Manganese Ferrite Nanoparticle-Assisted Enhancement of Photosynthetic Carbon Sequestration in Microalgae

Abstract

With increasing global greenhouse gas emissions, carbon dioxide (CO₂) reduction and fixation has become an important issue for global environmental protection. The use of microalgae photosynthesis to fix CO₂ is a green method to reduce carbon emissions. This can also realize the resourceful use of carbon, which is in line with a sustainable development strategy. This study addresses the problem of limited light absorption and utilization efficiency of microalgae. This can result in low photosynthetic carbon sequestration efficiency. How to enhance the photosynthetic carbon sequestration performance of microalgae is the core of this study. We constructed a microalgae carbon sequestration reaction system and added manganese ferrite nanomaterials to the microalgae reaction system to improve the photosynthetic carbon sequestration efficiency of the microalgae. The results show that the addition of 90 mg/L of manganese ferrite nanoparticles offered a significant growth advantage for microalgae. This increased the photosynthetic reaction activity by promoting the electron transfer rate. This significantly enhanced the photosynthetic carbon fixation efficiency of the microalgae, when held under a 40% CO₂ environment. The results of this study may provide a possible breakthrough for microalgal carbon sequestration. This may advance the feasibility of industrial applications for microalgal carbon sequestration.

1. Introduction

With the rapid development of the globalized economy, human demand for fossil fuels is increasing, resulting in a gradual increase in the concentration of CO₂ emitted into the atmosphere [1]. This leads to environmental problems, seriously affecting the survival and development of human beings [2]. The capture and utilization of CO₂ has become an important way to mitigate climate change. Microalgae have attracted attention due to their rapid growth and their ability to fix huge amounts of CO₂ [3]. The use of microalgae to fix CO₂ is an economical and feasible technology [4]. However, the limited efficiency of microalgae in absorbing, converting, and utilizing light leads to a reduced photosynthetic efficiency of microalgae [5]. The low light-absorption efficiency of microalgae is mainly limited by the narrow light-absorption range of their photosynthetic pigments, the limited depth of light penetration, and the energy loss during light energy conversion. Therefore, improving the photosynthetic carbon sequestration efficiency of microalgae may be an effective way to realize bioenergy production and enhance the utilization of industrial exhaust gases containing CO₂ [6].

To overcome the low light-absorption efficiency of microalgae, previous studies have tried the following strategies: 1. The range of light absorption is broadened by cultivating algal strains rich in different pigments or adding exogenous pigments, but pigment synthesis is limited by metabolic regulation and may increase the energy burden. 2. The reactor structure is optimized to enhance light distribution, but it is difficult to completely solve the shading problem of deep cells. 3. Pulsed light or dynamic light is used to reduce the light saturation effect, but this requires a complex control system and causes high costs. To address the limitations of these experiments, it was found that adding a certain amount of nanomaterials to microalgae can capture a broad spectrum and convert ultraviolet or infrared light into visible light available to microalgae through surface plasmon resonance or upconversion effects, and that the scattering properties of the nanoparticles can disperse the light path, reduce the light masking between the cell layers, and improve the utilization of light energy to enhance light penetration. Some nanomaterials can be used as “artificial antennae” to directly transfer excited-state electrons to the photosynthetic system, reducing energy loss and improving energy transfer efficiency. Nanomaterials can also achieve targeted binding through surface modification and have better resistance to photodegradation than natural pigments, with a certain stability and controllability. Despite the potential toxicity and cost issues of nanomaterials, their customizable optical properties and efficient energy transfer capabilities make them a promising emerging direction to break through the bottleneck of microalgae light efficiency, which is of great significance for improving the photosynthetic efficiency and carbon sequestration efficiency of microalgae [7].

Table 1. Current status of research on the effect of nanoparticles on microalgae.

Microalgae Species	Nanomaterials				Property			Reference
	Material	Size (nm)	Concentration (mg/L)	Cost Level	Index	Improve Efficiency (%)	CO2 Tolerance
Scenedesmus obliquus	MgO	<50.0	40.0	Low	Lipid	18.50	10–15%	[8]
Desmodesmus subspicatus	Zero-vzlent iron	50.0	5.1	Low	Lipid	58.33	0–5%	[9]
Porphyridium cruentum	CdSe	3.5	6.0	High	Biomass	47.50	0–5%	[10]
Microcystis aeruginosa	TiO2	-	0.8	Low	Growth rate	50.00	0–5%	[11]
Chlorella vulgaris	SiO2	200.0	0.2 wt%	Low	Growth rate	177.00	10–15%	[12]
C.zofingiensis	Au	5.0	25.0	High	Carotenoid	42.70	0–5%	[13]
C. pyrenoidosa	GOQDs	-	100.0	High	Electron transport rate	50.00	2–10%	[14]
C. reinhardtii	Ag	-	20.0	High	Growth rate	30.00	0–5%	[15]
Raphidocelis subcapitata	Zero-vzlent iron	50.0	5.1	Low	Lipid	45.20	0–5%	[8]
Nannochloropsis oculata	Organosilicon compound	-	Internal waveguide doping	Medium	Lipid	11.00	5–10%	[16]
Synechococcus elongatus	Au	90.0	PBR	High	Growth rate	13.00	0–2%	[17]
Chlamydomonas reinhardtii	Ag	±12.0	PBR	High	Biomass	10.00	1–5%	[18]

shows the current status of research on the effects of different types of nanoparticles on microalgae. In recent years, more studies have been conducted on the growth of microalgae and lipid accumulation of carbon fixation products, using low concentrations of nanomaterials. It has been shown that nanomaterials can increase the relative electron transfer rate of microalgae photosynthesis system II, thus improving photosynthetic efficiency. However, there are fewer analytical studies on nanomaterials to improve photosynthetic efficiency. So, in this study, we evaluate different concentrations of nanomaterials on microalgae photosynthetic efficiency. Also, pigment accumulation and other indicators are studied to determine the optimal conditions for increasing the microalgae’s light transfer efficiency and strengthening the photosynthetic carbon sequestration efficiency.

The raw nanomaterial chosen for this experimental study was manganese ferrite nanomaterial (MnFe₂O₄), which has a specific surface area of 45 m²/g and a particle size of 20 nm, and its TEM, XRD, and magnetization curves are shown in Figure 1. Manganese ferrite nanoparticles (MnFe₂O₄) are a spinel-structured material with unique magnetic and optical properties [19]. Compared with the various nanomaterials in Table 1, the iron and manganese in the raw material of manganese ferrite nanoparticles are cheaper, the preparation method is relatively simple, the cost is lower than that of the precious metals Au, Ag, and CdSe, their magnetic and photocatalytic properties make them more multifunctional in applications, and their cost-effectiveness is superior to that of high-cost particles. The high efficiency of manganese ferrite nanoparticles at high CO₂ concentrations indicates their potential for practical applications, especially when compared to other low-cost particles. Manganese ferrite nanoparticles strike a good balance between cost and performance, especially under high CO₂ conditions, and have high potential for industrial applications.

Manganese ferrite nanoparticles have unique advantages over other materials. Firstly, it has spectral adaptability; its narrow bandgap can absorb 500–700 nm visible light, while most nanomaterials such as TiO₂ only respond to ultraviolet light, and the Fe³⁺/Mn²⁺ d-d leap of manganese ferrite nanoparticles can directly match the electron transport chain of photosynthetic system II. Secondly, MnFe nanoparticles have the ability of electron mediation; the surface variable valence states (Mn²⁺/Mn³⁺, Fe²⁺/Fe³⁺) can be used as an “electron bridge” to promote the transfer of photogenerated electrons to the membrane of microalgal vesicles, which can increase the rate of oxygen release from PSII by 40%, and the efficiency of the wide bandgap electron transfer is 3–5 times higher than that of other nanomaterials, such as TiO₂. Finally, MnFe₂O₄ nanoparticles are biocompatible; it has a significantly lower dissolution rate than other nanomaterials such as ZnO in neutral environments, and Fe/Mn is a natural cofactor for photosynthesizing enzymes, avoiding the problem of heavy metal toxicity, a property that makes it both efficient and stable in long-term culture. Therefore, the addition of a certain amount of MnFe₂O₄ nanoparticles has more obvious advantages compared with other nanomaterials.

The core principle of manganese ferrite nanomaterials to improve the photosynthetic carbon sequestration efficiency of microalgae is mainly based on their unique physicochemical properties and the multiscale interactions of the photosynthetic system. The narrow bandgap semiconductor property of manganese ferrite gives it a significant light-absorption ability in the visible region, which can produce near-field enhancement through the focal surface plasmon resonance effect to make up for the short absorption of the microalgal pigment molecules in the green light region. Meanwhile, the interfacial coupling of the nanoparticles to the photosynthetic membrane system induces Forster resonance energy transfer, which efficiently transfers exciton energy to the PSII reaction center. The valorization property of Mn²⁺/Fe³⁺ confers material-like superoxide dismutase activity that scavenges overproduced ROS in the photosynthetic electron transport chain in situ, reducing the risk of photoinhibition. The negative electronegativity interface formed after hydroxylation on the surface of nanomaterials selectively adsorbs HCO₃⁻, the main inorganic carbon source of microalgae, and enhances the substrate concentration in the carboxylation site of Rubisco by shortening the CO₂ diffusion path. The simultaneous Mn²⁺ dissolution effect also activates carbonic anhydrase activity, accelerates CO₂/HCO₃⁻ dynamic equilibrium, and expands the intracellular dissolved inorganic carbon reservoir capacity by 1.5–2-fold. The ferromagnetic properties of ferrite can produce a magnetothermal effect with the assistance of an external magnetic field, which enhances the fluidity of the bursa-like membrane and promotes the conformational change of ATP synthase. This non-thermal effect enhances photosynthetic phosphorylation efficiency by more than 15%, providing a more adequate supply of ATP/NADPH to the Calvin cycle, thereby increasing the photosynthetic carbon sequestration efficiency of microalgae.

Manganese ferrite nanoparticles show significant “green” potential for microalgae carbon sequestration applications due to their unique magnetic and optical properties. From an environmental point of view, their sourcing process can be achieved through sustainable chemical synthesis methods and the availability of abundant and low-cost raw materials (iron and manganese), which reduces pressure on resources. In terms of recycling potential, the magnetic properties of manganese ferrite nanoparticles make them easy to be separated from the culture system by an applied magnetic field and reused, reducing the risk of material waste and secondary contamination. In addition, the study showed that low concentrations of manganese ferrooxides significantly promoted microalgae growth and photosynthetic efficiency, and no significant ecotoxicity was observed, suggesting that the environmental risk is controllable within a reasonable range of use. Overall, manganese ferrite nanoparticles enhance the carbon sequestration efficiency of microalgae while combining recyclability and low environmental risk, which is in line with the development of green technology.

2. Materials and Methods

2.1. Experimental Materials

2.1.1. Sources of Algae Species and Culture Media

The algal strain (Chlorella ellipsoidea, FACHB-41) for this experiment was purchased from the University of Texas Algae Bank, which is tolerant of a 40% CO₂ environment. It was screened in a previous test for CO₂ gradient domestication. To study the efficiency of CO₂ fixation by microalgae, the only inorganic carbon source used throughout the culture was CO₂. Also, a modified BG-11 medium was used for the culture. The medium formulations are shown in

Table 2. Modified BG-11 medium formulation.

Serial Number	Restoratives	Concentration (g/L)	Dosage (mL/L)
1	NaNO3	150.0	10.0
2	K2HPO4	4.0	10.0
3	MgSO4·7H2O	7.5	10.0
4	CaCl2·2H2O	3.6	10.0
5	Citric acid	0.6	10.0
6	Ferric ammonium citrate	0.6	10.0
7	EDTA-Na2	0.1	10.0
8	A5	Table 3	1.0

and

Table 3. A5 masterbatch formulations.

Serial Number	Restoratives	Concentration (g/L)	Dosage (mL/L)
1	H3BO3	2.9	1.0
2	MnCl2·4H2O	1.9	1.0
3	ZnSO4·7H2O	0.2	1.0
4	Na2MoO4·2H2O	0.4	1.0
5	CuSO4·5H2O	0.1	1.0
6	Co(NO3)2·6H2O	0.1	1.0

Note: pH adjusted to 7.1 with NaOH or HCl.

.

2.1.2. Experimental Reagents

The reagents used in this experiment are shown in

Table 4. Main experimental reagents.

Drug Name	Manufacturer
Sodium Nitrate	McLean Biotechnology Co., Shanghai, China
Dipotassium Hydrogen Phosphate	McLean Biotechnology Co., Shanghai, China
Magnesium Sulfate Heptahydrate	McLean Biotechnology Co., Shanghai, China
Calcium Chloride Dihydrate	McLean Biotechnology Co., Shanghai, China
Citric Acid	McLean Biotechnology Co., Shanghai, China
Ammonium Ferric Citrate	McLean Biotechnology Co., Shanghai, China
EDTA Salt	McLean Biotechnology Co., Shanghai, China
Sodium Carbonate	McLean Biotechnology Co., Shanghai, China
Boric Acid	Chemical Factory, Beijing, China
Manganese Chloride Tetrahydrate	McLean Biotechnology Co., Shanghai, China
Zinc Sulfate Heptahydrate	McLean Biotechnology Co., Shanghai, China
Sodium Molybdate Dihydrate	McLean Biotechnology Co., Shanghai, China
Copper Sulfate Pentahydrate	McLean Biotechnology Co., Shanghai, China
Manganese ferrite Nanometer	Hesimo New Material Co., Zhejiang, China
Cobalt Nitrate Hexahydrate	McLean Biotechnology Co., Shanghai, China
Anhydrous ethanol	Zhiyuan Chemical Reagent Co., Tianjin, China
RNAprep pure Plant Total RNA Extraction Kit (Gene Column Type)	Tiangen Biochemistry Technology Co., Beijing, China
FastKing cDNA First Strand Synthesis Kit (de-genomic)	Tiangen Biochemistry Technology Co., Beijing, China
SuperReal Fluorescence Pre-mixing Kit (SYBR Green have)	Tiangen Biochemistry Technology Co., Beijing, China
Carbon Dioxide	Nanfei Gas Technology Development Co., Beijing, China

.

2.1.3. Main Instrumentation of the Experiment

The instrumentation, models, and manufacturers used in this experiment are shown in

Table 5. Main instruments and equipment.

Instrument	Model	Manufacturer
Electronic balance	JB/T5374-1991	Mettler, Zurich, Switzerland
Constant temperature	MS7	IKAC-MAG, Staufen, Germany
Autoclave	GR60DR	Xiamen Zhiwei Instrument Co., Xiamen, China
High-speed centrifuge	Sorvall Lynx 60000	Thermo Fisher Scientific, New York, NY, USA
Light oscillation incubator	ZQZY-BGF8	Zhichu Instrument Co., Shanghai, China
UV spectrophotometer	7600	Jinghua Science and Technology Instrument Co., Shanghai, China
Ultra-clean bench	Heraguard ECO 1.8	Thermo Fisher Scientific, New York, NY, USA
TGrade Lite Metal Bath	OSE-DB-05/06	Tiangen Biochemical Technology Co., Beijing, China
Fluorescence Quantitative PCR Instrument	LightCycler 96	Goldside Biotechnology Co., Shanghai, China
Enzyme labeling instrument	Tecan Spark	Tecan Austria Ltd., Grodig, Austria
Gas flow indicator	D08-2F	Qixing Huachuang Flow Meter Co., Beijing, China
Gas flow controller	D07	Qixing Huachuang Flow Meter Co., Beijing, China
Centrifuge	3-18ks	Sigma, Osterode am Harz, Germany
Drying oven	DZF-6020	Yiheng Technology Co., Shanghai, China
pH meter	PHS-3C	Yidian Scientific Instrument Co., Shanghai, China
Chlorophyll fluorescence meter	AP110	FluorCam, Brno, Czech Republic

.

2.2. Construction of the Experimental Setup

This experiment was carried out using a homemade device, the construction of which is shown in Figure 2. The experiments involved in this study all used this set of devices. A microalgae carbon sequestration reactor with a height of 0.4 m and diameter of 0.25 m was used. The upper part is equipped with an air inlet, and the air inlet pipe goes straight to the bottom of the reactor; this enables the CO₂ gas and microalgae algal liquid to react fully. The upper right and lower left of the outer wall of the reactor are equipped with an air outlet and a feed port, respectively. The feed port is connected to a hose and a valve; this valve controls the amount of feed liquid. For the aeration method, CO₂ gas is mixed with air (filtered through the bacterial membrane) in a buffer bottle through a sevenstar flow control meter; this controls the flow rate, and the mixed gas is passed through a three-way valve, or a four-way valve, through a rotor flow control meter into the microalgae reactor. This distributes the microalgae carbon sequestration reaction into several vessels evenly.

2.3. Experimental Design

In this study, the initial inoculum concentration of microalgae was first diluted to OD₆₈₀ = 0.4 using microalgae 41 after 4 generations of continuous culture at 40% CO₂ concentration. The toxicity threshold of manganese ferrite nanoparticles on microalgae was used as a safety baseline, and within the safety range, different concentrations of manganese ferrite nanoparticles were set to be added to determine the peak concentration of photosynthetic carbon sequestration efficiency, to reduce the toxicity of the experimental group to no acute toxicity at a low concentration, and to determine the long-term stability by testing the microalgae’s growth and physiological changes over 12 days and the chlorophyll fluorescence parameter, etc. Eventually, 30 mg/L, 60 mg/L, 90 mg/L, and 120 mg/L concentrations of manganese ferrite nanomaterials were added to the microalgae carbon fixation reactor. Three experimental groups were set up in parallel, each with 40% CO₂ to control the flow rate of 0.1 vvm, at 25 °C. Light intensity was set at 4500 Lux, with continuous light cultivation for 12 days. The growth of microalgae, carbon fixation rate, pigment accumulation, chlorophyll fluorescence parameters, and the expression of key photosynthetic genes were tested and analyzed. The optimal treatment conditions were compared to promote the conversion and absorption of light by microalgae and improve the photosynthetic carbon fixation efficiency.

2.4. Analysis and Calculations

2.4.1. Methods of Biomass Determination

The acetate filter membrane of 0.45 um pore size was soaked in a sufficient amount of distilled water for 6 h [20]; then, the surface water was drained off, and the membrane was dried in a constant-temperature drying oven at 80 °C until constant weight, cooled in a desiccator, and weighed (M₁). A 10 mL sample of algal liquid was poured into a filter, and then pumped dry. Then, distilled water was used to drench the filter membrane three times and then, it was pumped dry; the filter membrane was put into a constant-temperature drying oven at 80 °C and dried to a constant weight. The microalgae was filtered in a membrane and then thoroughly dried and dehydrated. Finally, the sample was cooled in a desiccator and weighed (M₂). The calculation formula for biomass determination is as shown in Equation (1):

Y(g/L) = (M₂ − M₁)/V

(1)

where M₁ is the weight of the filter membrane (mg), M₂ is the weight of the algae and filter membrane (mg), and V is the volume of the microalgae algal solution (L).

2.4.2. Measurement of Growth Rate

Growth rate is calculated by Equation (2):

V(mg/L/d) = DW₂ − DW₁/t₁ − t₂

(2)

where DW₁ is the biomass concentration at time t₁ (mg/L), and DW₂ is the biomass concentration at time t₂ (mg/L).

2.4.3. Determination of Carbon Dioxide Fixation Rate

The carbon dioxide fixation rate R (mg/L/d) is as shown in Equations (3) and (4):

R = Cc × (MCO₂/Mc) × P

(3)

where Cc is the carbon content (%, w/w) in microalgal cell biomass, Cc is 50%; MCO₂ is the molar molecular weight of carbon dioxide, value 44 g/moL; Mc is the molar mass of elemental carbon, with a value of 12 g/moL; and P is the microalgal cell biomass yield (mg/L/d), which was calculated as follows:

P = (BCt/BC₀)/Δt

(4)

where BCt is the biomass concentration of microalgal cells at day (mg/L), BC₀ is the bio- mass concentration of microalgae cells in the initial state (mg/L), and Δt is the incubation time (d).

2.4.4. Determination of pH

The algal solution was inserted into a Ray magnetic pH meter and recorded when the reading stabilized.

2.4.5. Measurement Method of Chlorophyll Content

A 5 mL sample of algal liquid was centrifuged; then, 5 mL of 95% ethanol was added, and the sample was placed in a 75 °C water bath. It reacted for 15 min. When the reaction was complete, the sample was cooled and then centrifuged at 5000 r/min for 5 min; the supernatant was collected. Using a UV–visible spectrophotometer, the OD values at 665 nm and 649 nm were read, and the test was set up with two repetitions. The chlorophyll concentration was calculated according to following Equations (5) and (6) [21]:

Ca (mg/L) = 13.95 × OD₆₆₅ − 6.88 × OD₆₄₉

(5)

where OD₆₆₅ is the absorbance value of microalgae at 665 nm, and OD₆₄₉ is the absorbance value of microalgae at 649 nm.

Cb (mg/L) = 24.96 × OD₆₄₉ − 7.32 × OD₆₆₅

(6)

where OD₆₄₉ is the absorbance value of Chlorella at 649 nm, and OD₆₆₅ is the absorbance value of Chlorella at 665 nm.

2.4.6. Determination Method of Chlorophyll Fluorescence Parameters

Two samples of 3.5 mL of algal cell culture solution in the dark were collected and dark-treated for more than 20 min each, to ensure that the reaction center of light was completely open and the electron transfer was completely oxidized. Then, the samples were put in the AP110-C Chlorophyll Fluorescence Instrument to determine relevant photosynthetic parameters; the meaning of each chlorophyll fluorescence parameter is shown in

Table 6. Chlorophyll fluorescence parameters.

Parameter	Meaning
Fv/Fm	Maximum photosynthetic efficiency under dark conditions in response to the potential photochemical capacity of PSII in algal cells
Fv′/Fm′	Actual light energy conversion efficiency, reflecting the primary light energy capture efficiency of open PSII reaction center
ETo/RC	Energy used for electron transfer in the unit reaction center
qP	Photochemical quenching coefficient, reflecting the degree of opening of PSII reaction centers
NPQ	Non-photochemical quenching coefficient, how much reaction heat is dissipated

.

2.4.7. Fluorescence Quantitative PCR Assays

Selection of Target Genes

The target genes determined in this experiment were PsbA, PsbC, LHCB2, LHCB5, PetC, PetF, PetH, LHCA2, LHCA5, and RbcL.

PsbA and PsbC encode the reaction center D1 protein subunit of the PSII core complex and the CP43 protein subunit at the antenna splice site, respectively. LHCB2 and LHCB5 are genes coding for LHCII light-harvesting complex II. Light-harvesting pigment protein complex (LHCII) is a pigment protein centered on light energy capture and transfer and energy dissipation and photoprotective function under light stress. PetC is an iron–sulfur protein of the cytochrome b6-f complex, which encodes an iron–sulfur protein that acts as an electron transporter and is involved in various physiological processes in plants. The PetF gene encodes ferredoxin (Fd), which is involved in the electron transfer process of photosynthesis. The PetH gene encodes ferredoxin- NADP+ reductase (FNR), which is responsible for the acquisition of electrons and H+ from Fd and the conversion of NADP+ to NADPH during the Calvin cycle. LHCA2 and LHCA5 encode LHCI light-harvesting complex I. LHCI is mainly responsible for transferring light energy to the active center of the PSI core subunit, which leads to charge separation and electron transfer reactions. RbcL, the gene encoding Rubisco enzyme, is a key gene in the microalgae dark reaction Calvin cycle, which absorbs CO₂ for the dark reaction and directly determines CO₂ fixation capacity.

Fluorescence Quantitative PCR Procedure

Sample RNA was first extracted using the RNA-prep pure total plant RNA extract- ion kit; then, the extracted RNA from the previous step was reverse-transcribed into cDNA, using a reverse transcription kit. Finally, primers were designed to detect the expression by RT-PCR. A total of 7.5 mL of microalgae was added to a centrifuge tube and centrifuged to remove supernatant. Then, 1 mL of distilled water was added for resuspension and concentration in a 1.5 mL centrifuge tube, and then, this was centrifuged to remove the supernatant. Then, wall-breaking grinding was carried out with a grinding stick, followed by RNA extraction, and the steps of RNA-prep pure plant total RNA extraction kit were followed. Then, the steps for DNA removal were carried out with a DNA digestion kit; finally, the extracted RNA was collected for spare use.

The RT-RCR program is shown in

Table 7. qPCR amplification program.

Step	Temperature	Time	Number of Cycles
Step 1	95 °C	30 s	1
Step 2	95 °C	5 s	45
	60 °C	20 s
Step 3	95 °C	1 min	1
	55 °C
	95 °C

below.

Primers were designed using the NCBI website, and 18sRNA was selected as the internal reference gene; the primer design for the internal reference gene and the target gene is shown in

Table 8. Primer design of internal reference gene and target gene.

Gene	Primer Sequence 5′-3′	Gene Annotation
18s	F: ACTTCTTAGAGGGACTATTGGCG	Growth reference genes
	R: CCTTGTTACGACTTCTCCTTCCT
RbcL	F: CTTGGACGACTGTATGGACTG	Rubisco enzyme large subunit gene
	R: ATACCGTGAGGAGGACCTTG
PsbA	F: TGCTTGGCCAGTTGTTGGTA	PSII reaction center D1 protein subunit
	R: ACGCTCGTGCATTACTTCCA
PsbC	F: AGGT CCAGAAGCATCACA	CP43 protein subunit of PSII reaction center
	R: AAT CCCAGAAACGCATAG
LHCB2	F: CTACCTGACTGGCGAGTTCC	LHCII light-harvesting complex II gene
	R: CCTCCTGGAAGATCTGAGCA
LHCB5	F: GACCTGGACAAGTGGTACGG	LHCII light-harvesting complex II gene
	R: CAGAGGGTCGTAGCCGTAGT
PetC	F: TCGGTCACGATCAGGTAGGT	Cytochrome b6-f complex iron–sulfur protein gene
	R: CCTACGCCCTGTTCTTCGTG
PetH	F: CCACGTGGAGGTGTACTGAG	Ferredoxin-NADP+ reductase gene
	GAGTGCCGAAAATAAGCGCC
PetF	F: GTGATCACTATCAGCTACGA	Iron Oxygen Reduction Protein Gene
	R: ACCTCCGACTACGCTGTCGT
LHCA2	F: GTTGCGGATCTCGTTGGTC	LHCI phototrapping complexl gene
	R: CCCCTACACGCTGTTCTGG
LHCA5	F: TGGGCGACTACGGCTTT	LHCI photoconjugate complexl gene
	R: CTCCAGGATGGCGAAGGT

.

3. Results

3.1. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on the Growth of Microalgae

As can be seen from Figure 3a, the addition of different concentrations of nanomaterials helped to enhance the biomass of common microalgae. The microalgae with 90 mg/L manganese ferrite nanoparticles had an obvious growth advantage. The experimental group had the largest biomass of 1320 mg/L on day 12, which was 42.7% higher than that of the control group. As can be seen from Figure 3b, the growth of microalgae with different concentrations of nanomaterials added was relatively slow on the first day, probably due to the fact that the microalgae had just entered the high concentration of CO₂ and conditions without which it would not have adapted; however, it began to grow rapidly into the logarithmic growth period on days 2–8, and entered into a growth plateau on days 9–12.

3.2. Effect of Different Concentrations of Manganese Ferrite Nanoparticles on the pH of Microalgal Algal Blooms

pH is an important factor that influences the growth of microalgae for efficient carbon sequestration [22]. As seen in Figure 4, on adding different concentrations of manganese ferrite nanoparticles to microalgae No. 41, the pH of the algal solution decreased sharply on the first day of growth (initial pH of 6.8), but then the pH gradually increased and stabilized at about 6.9. This was attributed to the increase in algal pH caused by the regulation of cellular metabolic action of the microalgae, when the microalgae were grown in the conditions of high CO₂ concentration, after the cells became adapted. When microalgae grow under high CO₂ concentration, the cell adapts to the strategy by reducing the activity of PSII system. The energy allocation of non-cyclic photosynthetic phosphorylation and increasing the energy ratio of cyclic photosynthetic phosphorylation of PSI system reduce normal organic carbon synthesis. At the same time, this provides and allocates more ATP for the maintenance of intracellular pH stability. So, after the metabolic adjustments in the delayed period of 1–2 days, the microalgae is able to accelerate growth, and gradually returns to a normal growth rate and enters the logarithmic growth period [23]. Finally, the algal ions reach equilibrium and the pH stabilizes. Therefore, the nano-manganese ferrite 1–7 adjusts the pH value of the algal fluid by promoting the metabolism of the microalgae, so that the pH value is slightly increased and stabilized in the weakly alkaline zone, in order to maintain a suitable environment for the microalgae, which is conducive to the growth of the microalgae.

3.3. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on the Carbon Sequestration Rate of Microalgae

As shown in Figure 5, the rate of CO₂ fixation in microalgae increased with the increase in Mn nano ferrite concentration (0–90 mg/L) in the first 7 days of incubation. The 90 mg/L Mn nano ferrite showed the greatest CO₂ fixation rate, from the beginning of the incubation to the 6th day, which was 260 mg/L/d, and 30.0% higher than that of the control group. The CO₂ fixation rate of microalgae with the addition of 120 mg/L Mn nano ferrite was slightly decreased, compared to that of 90 mg/L of manganese ferrite nanoparticles. However, this decrease in the carbon fixation rate of microalgae was still higher than the carbon fixation rate of the blank control group. With the prolongation of the incubation time, at 8–12 days, both the experimental group and the control group showed a decreasing trend. The reason for this result may be that the microalgae in this experiment belongs to continuous cultivation, and the nutrient salts, such as nitrogen and phosphorus sources, in the culture solution were limited. With the increase in the incubation time, the nutrient salts were gradually consumed, so the microalgae biomass yield gradually decreased, and therefore, the rate of CO₂ fixation decreased at the end of the growth period.

3.4. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on Chlorophyll Accumulation in Microalgae

As shown in Figure 6, the chlorophyll concentration in the microalgae, with 90 mg/L of manganese ferrite nanoparticles added, was significantly higher than that in the control group. The chlorophyll concentration reached 19.86 mg/L, which was 1.21 times higher than that in the control group. This suggests that the incorporation of nanomaterials can significantly promote the accumulation of chlorophyll in microalgae. Low concentrations of nanomaterials provide microalgae with key nutrients required for chlorophyll synthesis by releasing trace iron [24], while their photocatalytic properties enhance the efficiency of light energy utilization in the algal solution, thus accelerating the photosynthesis process.

3.5. Study on the Effect of Different Nanomaterials on Chlorophyll Fluorescence Parameters of Microalgae

3.5.1. Study on the Effect of Different Concentrations of Manganese Ferrite Nanomaterials on Fv/Fm of Microalgae

Fv/Fm is the PSII photochemical maximum quantum yield, which reflects the potential photochemical capacity of PSII in algal cells [25]. As can be seen from Figure 7, the Fv/Fm of the added nanomaterials showed a trend of rising and then falling and did not show a rapid and substantial decrease, indicating that the microalgae did not undergo stress. The addition of a certain concentration of nanomaterials could increase the photosynthetic phosphorylation level of microalgae, increase ATP synthesis, increase the efficiency of the Calvin cycle, and promote the synthesis and regeneration of NADP⁺ and NADPH, increasing the rate of carbon sequestration by microalgae. This contributed to the enhancement of the functional activity of PSII, which was manifested in the increase in the photochemical efficiency and quantum yield of PSII, and the increase in the Fv/Fm ratio [26]. The small decrease in Fv/Fm value was because the Fv/Fm value was proportional to the chlorophyll content, and the microalgae adapted to the high concentration of CO₂ in the late stage. This intensified the nutrient depletion of the microalgae, and the algal cell growth was faster. The color became darker green, which led to insufficient light, and the carbon source was used for the increase in the cellular biomass to the extent that the chlorophyll nutrient was lacking. This led to the obstruction of chlorophyll synthesis, the decrease in the chlorophyll content, and the decrease in the Fv/Fm ratio value [27]. However, the Fv/Fm values of the experimental group were still higher than those of the blank control group. It can be shown that the added manganese ferrite nanomaterials can improve the light energy capture efficiency, provide more ATP and NADPH for the Calvin cycle, and enhance the photosynthetic carbon sequestration efficiency of microalgae.

3.5.2. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on Microalgae Fv′/Fm′

Fv′/Fm′ is the actual light energy conversion efficiency, which represents the quantum efficiency of linear electron transfer and reflects the efficiency of primary light energy capture in open PSII reaction centers. However, CO₂ protects both the excitation energy capture efficiency and the photochemical reaction from being less affected by the photoprotection mechanism. As can be seen from Figure 8, the Fv′/Fm′ ratio of the experimental group with different concentrations of nanomaterials showed a trend of first increasing and then decreasing. But the overall change was not significant, and there was no rapid and large-scale decline, suggesting that smooth linear electron transfer, which supports the continued operation of the Calvin cycle, can contribute to the efficiency of carbon sequestration by microalgae, indicating that the microalgae did not undergo stress. Thus, the microalgae could grow normally and stably, after the addition of nanomaterials with different concentrations.

3.5.3. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on Microalgae qP

qP is the photochemical bursting coefficient, which represents the photochemical quenching of variable chlorophyll fluorescence quenching. It is commonly used to reflect the degree of opening of PSII reaction centers [28]. As shown in Figure 9, the trend of qP in both the experimental group and the blank control group first increased and then decreased; this was the same as the trend of the Fv/Fm ratio. The qP values of each experimental group ranged from about 0.7 to 0.9. The synthesis of microalgae growth, carbon sequestration, and other indicators can be learned from the data. The addition of manganese ferrite nanoparticles in the first three days led to an increase in the activity of the reaction centers, opened by microalgae PSII and an increase in the number of electrons involved in the fixation of CO_2, suggesting that more electrons are used for CO₂ reduction rather than heat dissipation, directly contributing to carbon sequestration efficiency. This led to the enhancement of the photosynthetic electron transfer capacity and an increase in the photosynthetic efficiency, and thus the rise in qP in the first three days [29]. The decrease in qP indicates a decrease in the index of the proportion of open reaction centers in PSII reaction centers. This resulted in a blockage of electron transfer from the oxidized side of PSII to PSI reaction centers and a decrease in the number of electrons used to carry out photosynthesis. Thus, there was a decrease in the ability to use captured photon energy for photochemical reactions, resulted in a decrease in the ability to emit only light energy, dissipated as heat or in some other form, which is a kind of active defense mechanism to avoid algae from being damaged [30]. Overall, the addition of manganese ferrite nanoparticles resulted in enhanced photosynthetic electron transfer capacity and increased photosynthetic efficiency of the microalgae.

3.5.4. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on NPQ of Microalgae

NPQ is the non-photochemical quenching coefficient, which represents the reduction in fluorescence yield due to non-photochemical reactions, and is often used to indicate how much heat is dissipated. As can be seen in Figure 10, the NPQ values of the experimental group were reduced compared to the control group, indicating that the heat dissipation in the experimental group with the addition of nanomaterials was reduced. Thus, more energy was used for the photochemical reaction. It can be concluded that the microalgae with added manganese ferrite nanomaterials had faster energy transfer during the photoreaction. The increased energy (electron) transfer rate of the photoreaction may synthesize more energetic compounds and reduce power, thus promoting the turnover rate of carbon flow in the Calvin cycle. This further explains the increase in the rate of carbon sequestration in the late stage of microalgae and the significant increase in the expression of key genes for carbon sequestration. The NPQs of all four experimental groups in Figure 10 tend to decrease and then increase throughout the experiment. NPQ experienced a decline from day 0 to 3, but then an upward trend began on day 4, at the same time as its Fv/Fm ratio change occurred.

The reason that NPQ is not 0 on the 1st day of inoculation may be because the algae species were transferred from a starvation medium for cultivation under a high CO₂ concentration. This required an adaptation process, and the excess light energy could not be completely absorbed and transformed by ordinary Chlorella. To protect itself from being harmed, it had to emit the excess light energy in the form of heat, so the NPQ could not be 0. And from day 2–4, NPQ was 0. The reason is that the Fv/Fm ratio increased dramatically from day 2–4 when the algal cells were not yet limited by nutrient salts. The non-photochemical burst was at a lower level, the Calvin cycle of the algal cells was active, the utilization rate of the light energy was higher, the photosynthetic efficiency was improved, the absorption and conversion ability of the microalgae to light energy was not weakened drastically, and finally, the photosynthetic apparatus would not be damaged, so the NPQ remained at 0. This further indicates that the addition of manganese ferrite nanomaterials facilitates the capture and utilization of light energy by chlorophyll and does not result in excess light energy, suggesting that light energy is used more for photochemical reactions than for heat dissipation, thus enhancing carbon sequestration efficiency. The reason for the increasing NPQ from the fifth day is that the process of this change occurred at a late stage of the experiment. This indicated that the proportion of light energy absorbed by microalgae for heat dissipation had increased. The gradual increase in the microalgae NPQ to stabilization under the condition of high concentration of CO₂ indicated that the degree of its inhibition of the activity of the Calvin cycle increased, and the potential for heat dissipation of PSII increased, which is a protective effect for the algal organism itself. With the prolongation of incubation time, nutrient salt limitation gradually manifested and became more and more obvious. The Calvin cycle was inhibited, the efficiency of photosynthesis was reduced, the utilization of chlorophyll after absorbing light energy was lower, and the excess light energy was emitted in the form of heat dissipation; this led to an increase in NPQ, thus avoiding or mitigating the damage of the photosynthetic apparatus caused by the absorption of excessive light energy by PSII. The addition of 90 mg/L of manganese ferrite nanoparticles ultimately had the smallest NPQ, probably because this concentration was the best in the experimental group. This indicated that its activity of the Calvin cycle was minimally inhibited, with high energy utilization. This resulted in less excess light energy and a higher photosynthetic and carbon fixation efficiency, which were all most suitable for the growth of the microalgae.

3.5.5. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on ETo/RC of Microalgae

ETo/RC denotes the energy per unit area used for electron transfer. It can be seen from Figure 11 that ETo/RC shows a general trend of first increasing and then decreasing, and finally stabilizing. This result may be attributed to the fact that the addition of nanomaterials at the beginning will promote the Calvin cycle during photosynthesis. High ETo/RC indicates a strong activity of the electron transport chain, driving more NADPH production, providing reducing power for Rubisco enzymes, and promoting carbon sequestration efficiency. This makes the synthesis of microalgae chlorophyll and the rate of cell division increase, with an increase in ATP, so that the rate of electron transfer in the PSII reaction center may be enhanced, increasing microalgae photosynthetic efficiency. During this period, microalgae rapidly adapts to the high concentration of CO₂ conditions, allowing the rate of CO₂ fixation to increase. The increased carbon fixation rate of microalgae can exacerbate nutrient consumption and, thus, suppress the electron transfer rate of the PSII reaction center, which can lead to a decrease in photosynthetic efficiency. Microalgae, with different concentrations of nanomaterials added, can reach a dynamic equilibrium in electron transfer after short-term acclimatization to conditions of high CO₂ concentration. The experimental groups with the addition of manganese ferrite nanomaterials all showed some increase in the energy of electron transfer, compared to the control group, implying that they have enhanced PSII reaction center activity and greater ability to drive more electrons for transfer. Also, higher electron transfer rates allow the microalgae cells to capture a gradual increase in the number of photo-quanta that can be utilized.

3.6. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on Gene Expression of Microalgae

3.6.1. Study on the Effect of Two Nanomaterials on the Expression of Key Genes of Microalgae Photoresponsive PSII

PsbA and PsbC are important regulatory genes for the synthesis of response center proteins of the PSII core complex. LHCB2 and LHCB5 are genes coded for the LHCII light-trapping complex II, whose main functions include the capture and transfer of light energy and the regulation of excitation energy distribution between PSI and PSII [31]. As can be seen in Figure 12, the addition of different concentrations of nanomaterials significantly upregulated the gene expression of PsbA, PsbC, and LHCB2 proteins in microalgae. It has been shown that to achieve the most suitable living environment, photosynthetic organisms can better adapt to the quality and quantity of light energy by regulating the components of their photosynthesis system. Photosynthetic organisms regulate the size and composition of their light-trapping antenna system. Therefore, the manganese ferrite nanomaterials can cause a significant upregulation of LHCB2, the gene coding for the main protein of LHCII, in the face of high-CO₂-concentration conditions. This suggests that the manganese ferrite nanomaterials have a greater effect on the transcriptional level of the LHCB2 protein. The light-trapping antennae proteins in the excited state can enhance the cell’s ability to capture light and increase the penetration of light energy to improve photosynthetic efficiency. However, the nanomaterials did not have a significant effect on LHCB5 protein transcription, so it is hypothesized that the main site of action of the nanomaterials on microalgae is LHCB2, and it is not obvious for LHCB5.

3.6.2. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on the Expression of Key Genes for Light-Responsive Electron Transfer in Microalgae

PetC encodes the cytochrome b6-f complex iron–sulfur protein, whose primary role is to accept electrons and transfer them to the next electron acceptor. PetF encodes ferredoxin (Fd), which is involved in the electron transfer process of photosynthesis. PetH encodes ferredoxin-NADP⁺ reductase (FNR), the terminal oxidase of the photosynthetic electron transport chain. FNR catalyzes the end-point reaction of photosystem-I electron transport, converting NADP⁺ and H+ to NADPH.

As can be seen in Figure 13, the gene expression of PetC, PetF and PetH in the experimental group was significantly upregulated relative to the control group, indicating that the addition of different concentrations of manganese ferrite nanomaterials made the electron transfer in the microalgae cells very active. The ferredoxin-NADP⁺ reductase catalyzed the synthesis of more NADPH by electrons from the reduced flavin proteins, which provided more substrates of NADPH for the dark reaction, thereby enhancing the photosynthetic efficiency. Therefore, it can be shown that the addition of different concentrations of nanomaterials can increase the relative electron transfer rate of microalgae, thus enhancing the photosynthetic efficiency of microalgae.

3.6.3. Effects of Different Concentrations of Manganese Ferrite Nanoparticles on the Expression of Key Genes of Microalgae Photoresponsive PSI

PSI is composed of subunits such as reaction center complex and light-trapping complex, which contain a light-trapping complex and a light reaction center. The light-trapping complex that constitutes PSI is called LCHI [32]. LHCA2 and LHCA5 encode the LHCI light-trapping complex I. As can be seen from Figure 14, the addition of different concentrations of manganese ferrite nanoparticles resulted in the upregulation of light-trapping complex protein gene expression in the PSI reaction centers of microalgae. In particular, the experimental group with the addition of 90 mg/L of manganese ferrite nanoparticles was very different from the control group. Increased synthesis of photosynthetic antenna proteins allows for the formation of more light-trapping complexes with photosynthetic pigments, improving the light-trapping efficiency and energy transfer of PSI. Therefore, the addition of manganese ferrite nanomaterials increased the reactivity of PSI and PSII and caused a coordinated interaction between the two, to promote the transfer of energy in the photosynthetic electron transport chain. This increased the photosynthetic efficiency of the microalgae and thus promoted their biomass synthesis, while providing a basis for the rate of carbon fixation [33].

3.6.4. Study on the Effect of Different Concentrations of Manganese Ferrite Nanoparticles on the Expression of Key Rubisco Genes for Carbon Sequestration in Microalgae

RbcL encodes the Rubisco enzyme gene, the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase of the Calvin cycle, which is a key enzyme in the CO₂ fixation process [34]. As can be seen from Figure 15, the expression of the Rubisco enzyme in the experimental group was high, compared with that of the blank control group. This indicates that the addition of a certain amount of manganese ferrite nanomaterials may cause the presence of more activated forms of Rubisco enzyme. This led to the increase in the initial enzyme activity of the Rubisco enzyme. The activity of Rubisco-activating enzyme is positively correlated with the concentration of RuBP. The addition of a certain amount of manganese ferrite nanoparticles caused the microalgae to synthesize more RuBP, which in turn activated more Rubisco enzyme and increased the rate of CO₂ fixation.

4. Conclusions

Based on the limited light absorption and utilization efficiency of microalgae during photosynthesis, the present study was conducted by adding different concentrations of manganese ferrite nanomaterials to microalgae No. 41 at 40% CO₂ concentration. The growth and metabolism of the microalgae were investigated during the process of carbon sequestration. Chlorophyll fluorescence parameters and changes in the expression of key genes for photosynthesis and carbon sequestration were compared and analyzed to obtain the optimal concentration of nanomaterials to improve the light absorption and transmission efficiency of microalgae. Thus, the photosynthetic efficiency of microalgae was improved. These results are summarized as follows:

(1) The addition of 30–120 mg/L manganese ferrite nanoparticles helped to increase the biomass and carbon sequestration rate of the microalgae. Specifically, the addition of 90 mg/L manganese ferrite nanoparticles had an obvious growth advantage for the microalgae. The carbon sequestration rate of the experimental group reached the maximum on the 6th day, which was 40.72% higher than that of the control group. The biomass growth and the concentration of chlorophyll reached a maximum on the 12th day, which were 42.7% and 12.1% higher than that of the control group. At first, the pH of MnFePO₄ nanomaterials decreased; then, the pH gradually increased and stabilized at about 6.9. It is shown that the nanomaterials promote the growth and metabolism of microalgae, thereby regulating the pH of the algal fluid to maintain a suitable growth environment for microalgae. The experimental group with the addition of 120 mg/L manganese ferrite nanoparticles was still better than the control group, but the effect was significantly lower than that of the 90 mg/L experimental group, and this trend of “increasing and then decreasing” indicates that the effect of adding manganese ferrite nanoparticles to the experimental group is still better than that of the control group. The light scattering effect of manganese ferrite nanoparticles was maximized at 90 mg/L. Higher concentrations, on the contrary, reduced the light penetration depth. The electron-mediated capacity was close to the carrying limit of the photosynthetic chain of microalgae, and the high concentration of nanoparticles might adsorb nutrient salts in the medium, exacerbating the nutrient limitation at the late stage of cultivation. Thus, the addition of 90 mg/L of manganese ferrite nanoparticles was the saturation point for light-absorption enhancement and electron transfer facilitation, with higher concentrations leading to diminishing returns.

(2) Microalgae photosynthetic activity parameters Fv/Fm, Fv′/Fm′, qP, and ETo/RC all showed a trend of increasing and then decreasing. However, NPQ showed the opposite effect, a trend of decreasing and then increasing. The photosynthetic activity of the microalgae in the experimental group was higher than that of the control group. The microalgae with the highest concentration of chlorophyll, the strongest ability to capture light, the strongest photosynthetic activity, and the fastest photoresponse was detected when 90 mg/L of manganese ferrite nanoparticles was added. The highest concentration of chlorophyll, the strongest light-trapping ability, the strongest photosynthetic activity, and the fastest electron transfer rate in the light reaction were all observed in the experimental group. It began to decline as it continued to rise up to 120 mg/L. NPQ was lowest in the experimental group with the addition of 90 mg/L of manganese ferrite nanoparticles, indicating the highest light energy utilization, whereas NPQ increased in the experimental group with the addition of 120 mg/L of manganese ferrite nanoparticles, suggesting that the excess light energy was dissipated in the form of heat, reflecting the beginning of the damage to the photosynthetic apparatus. The increase in NPQ and the decrease in Fv/Fm suggest that photosystem II may be subjected to oxidative damage at high concentrations. This indicated that the addition of an appropriate concentration of manganese ferrite nanoparticles could alleviate the inhibitory effect of the high concentration of CO₂ on the photosynthesis of microalgae. This not only promoted the Calvin cycle of microalgae photosynthesis but also affected the synthesis of chlorophyll and the division of the cells, thus increasing the photosynthetic activity and the efficiency.

(3) From the analysis of gene expression, the addition of different concentrations of nanomaterials upregulated the gene expression of the light capture complex protein in the PSI reaction center of microalgae. The addition of manganese ferrite nanoparticles increased the reaction activity of microalgae PSI and PSII and coordinated the two to promote the transfer of energy in the photosynthetic electron transport chain. This improved the photosynthetic efficiency of the microalgae, promoted its biomass synthesis, and provided a basis for the improved carbon fixation rate. This study clearly supports the addition of 90 mg/L of manganese ferrite nanoparticles as the performance threshold, beyond which negative effects dominate, leading to diminishing returns, and a concentration window of 80–100 mg/L should be prioritized for industrial applications to balance efficiency and safety.

5. Prospects

In this study, it was found that the addition of a certain concentration of manganese ferrite nanomaterials could increase the relative electron transfer rate of microalgae PS II and improve the photosynthetic activity and photosynthetic efficiency of microalgae under controlled conditions. Although some research results have been achieved, due to conditions and time constraints, this study is relatively limited on the mechanism of how nanomaterials can improve the photosynthetic efficiency of microalgae, and its potential risks should not be ignored. If the nanomaterials are discharged with the algal solution into natural water bodies, they may be toxic to aquatic organisms and may enter microalgal cells through endocytosis, and their long-term accumulation may interfere with cell metabolism, leading to oxidative stress and damage to membrane structure. In the future, it is hoped that ecotoxicological studies can be invoked in research experiments or simulations can be carried out to increase the detection of intracellular nanoparticle distribution and functional effects on organelles, to quantify their effects on organisms at different trophic levels, to develop surface passivation or magnetic recycling techniques to reduce the risk of environmental residues, and to assess the residual amount of nanoparticles in biomass and their safety for downstream applications. The risk of carbon re-release due to cell lysis after microalgae death should be evaluated, and cell wall strengthening technologies should be developed to reduce degradation rates or achieve permanent carbon sequestration through deep geological sequestration to avoid secondary release of CO₂ due to microbial decomposition after short-term carbon sequestration. Through multidisciplinary collaboration, nanomaterial-enhanced microalgae carbon sequestration technology is expected to be a key link in a negative emissions (CDR) system that promotes balance efficiency and ecological sustainability.

This experimental study of enhanced photosynthetic carbon sequestration by microalgae using manganese ferrite nanoparticles has multiple potential advantages. Firstly, manganese ferrite nanoparticles significantly enhanced the carbon sequestration rate of microalgae at 40% CO₂ concentration by enhancing light energy absorption and electron transfer efficiency, which is both highly efficient and sustainable and avoids the problem of high energy consumption compared to traditional carbon sequestration methods and offers the possibility of direct utilization of industrial waste gas. Secondly, the method promotes the Calvin cycle and biomass accumulation by upregulating photosynthetic gene expression, which can synchronize carbon sequestration and bioenergy production; moreover, the low ecotoxicity of the nanomaterials provides a safety guarantee for their practical application. In practical application, it can be combined with an open-pool system or photobioreactor, using industrial waste gas as a carbon source, developing efficient gas diffusion technology to maintain the supply of carbon source, combining with dynamic light regulation to adapt to the natural fluctuation of light intensity, evaluating the stability of manganese ferrite nanoparticles in the open system, and reducing the cost and risk through the immobilization of nanomaterials technology. We also coupled the extraction of high-value-added products after microalgae harvesting to form a closed loop of “carbon capture-resourcing”, to promote its large-scale implementation in the carbon neutral and circular economy, and to gradually demonstrate the feasibility of large-scale implementation through pilot tests, so as to maximize the efficiency of carbon sequestration and to balance the economy and ecological safety.