [Google Scholar] [CrossRef]
- Kobayashi, E.; Sato, Y.; Umegaki, K.; Chiba, T. The prevalence of dietary supplement use among college students: A nationwide survey in Japan. Nutrients 2017, 9, 1250. [Google Scholar] [CrossRef]
- Hirayama, F.; Lee, A.H.; Binns, C.W.; Watanabe, F.; Ogawa, T. Dietary supplementation by older adults in Japan. Asia Pac. J. Clin. Nutr. 2008, 17, 280–284. [Google Scholar] [PubMed]
- Kobayashi, E.; Nishijima, C.; Sato, Y.; Umegaki, K.; Chiba, T. The prevalence of dietary supplement use among elementary, junior high, and high school students: A nationwide survey in Japan. Nutrients 2018, 10, 1176. [Google Scholar] [CrossRef] [PubMed]
- Bailey, R.L.; Gahche, J.J.; Lentino, C.V.; Dwyer, J.T.; Engel, J.S.; Thomas, P.R.; Betz, J.M.; Sempos, C.T.; Picciano, M.F. Dietary supplement use in the United States, 2003–2006. J. Nutr. 2011, 141, 261–266. [Google Scholar] [CrossRef] [PubMed]






| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| PXR | TGGACGCTCAGATGAAAACCTT | CACTTGGCAGCTTCTTCCCTC |
| MDR1 | CCCATCATTGCAATAGCAGG | TGTTCAAACTTCTGCTCCTGA |
| CYP3A4 | TGGTGATGATTCCAAGCTATGCTC | AATGCAGTTTCTGGGTCCACTTC |
| EEF1A1 | GATGGCCCCAAATTATTGAAG | GGACCATGTCAATGGCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sultana, H.; Kato, A.; Ohashi, A.; Takashima, R.; Katsurai, T.; Sato, S.; Monma, M.; Ohsaki, Y.; Goto, T.; Komai, M.; et al. Effect of Vitamin K-Mediated PXR Activation on Drug-Metabolizing Gene Expression in Human Intestinal Carcinoma LS180 Cell Line. Nutrients 2021, 13, 1709. https://doi.org/10.3390/nu13051709
Sultana H, Kato A, Ohashi A, Takashima R, Katsurai T, Sato S, Monma M, Ohsaki Y, Goto T, Komai M, et al. Effect of Vitamin K-Mediated PXR Activation on Drug-Metabolizing Gene Expression in Human Intestinal Carcinoma LS180 Cell Line. Nutrients. 2021; 13(5):1709. https://doi.org/10.3390/nu13051709
Chicago/Turabian StyleSultana, Halima, Ayaka Kato, Ai Ohashi, Rie Takashima, Tomoko Katsurai, Shoko Sato, Masafumi Monma, Yusuke Ohsaki, Tomoko Goto, Michio Komai, and et al. 2021. "Effect of Vitamin K-Mediated PXR Activation on Drug-Metabolizing Gene Expression in Human Intestinal Carcinoma LS180 Cell Line" Nutrients 13, no. 5: 1709. https://doi.org/10.3390/nu13051709
APA StyleSultana, H., Kato, A., Ohashi, A., Takashima, R., Katsurai, T., Sato, S., Monma, M., Ohsaki, Y., Goto, T., Komai, M., & Shirakawa, H. (2021). Effect of Vitamin K-Mediated PXR Activation on Drug-Metabolizing Gene Expression in Human Intestinal Carcinoma LS180 Cell Line. Nutrients, 13(5), 1709. https://doi.org/10.3390/nu13051709

