Unveiling the Effects of Two Polycyclic Aromatic Hydrocarbons and Two Temperatures on the Trout RTL-W1 Cell Line Expression of Detoxification-Related Target Genes
Abstract
1. Introduction
2. Materials and Methods
2.1. The Culture of the RTL-W1 Cell Line
2.2. Exposure to PAHs
2.3. Lactate Dehydrogenase (LDH) Assay
2.4. Molecular Analysis
2.4.1. RNA Extraction and cDNA Synthesis
2.4.2. Reverse Transcription–Quantitative Polymerase Chain Reaction (RT-qPCR)
| Gene | Primer (5′-3′) | Protocol | E (%) | Reference |
|---|---|---|---|---|
| AhR | F: GGATGCCACTGAGTTCCAAACCAA R: AATGCCTGGTCTATGGGTAGCTGA | 95 °C—3 min (95 °C—20 s; 60.0 °C—20 s; 72 °C—20 s) 40× 95 °C—1 min | 101.6 | [38] |
| CYP1A | F: GATGTCAGTGGCAGCTTTGA R: TCCTGGTCATCATGGCTGTA | 95 °C—3 min (95 °C—20 s; 60.0 °C—20 s; 72 °C—20 s) 40× 95 °C—1 min | 97.7 | [39] |
| CYP3A27 | F: GACGGTGGAGATCAACG R: GAGGATCTCGACCATGG | 95 °C—3 min (95 °C—20 s; 60.0 °C—20 s; 72 °C—20 s) 40× 95 °C—1 min | 99.0 | [39] |
| UGT | F: ATAAGGACCGTCCCATCGAG R: ATCCAGTTGAGGTCGTGAGC | 94 °C—3 min (94 °C—20 s; 60.0 °C—20 s; 72 °C—20 s) 40× 94°C—1 min | 94.9 | [39] |
| GSTO1 | F: AGCTGCTCCCAGCTGATCC R: CAAACCACGGCCACATCATGTAATC | 94°C—3 min (94 °C—20 s; 60.0 °C—20 s; 72 °C—20 s) 40× 94 °C—1 min | 93.9 | [38] |
| CAT | F: CACTGATGAGGGCAACTGGG R: CTTGAAGTGGAACTTGCAG | 95 °C—3 min (95 °C—10 s; 58.0 °C—30 s; 72 °C—30 s) 40× 95 °C—30 s | 104.5 | [40] |
| MRP2 | F: CCATTCTGTTCGCTGTCTCA R: CTCGTAGCAGGGTCTGGAAG | 94 °C—3 min (94 °C—20 s; 60.0 °C—20 s; 72 °C—20 s) 40× 94 °C—1 min | 100.2 | [39] |
| β-act | F: TCTGGCATCACACCTTCTAC R: TTCTCCCTGTTGGCTTTGG | 94 °C—3 min (94 °C—20 s; 55.0 °C—20 s; 72 °C—20 s) 40× 94 °C—1 min | 99.7 | [41] |
| ef1α | F: TGCCACACTGCTCACATC R: TCTCCAGACTTCAGGAACTTG | 94 °C—3 min (94 °C—20 s; 55.0 °C—20 s; 72 °C—20 s) 40× 94 °C—1 min | 97.4 | [42] |
2.5. Statistical Analysis
3. Results
3.1. Cell Density and Viability
3.2. Gene Expression Analysis
4. Discussion
4.1. Cell Viability Tests
4.2. Gene Expression
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Honda, M.; Suzuki, N. Toxicities of Polycyclic Aromatic Hydrocarbons for Aquatic Animals. Int. J. Environ. Res. Public Health 2020, 17, 1363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, D.E. The Rainbow Trout Liver Cancer Model: Response to Environmental Chemicals and Studies on Promotion and Chemoprevention. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2012, 155, 121–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimada, T. Xenobiotic-Metabolizing Enzymes Involved in Activation and Detoxification of Carcinogenic Polycyclic Aromatic Hydrocarbons. Drug Metab. Pharmacokinet. 2006, 21, 257–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fischer, S.; Loncar, J.; Zaja, R.; Schnell, S.; Schirmer, K.; Smital, T.; Luckenbach, T. Constitutive mRNA expression and protein activity levels of nine ABC efflux transporters in seven permanent cell lines derived from different tissues of rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 2011, 101, 438–446. [Google Scholar] [CrossRef] [Scilit]
- Bramatti, I.; Matos, B.; Figueiredo, N.; Pousão-Ferreira, P.; Branco, V.; Martins, M. Interaction of Polycyclic Aromatic Hydrocarbon compounds in fish primary hepatocytes: From molecular mechanisms to genotoxic effects. Sci. Total Environ. 2023, 855, 158783. [Google Scholar] [CrossRef] [Scilit]
- Derakhshesh, N.; Salamat, N.; Movahedinia, A.; Hashemitabar, M.; Bayati, V. Exposure of liver cell culture from the orange-spotted grouper, Epinephelus coioides, to benzo[a]pyrene and light results in oxidative damage as measured by antioxidant enzymes. Chemosphere 2019, 226, 534–544. [Google Scholar] [CrossRef] [Scilit]
- Franco, M.E.; Sutherland, G.E.; Lavado, R. Xenobiotic metabolism in the fish hepatic cell lines Hepa-E1 and RTH-149, and the gill cell lines RTgill-W1 and G1B: Biomarkers of CYP450 activity and oxidative stress. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2018, 206–207, 32–40. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.; Li, J.; Yu, L.; Wei, Y.; Miao, Z.; Chen, M.; Huang, R. Characterization of transcriptional responses mediated by benzo[a]pyrene stress in a new marine fish model of goby, Mugilogobius chulae. Genes Genom. 2019, 41, 113–123. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.; Zhou, A.; Zhang, Y.; Liu, S.; Pan, Z.; Zou, J.; Xie, S. Transcriptomic Changes in Western Mosquitofish (Gambusia affinis) Liver Following Benzo[a]pyrene Exposure. Environ. Sci. Pollut. Res. Int. 2020, 27, 21924–21938. [Google Scholar] [CrossRef] [Scilit]
- Colli-Dula, R.C.; Fang, X.; Moraga-Amador, D.; Albornoz-Abud, N.; Zamora-Bustillos, R.; Conesa, A.; Zapata-Perez, O.; Moreno, D.; Hernandez-Nuñez, E. Transcriptome Analysis Reveals Novel Insights into the Response of Low-Dose Benzo(a)pyrene Exposure in Male Tilapia. Aquat. Toxicol. 2018, 201, 162–173. [Google Scholar] [CrossRef] [Scilit]
- Rodd, A.L.; Messier, N.J.; Vaslet, C.A.; Kane, A.B. A 3D Fish Liver Model for Aquatic Toxicology: Morphological Changes and Cyp1a Induction in PLHC-1 Microtissues after Repeated Benzo(a)pyrene Exposures. Aquat. Toxicol. 2017, 186, 134–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yadetie, F.; Brun, N.R.; Vieweg, I.; Nahrgang, J.; Karlsen, O.A.; Goksøyr, A. Transcriptome responses in polar cod (Boreogadus saida) liver slice culture exposed to benzo[a]pyrene and ethynylestradiol: Insights into anti-estrogenic effects. Toxicol. In Vitro 2021, 75, 105193. [Google Scholar] [CrossRef] [Scilit]
- Yadetie, F.; Zhang, X.; Hanna, E.M.; Aranguren-Abadía, L.; Eide, M.; Blaser, N.; Brun, M.; Jonassen, I.; Goksøyr, A.; Karlsen, O.A. RNA-Seq Analysis of Transcriptome Responses in Atlantic Cod (Gadus morhua) Precision-Cut Liver Slices Exposed to Benzo[a]pyrene and 17α-Ethynylestradiol. Aquat. Toxicol. 2018, 201, 174–186. [Google Scholar] [CrossRef] [Scilit]
- Behrens, A.; Schirmer, K.; Bols, N.C.; Segner, H. Polycyclic Aromatic Hydrocarbons as Inducers of Cytochrome P4501A Enzyme Activity in the Rainbow Trout Liver Cell Line, RTL-W1, and in Primary Cultures of Rainbow Trout Hepatocytes. Environ. Toxicol. Chem. 2001, 20, 632–643. [Google Scholar] [CrossRef]
- Bols, N.C.; Schirmer, K.; Joyce, E.M.; Dixon, D.G.; Greenberg, B.M.; Whyte, J.J. Ability of Polycyclic Aromatic Hydrocarbons to Induce 7-Ethoxyresorufin-O-Deethylase Activity in a Trout Liver Cell Line. Ecotoxicol. Environ. Saf. 1999, 44, 118–128. [Google Scholar] [CrossRef] [Scilit]
- Valdehita, A.; Fernández-Cruz, M.L.; Navas, J.M. The Potentiating Effect of Graphene Oxide on the Arylhydrocarbon Receptor (AhR)-Cytochrome P4501A (Cyp1A) System Activated by Benzo(k)fluoranthene (BkF) in Rainbow Trout Cell Line. Nanomaterials 2023, 13, 2501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pannetier, P.; Clérandeau, C.; Le Floch, S.; Cachot, J.; Morin, B. Toxicity Evaluation of Water-Accommodated Fraction of Heavy and light oils on the Rainbow Trout Fish Cell Line RTL-W1. Environ. Sci. Pollut. Res. Int. 2024, 31, 49715–49726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, L.E.J.; Clemons, J.H.; Bechtel, D.G.; Caldwell, S.J.; Han, K.-B.; Pasitschniak-Arts, M.; Mosser, D.D.; Bols, N.C. Development and characterization of a Rainbow Trout Liver Cell Line Expressing Cytochrome P450-Dependent Monooxygenase Activity. Cell Biol. Toxicol. 1993, 9, 279–294. [Google Scholar] [CrossRef] [Scilit]
- IPCC (Intergovernmental Panel on Climate Change) (Ed.) Climate Change 2022—Mitigation of Climate Change: Working Group III Contribution to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change; Cambridge University Press: Cambridge, UK, 2023. [Google Scholar]
- Alix, M.; Kjesbu, O.S.; Anderson, K.C. From Gametogenesis to Spawning: How Climate-Driven Warming Affects Teleost Reproductive Biology. J. Fish Biol. 2020, 97, 607–632. [Google Scholar] [CrossRef] [Scilit]
- de Alvarenga, E.R.; de França, L.R. Effects of Different Temperatures on Testis Structure and Function, with Emphasis on Somatic Cells, in Sexually Mature Nile Tilapias (Oreochromis niloticus). Biol. Reprod. 2009, 80, 537–544. [Google Scholar] [CrossRef] [Scilit]
- Neuheimer, A.B.; Thresher, R.E.; Lyle, J.M.; Semmens, J.M. Tolerance limit for Fish Growth Exceeded by Warming Waters. Nat. Clim. Chang. 2011, 1, 110–113. [Google Scholar] [CrossRef] [Scilit]
- Volkoff, H.; Rønnestad, I. Effects of temperature on feeding and Digestive Processes in Fish. Temperature 2020, 7, 307–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lannig, G.; Tillmann, A.; Howald, S.; Stapp, L.S. Thermal Sensitivity of Cell Metabolism of Different Antarctic Fish Species Mirrors Organism Temperature Tolerance. Polar Biol. 2020, 43, 1887–1898. [Google Scholar] [CrossRef] [Scilit]
- Roh, H.; Kim, A.; Kim, N.; Lee, Y.; Kim, D.H. Multi-Omics Analysis Provides Novel Insight into Immuno-Physiological Pathways and Development of Thermal Resistance in Rainbow Trout Exposed to Acute Thermal Stress. Int. J. Mol. Sci. 2020, 21, 9198. [Google Scholar] [CrossRef] [Scilit]
- Alfonso, S.; Gesto, M.; Sadoul, B. Temperature increase and its effects on Fish Stress Physiology in the Context of Global Warming. J. Fish Biol. 2021, 98, 1496–1508. [Google Scholar] [CrossRef] [Scilit]
- Yebra-Pimentel, E.S.; Gebert, M.; Jansen, H.J.; Jong-Raadsen, S.A.; Dirks, R.P.H. Deep Transcriptome Analysis of the Heat Shock Response in an Atlantic Sturgeon (Acipenser oxyrinchus) Cell Line. Fish Shellfish. Immunol. 2019, 88, 508–517. [Google Scholar] [CrossRef] [Scilit]
- Lutze, P.; Brenmoehl, J.; Tesenvitz, S.; Ohde, D.; Wanka, H.; Meyer, Z.; Grunow, B. Effects of Temperature Adaptation on the Metabolism and Physiological Properties of Sturgeon Fish Larvae Cell Line. Cells 2024, 13, 269. [Google Scholar] [CrossRef] [Scilit]
- Grunow, B.; Franz, G.P.; Tönißen, K. In Vitro Fish Models for the Analysis of Ecotoxins and Temperature Increase in the Context of Global Warming. Toxics 2021, 9, 286. [Google Scholar] [CrossRef] [Scilit]
- Vilaça, M.; Lopes, C.; Seabra, R.; Rocha, E. 17α-Ethynylestradiol and Levonorgestrel Exposure of Rainbow Trout RTL-W1 Cells at 18 °C and 21 °C Mainly Reveals Thermal Tolerance, Absence of Estrogenic Effects, and Progestin-Induced Upregulation of Detoxification Genes. Genes 2024, 15, 1189. [Google Scholar] [CrossRef] [Scilit]
- Andersen, Ø.; Frantzen, M.; Rosland, M.; Timmerhaus, G.; Skugor, A.; Krasnov, A. Effects of crude oil exposure and elevated temperature on the Liver Transcriptome of Polar Cod (Boreogadus saida). Aquat. Toxicol. 2015, 165, 9–18. [Google Scholar] [CrossRef] [Scilit]
- Brinkmann, M.; Hudjetz, S.; Kammann, U.; Hennig, M.; Kuckelkorn, J.; Chinoraks, M.; Cofalla, C.; Wiseman, S.; Giesy, J.P.; Schäffer, A.; et al. How Flood Events Affect Rainbow Trout: Evidence of a Biomarker Cascade in Rainbow Trout after Exposure to PAH Contaminated Sediment Suspensions. Aquat. Toxicol. 2013, 128–129, 13–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lyons, M.C.; Wong, D.K.; Mulder, I.; Lee, K.; Burridge, L.E. The influence of Water Temperature on Induced Liver EROD Activity in Atlantic Cod (Gadus morhua) Exposed to Crude Oil and Oil Dispersants. Ecotoxicol. Environ. Saf. 2011, 74, 904–910. [Google Scholar] [CrossRef] [Scilit]
- Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr. Protoc. Immunol. 2015, 111, A3.B.1–A3.B.3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Esteves, T.; Malhão, F.; Rocha, E.; Lopes, C. Effects of Benzo[k]fluoranthene at Two Temperatures on Viability, Structure, and Detoxification-Related Genes in Rainbow Trout RTL-W1 Cell Spheroids. Toxics 2025, 13, 302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alves, R.F.; Lopes, C.; Rocha, E.; Madureira, T.V. Estrogenic Responsiveness of Brown Trout Primary Hepatocyte Spheroids to Environmental Levels of 17α-Ethinylestradiol. J. Xenobiotics 2024, 14, 1064–1078. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- De Anna, J.S.; Darraz, L.A.; Painefilú, J.C.; Cárcamo, J.G.; Moura-Alves, P.; Venturino, A.; Luquet, C.M. The Insecticide Chlorpyrifos Modifies the Expression of Genes Involved in the PXR and AhR Pathways in the Rainbow Trout, Oncorhynchus mykiss. Pestic. Biochem. Physiol. 2021, 178, 104920. [Google Scholar] [CrossRef] [Scilit]
- Uchea, C.; Owen, S.F.; Chipman, J.K. Functional Xenobiotic Metabolism and Efflux Transporters in Trout Hepatocyte Spheroid Cultures. Toxicol. Res. 2015, 4, 494–507. [Google Scholar] [CrossRef] [Scilit]
- Batista-Pinto, C. Peroxisomes in Brown Trout (Salmo trutta f. fario): Regulation by Estrogens; Institute of Biomedical Sciences Abel Salazar: Porto, Portugal, 2007. [Google Scholar]
- Madureira, T.V.; Pinheiro, I.; Malhão, F.; Lopes, C.; Urbatzka, R.; Castro, L.F.C.; Rocha, E. Cross-Interference of Two Model Peroxisome Proliferators in Peroxisomal and Estrogenic Pathways in Brown Trout Hepatocytes. Aquat. Toxicol. 2017, 187, 153–162. [Google Scholar] [CrossRef] [Scilit]
- Madureira, T.V.; Pinheiro, I.; de Paula Freire, R.; Rocha, E.; Castro, L.F.; Urbatzka, R. Genome Specific PPARαB Duplicates in Salmonids and Insights into Estrogenic Regulation in Brown Trout. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2017, 208–209, 94–101. [Google Scholar] [CrossRef] [Scilit]
- Green, J.; Wheeler, J.R. The Use of Carrier Solvents in Regulatory Aquatic Toxicology Testing: Practical, Statistical and Regulatory Considerations. Aquat. Toxicol. 2013, 144–145, 242–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pastore, A.S.; Santacroce, M.P.; Narracci, M.; Cavallo, R.A.; Acquaviva, M.I.; Casalino, E.; Colamonaco, M.; Crescenzo, G. Genotoxic Damage of Benzo[A]Pyrene in Cultured Sea Bream (Sparus aurata L.) hepatocytes: Harmful effects of Chronic Exposure. Mar. Environ. Res. 2014, 100, 74–85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kienzler, A.; Tronchère, X.; Devaux, A.; Bony, S. Assessment of RTG-W1, RTL-W1, and PLHC-1 fish cell lines for genotoxicity testing of environmental pollutants by means of a Fpg-modified comet assay. Toxicol. In Vitro 2012, 26, 500–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santana, M.S.; Sandrini-Neto, L.; Filipak Neto, F.; Oliveira Ribeiro, C.A.; Di Domenico, M.; Prodocimo, M.M. Biomarker Responses in Fish Exposed to Polycyclic Aromatic Hydrocarbons (PAHs): Systematic Review and Meta-Analysis. Environ. Pollut. 2018, 242, 449–461. [Google Scholar] [CrossRef] [Scilit]
- Nahrgang, J.; Camus, L.; Gonzalez, P.; Goksøyr, A.; Christiansen, J.S.; Hop, H. PAH Biomarker Responses in Polar Cod (Boreogadus saida) Exposed to Benzo(A)Pyrene. Aquat. Toxicol. 2009, 94, 309–319. [Google Scholar] [CrossRef] [Scilit]
- Nuez-Ortín, W.G.; Carter, C.G.; Nichols, P.D.; Cooke, I.R.; Wilson, R. Liver Proteome Response of Pre-Harvest Atlantic Salmon Following Exposure to Elevated Temperature. BMC Genom. 2018, 19, 133. [Google Scholar] [CrossRef] [Scilit]
- Pandey, A.; Rajesh, M.; Baral, P.; Sarma, D.; Tripathi, P.H.; Akhtar, M.S.; Ciji, A.; Dubey, M.K.; Pande, V.; Sharma, P.; et al. Concurrent Changes in Thermal Tolerance Thresholds and Cellular Heat Stress Response Reveals Novel Molecular Signatures and Markers of High Temperature Acclimation in Rainbow Trout. J. Therm. Biol. 2021, 102, 103124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bender, M.L.; Giebichenstein, J.; Teisrud, R.N.; Laurent, J.; Frantzen, M.; Meador, J.P.; Sørensen, L.; Hansen, B.H.; Reinardy, H.C.; Laurel, B.; et al. Combined Effects of Crude Oil Exposure and Warming on Eggs and Larvae of an Arctic Forage Fish. Sci. Rep. 2021, 11, 8410. [Google Scholar] [CrossRef] [Scilit]
- Creusot, N.; Brion, F.; Piccini, B.; Budzinski, H.; Porcher, J.M.; Aït-Aïssa, S. BFCOD Activity in Fish Cell Lines and Zebrafish Embryos and its Modulation by Chemical Ligands of Human Aryl Hydrocarbon and Nuclear Receptors. Environ. Sci. Pollut. Res. Int. 2015, 22, 16393–16404. [Google Scholar] [CrossRef] [Scilit]
- Tseng, H.P.; Hseu, T.H.; Buhler, D.R.; Wang, W.D.; Hu, C.H. Constitutive and Xenobiotics-Induced Expression of a Novel CYP3A Gene from Zebrafish Larva. Toxicol. Appl. Pharmacol. 2005, 205, 247–258. [Google Scholar] [CrossRef] [Scilit]
- Thibaut, R.; Schnell, S.; Porte, C. Assessment of Metabolic Capabilities of PLHC-1 and RTL-W1 Fish Liver Cell Lines. Cell Biol. Toxicol. 2009, 25, 611–622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leaver, M.J.; Wright, J.; Hodgson, P.; Boukouvala, E.; George, S.G. Piscine UDP-Glucuronosyltransferase 1B. Aquat. Toxicol. 2007, 84, 356–365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarke, D.J.; George, S.G.; Burchell, B. Multiplicity of UDP-Glucuronosyltransferases in Fish. Purification and Characterization of a Phenol UDP-Glucuronosyltransferase from the Liver of a Marine Teleost, Pleuronectes platessa. Biochem. J. 1992, 284, 417–423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allmon, E.; Serafin, J.; Chen, S.; Rodgers, M.L.; Griffitt, R.; Bosker, T.; de Guise, S.; Sepúlveda, M.S. Effects of Polycyclic Aromatic Hydrocarbons and Abiotic Stressors on Fundulus grandis Cardiac Transcriptomics. Sci. Total Environ. 2021, 752, 142156. [Google Scholar] [CrossRef] [Scilit]
- Ojima, N.; Yamashita, M.; Watabe, S. Quantitative mRNA Expression Profiling of Heat-Shock Protein Families in Rainbow Trout Cells. Biochem. Biophys. Res. Commun. 2005, 329, 51–57. [Google Scholar] [CrossRef] [Scilit]
- Ojima, N.; Yamashita, M.; Watabe, S. Comparative Expression Analysis of Two Paralogous Hsp70s in Rainbow Trout Cells Exposed to Heat Stress. Biochim. Biophys. Acta 2005, 1681, 99–106. [Google Scholar] [CrossRef] [Scilit]



Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vilaça, M.; Esteves, T.; Seabra, R.; Rocha, E.; Lopes, C. Unveiling the Effects of Two Polycyclic Aromatic Hydrocarbons and Two Temperatures on the Trout RTL-W1 Cell Line Expression of Detoxification-Related Target Genes. J. Xenobiotics 2025, 15, 84. https://doi.org/10.3390/jox15030084
Vilaça M, Esteves T, Seabra R, Rocha E, Lopes C. Unveiling the Effects of Two Polycyclic Aromatic Hydrocarbons and Two Temperatures on the Trout RTL-W1 Cell Line Expression of Detoxification-Related Target Genes. Journal of Xenobiotics. 2025; 15(3):84. https://doi.org/10.3390/jox15030084
Chicago/Turabian StyleVilaça, Margarida, Telma Esteves, Rosária Seabra, Eduardo Rocha, and Célia Lopes. 2025. "Unveiling the Effects of Two Polycyclic Aromatic Hydrocarbons and Two Temperatures on the Trout RTL-W1 Cell Line Expression of Detoxification-Related Target Genes" Journal of Xenobiotics 15, no. 3: 84. https://doi.org/10.3390/jox15030084
APA StyleVilaça, M., Esteves, T., Seabra, R., Rocha, E., & Lopes, C. (2025). Unveiling the Effects of Two Polycyclic Aromatic Hydrocarbons and Two Temperatures on the Trout RTL-W1 Cell Line Expression of Detoxification-Related Target Genes. Journal of Xenobiotics, 15(3), 84. https://doi.org/10.3390/jox15030084

