Transcriptomic Response of Balamuthia mandrillaris to Lippia graveolens Extract Fractions
Abstract
1. Introduction
2. Materials and Methods
2.1. Culture, L. graveolens Fraction Exposure and Harvest of B. mandrillaris
2.2. Obtention of Lippia graveolens Extracts
Obtention of Lippia graveolens Fractions
2.3. RNA Extraction and Sequencing
2.4. Bioinformatic Analysis
2.5. DEG Selection for Primer Design
2.6. cDNA Synthesis and Validation by RT-qPCR Analysis
3. Results
3.1. Effect of L. graveolens Extract Fractions on B. mandrillaris
3.2. Analysis of Transcriptomic Data
3.3. Transcriptomic Response of B. mandrillaris to L. graveolens Extract Fractions
3.4. Differential Expression Analysis
3.5. Over-Representation Analysis of GO Categories
3.6. RT-qPCR Validation of RNA-Seq Data
4. Discussion
4.1. Functions of Top GO Categories
4.2. Up-Regulated Genes in Stress Response and Adaptation
4.3. Down-Regulated Genes in Structural and Virulence Functions
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schuster, F.L.; Visvesvara, G.S. Free-living amoebae as opportunistic and non-opportunistic pathogens of humans and animals. Int. J. Parasitol. 2004, 34, 1001–1027. [Google Scholar] [CrossRef]
- Qvarnstrom, Y.; da Silva, A.J.; Schuster, F.L.; Gelman, B.B.; Visvesvara, G.S. Molecular confirmation of Sappinia pedata as a causative agent of amoebic encephalitis. J. Infect. Dis. 2009, 199, 1139–1142. [Google Scholar] [CrossRef]
- Li, Z.; Li, W.; Li, Y.; Ma, F.; Li, G. A case report of Balamuthia mandrillaris encephalitis. Heliyon 2024, 10, e26905. [Google Scholar] [CrossRef]
- Cabello-Vílchez, A.M.; Ruiz-Ruiz, M.I. Molecular analysis unmasking a Balamuthia mandrillaris: Skin lesion and granulomatous amebic encephalitis by Acanthamoeba sp. close to genotype T4 with fatal outcome. Clin. Infect. Pract. 2024, 21, 100246. [Google Scholar] [CrossRef]
- Spottiswoode, N.; Haston, J.C.; Hanners, N.W.; Gruenberg, K.; Kim, A.; DeRisi, J.L.; Wilson, M.R. Challenges and advances in the medical treatment of granulomatous amebic encephalitis. Ther. Adv. Infect. Dis. 2024, 11, 20499361241228340. [Google Scholar] [CrossRef]
- Qin, L.; Xiang, Y.; Wu, Z.; Zhang, H.; Wu, X.; Chen, Q. Metagenomic next-generation sequencing for diagnosis of fatal Balamuthia amoebic encephalitis. Infect. Genet. Evol. 2024, 119, 105570. [Google Scholar] [CrossRef]
- Otero-Ruiz, A.; Gonzalez-Zuñiga, L.D.; Rodriguez-Anaya, L.Z.; Lares-Jiménez, L.F.; Gonzalez-Galaviz, J.R.; Lares-Villa, F. Distribution and Current State of Molecular Genetic Characterization in Pathogenic Free-Living Amoebae. Pathogens 2022, 11, 1199. [Google Scholar] [CrossRef]
- Fimbres-García, J.O.; Flores-Sauceda, M.; Othón-Díaz, E.D.; García-Galaz, A.; Tapia-Rodriguez, M.R.; Silva-Espinoza, B.A.; Alvarez-Armenta, A.; Ayala-Zavala, J.F. Lippia graveolens Essential Oil to Enhance the Effect of Imipenem against Axenic and Co-Cultures of Pseudomonas aeruginosa and Acinetobacter baumannii. Antibiotics 2024, 13, 444. [Google Scholar] [CrossRef]
- Cabral-Miramontes, J.P.; Martínez-Rocha, A.L.; Rosales-Castro, M.; Lopez-Rodriguez, A.; Meneses-Morales, I.; Del Campo-Quinteros, E.; Herrera-Ocelotl, K.K.; Gandara-Moreno, G.; Velázquez-Huizar, S.J.; Ibarra-Sánchez, L.; et al. Antifungal Activity of Mexican Oregano (Lippia graveolens Kunth) Extracts from Industrial Waste Residues on Fusarium spp. in Bean Seeds (Phaseolus vulgaris L.). Agriculture 2024, 14, 1975. [Google Scholar] [CrossRef]
- Quintanilla-Licea, R.; Vargas-Villarreal, J.; Verde-Star, M.J.; Rivas-Galindo, V.M.; Torres-Hernández, Á.D. Antiprotozoal Activity against Entamoeba histolytica of Flavonoids Isolated from Lippia graveolens Kunth. Molecules 2020, 25, 2464. [Google Scholar] [CrossRef]
- Siddiqui, R.; Boghossian, A.; Khatoon, B.; Kawish, M.; Alharbi, A.M.; Shah, M.R.; Alfahemi, H.; Khan, N.A. Antiamoebic Properties of Metabolites against Naegleria fowleri and Balamuthia mandrillaris. Antibiotics 2022, 11, 539. [Google Scholar] [CrossRef]
- Siddiqui, R.; Akbar, N.; Khatoon, B.; Kawish, M.; Ali, M.S.; Shah, M.R.; Khan, N.A. Novel Plant-Based Metabolites as Disinfectants against Acanthamoeba castellanii. Antibiotics 2022, 11, 248. [Google Scholar] [CrossRef]
- Sangkanu, S.; Mitsuwan, W.; Mahboob, T.; Mahabusarakam, W.; Chewchanwuttiwong, S.; Siphakdi, P.; Jimoh, T.O.; Wilairatana, P.; Dolma, K.G.; Pereira, M.L.; et al. Phytochemical, anti-Acanthamoeba, and anti-adhesion properties of Garcinia mangostana flower as preventive contact lens solution. Acta Trop. 2022, 226, 106266. [Google Scholar] [CrossRef]
- Criollo-Mendoza, M.S.; Ramos-Payán, R.; Contreras-Angulo, L.A.; Gutiérrez-Grijalva, E.P.; León-Félix, J.; Villicaña, C.; Angulo-Escalante, M.A.; Heredia, J.B. Cytotoxic Activity of Polyphenol Extracts from Three Oregano Species: Hedeoma patens, Lippia graveolens and Lippia palmeri, and Antiproliferative Potential of Lippia graveolens against Two Types of Breast Cancer Cell Lines (MDA-MB-231 and MCF-7). Molecules 2022, 27, 5240. [Google Scholar] [CrossRef]
- Gutiérrez-Grijalva, E.P.; Antunes-Ricardo, M.; Acosta-Estrada, B.A.; Gutiérrez-Uribe, J.A.; Basilio Heredia, J. Cellular antioxidant activity and in vitro inhibition of α-glucosidase, α-amylase and pancreatic lipase of oregano polyphenols under simulated gastrointestinal digestion. Int. Food Res. 2019, 116, 676–686. [Google Scholar] [CrossRef] [PubMed]
- Lares-Jiménez, L.F.; Gámez-Gutiérrez, R.A.; Lares-Villa, F. Novel culture medium for the axenic growth of Balamuthia mandrillaris. Diagn. Microbiol. Infect. Dis. 2015, 82, 286–288. [Google Scholar] [CrossRef]
- Gonzalez-Zuñiga, L.D.; Rodriguez-Anaya, L.Z.; Gonzalez-Galaviz, J.R.; Cruz-Mendívil, A.; Lares-Villa, F.; Lares-Jiménez, L.F. Evaluation and Standardization of RNA Extractions with Quality for RNA-Seq for Balamuthia mandrillaris. Parasitologia 2024, 4, 199–208. [Google Scholar] [CrossRef]
- Andrews, S. FastQC A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 13 September 2024).
- Ewels, P.; Magnusson, M.; Lundin, S.; Käller, M. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics 2016, 32, 3047–3048. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Otero-Ruiz, A.; Rodriguez-Anaya, L.Z.; Lares-Villa, F.; Lozano Aguirre Beltrán, L.F.; Lares-Jiménez, L.F.; Gonzalez-Galaviz, J.R.; Cruz-Mendívil, A. Functional annotation and comparative genomics analysis of Balamuthia mandrillaris reveals potential virulence-related genes. Sci. Rep. 2023, 13, 14318. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Integrated DNA Technologies. PrimerQuest™ Tool. Available online: https://www.idtdna.com/PrimerQuest/Home/Index (accessed on 17 October 2024).
- Arevalo-Sainz, K.; Gonzalez-Galaviz, J.; Casillas-Hernández, R.; Fraijo-Valenzuela, A.; Gil-Núñez, J.; Rodriguez-Anaya, L.; Lares-Villa, F.; Gortares-Moroyoqui, P.; Arias-Moscoso, J.; Bórquez-López, R. Methionine sources and Bacillus amyloliquefaciens CECT 5940 effects on growth, body composition, and nutrient metabolism of Penaeus vannamei fed reduced fishmeal diets. Lat. Am. J. Aquat. Res. 2024, 52, 404–415. [Google Scholar] [CrossRef]
- Rodriguez-Anaya, L.Z.; Casillas-Hernández, R.; Flores-Pérez, M.B.; Lares-Villa, F.; Lares-Jiménez, L.F.; Luna-Nevarez, P.; Gonzalez-Galaviz, J.R. Effect of genetic line, protein source, and protein level on growth, survival, and immune-related gene expression of Litopenaeus vannamei. J. World Aquac. Soc. 2020, 51, 1161–1174. [Google Scholar] [CrossRef]
- Conesa, A.; Madrigal, P.; Tarazona, S.; Gomez-Cabrero, D.; Cervera, A.; McPherson, A.; Szcześniak, M.W.; Gaffney, D.J.; Elo, L.L.; Zhang, X.; et al. A survey of best practices for RNA-seq data analysis. Genome Biol. 2016, 17, 13. [Google Scholar] [CrossRef]
- Jolliffe, I.T.; Cadima, J. Principal component analysis: A review and recent developments. Philos. Transact. A Math. Phys. Eng. Sci. 2016, 374, 20150202. [Google Scholar] [CrossRef]
- Suo, S.B.; Qiu, J.D.; Shi, S.P.; Chen, X.; Liang, R.P. PSEA: Kinase-specific prediction and analysis of human phosphorylation substrates. Sci. Rep. 2014, 4, 4524. [Google Scholar] [CrossRef]
- Wolfe, L.M.; Veeraraghavan, U.; Idicula-Thomas, S.; Schürer, S.; Wennerberg, K.; Reynolds, R.; Besra, G.S.; Dobos, K.M. A chemical proteomics approach to profiling the ATP-binding proteome of Mycobacterium tuberculosis. Mol. Cell. Proteom. 2013, 12, 1644–1660. [Google Scholar] [CrossRef]
- Arico, D.S.; Beati, P.; Wengier, D.L.; Mazzella, M.A. A novel strategy to uncover specific GO terms/phosphorylation pathways in phos-phoproteomic data in Arabidopsis thaliana. BMC Plant Biol. 2021, 21, 592. [Google Scholar] [CrossRef]
- European Bioinformatics Institute. GO:0016020—Membrane. QuickGO. Available online: https://www.ebi.ac.uk/QuickGO/term/GO:0016020 (accessed on 15 December 2024).
- Bhajun, R.; Guyon, L.; Pitaval, A.; Sulpice, E.; Combe, S.; Obeid, P.; Haguet, V.; Ghorbel, I.; Lajaunie, C.; Gidrol, X. A statistically inferred microRNA network identifies breast cancer target miR-940 as an actin cytoskeleton regulator. Sci. Rep. 2015, 5, 8336. [Google Scholar] [CrossRef]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef] [PubMed]
- Gene Ontology Consortium. AmiGO 2: Term Details for «NAD+ binding (GO:0070403). Available online: https://amigo.geneontology.org/amigo/term/GO%3A0070403 (accessed on 15 December 2024).
- Søgaard, A.B.; Pedersen, A.B.; Løvschall, K.B.; Monge, P.; Jakobsen, J.H.; Džabbarova, L.; Nielsen, L.F.; Stevanovic, S.; Walther, R.; Zelikin, A.N. Transmembrane signaling by a synthetic receptor in artificial cells. Nat. Commun. 2023, 14, 1646. [Google Scholar] [CrossRef]
- European Bioinformatics Institute. GO:0007166—Cell Surface Receptor Signaling Pathway. QuickGO. Available online: https://www.ebi.ac.uk/QuickGO/term/GO:0007166 (accessed on 17 December 2024).
- Giaginis, C.; Tsoukalas, N.; Bournakis, E.; Alexandrou, P.; Kavantzas, N.; Patsouris, E.; Theocharis, S. Ephrin (Eph) receptor A1, A4, A5 and A7 expression in human non-small cell lung carcinoma: Associations with clinicopathological parameters, tumor proliferative capacity and patients’ survival. BMC Clin. Pathol. 2014, 14, 8. [Google Scholar] [CrossRef]
- Castro, H.; Rocha, M.I.; Duarte, M.; Vilurbina, J.; Gomes-Alves, A.G.; Leao, T.; Dias, F.; Morgan, B.; Deponte, M.; Tomás, A.M. The cytosolic hyperoxidation-sensitive and -robust Leishmania peroxiredoxins cPRX1 and cPRX2 are both dispensable for parasite infectivity. Redox Biol. 2024, 71, 103122. [Google Scholar] [CrossRef]
- Hernando-Rodríguez, B.; Artal-Sanz, M. Mitochondrial Quality Control Mechanisms and the PHB (Prohibitin) Complex. Cells 2018, 7, 238. [Google Scholar] [CrossRef] [PubMed]
- Víglaš, J.; Olejníková, P. An update on ABC transporters of filamentous fungi—From physiological substrates to xenobiotics. Microbiol. Res. 2021, 246, 126684. [Google Scholar] [CrossRef]
- Laederich, M.B.; Degnin, C.R.; Lunstrum, G.P.; Holden, P.; Horton, W.A. Fibroblast growth factor receptor 3 (FGFR3) is a strong heat shock protein 90 (Hsp90) client: Implications for therapeutic manipulation. J. Biol. Chem. 2011, 286, 19597–19604. [Google Scholar] [CrossRef]
- Sato, M.; Sato, K.; Nishikawa, S.; Hirata, A.; Kato, J.; Nakano, A. The yeast RER2 gene, identified by endoplasmic reticulum protein localization mutations, encodes cis-prenyltransferase, a key enzyme in dolichol synthesis. Mol. Cell Biol. 1999, 19, 471–483. [Google Scholar] [CrossRef]
- Xiang, J.; Wei, L.; Zheng, T.; Wu, J.; Cheng, J. ADP-ribosylation factor 1 (ARF1) protein interacts with elicitor PvNLP7 from Plasmopara viticola to mediate PvNLP7-triggered immunity. Plant Sci. 2024, 347, 112194. [Google Scholar] [CrossRef]
- Serbzhinskiy, D.A.; Clifton, M.C.; Sankaran, B.; Staker, B.L.; Edwards, T.E.; Myler, P.J. Structure of an ADP-ribosylation factor, ARF1, from Entamoeba histolytica bound to Mg2+-GDP. Acta Crystallogr. Sect. F Struct. Biol. Commun. 2015, 71, 594–599. [Google Scholar] [CrossRef]
- Huerta, M.; Reyes, L.; García-Rivera, G.; Bañuelos, C.; Betanzos, A.; Díaz-Hernández, M.; Galindo, A.; Bolaños, J.; Cárdenas, H.; Azuara-Liceaga, E.; et al. A noncanonical GATA transcription factor of Entamoeba histolytica modulates genes involved in phagocytosis. Mol. Microbiol. 2020, 114, 1019–1037. [Google Scholar] [CrossRef]
- Gao, J.; Chen, Y.-H.; Peterson, L.C. GATA family transcriptional factors: Emerging suspects in hematologic disorders. Exp. Hematol. Oncol. 2015, 4, 28. [Google Scholar] [CrossRef]
- Zhao, G.; Ying, L.; Shi, Y.; Dong, Y.; Fu, M.; Shen, Z. Potential mechanisms of Streptococcus suis virulence-related factors in blood–brain barrier disruption. One Health Adv. 2024, 2, 26. [Google Scholar] [CrossRef]
- Wang, Q.; An, B.; Hou, X.; Guo, Y.; Luo, H.; He, C. Dicer-like Proteins Regulate the Growth, Conidiation, and Pathogenicity of Colletotrichum gloeosporioides from Hevea brasiliensis. Front. Microbiol. 2018, 8, 2621. [Google Scholar] [CrossRef]
- Iavarone, A.; Massagué, J. Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-beta in cells lacking the CDK inhibitor p15. Nature 1997, 387, 417–422. [Google Scholar] [CrossRef]
- Li, Y.L.; Li, Y.X.; Wang, X.P.; Kang, X.L.; Guo, K.Q.; Dong, D.J.; Wang, J.X.; Zhao, X.F. Identification and Functional Analysis of G Protein-Coupled Receptors in 20-Hydroxyecdysone Signaling from the Helicoverpa armigera Genome. Front. Cell Dev. Biol. 2021, 9, 753787. [Google Scholar] [CrossRef]
Gene ID | Protein | Log2-FC | Condition | Sequence Name | Sequence 5’–3’ |
---|---|---|---|---|---|
bal_000023 | Lipopolysaccharide-induced tumor necrosis factor alpha factor (LITAF) domain-containing protein | N/A | Normalizer | BAL1F | CGCTGTCACCATCAACAAAC |
BAL1R | GCAGAGGCATAGGTGATGAG | ||||
bal_000159 | Deacetylase sirtuin-type domain-containing protein | N/A | Normalizer | BAL2F | TGAGGAGAGATCAGGTGAAGAA |
BAL2R | CAGCACTCTATCCGGCATTT | ||||
bal_004939 | Ephrin type-A receptor 4a | 3.36 | F1_48 h | BAL7F | CCTTCTTCCATGTCCATCTCTC |
BAL7R | GGTGTGTTGCTGGTACTTCT | ||||
bal_014161 | Hypothetical protein | −4.16 | F1_48 h | BAL11F | ACAAGGTGGGAGCGTAGATA |
BAL11R | CGGCGATTGTGGATTTGATTAC | ||||
bal_002453 | Peroxiredoxin | 3.45 | F1_96 h | BAL12F | GCCATCCTCATAGTGGAAGTT |
BAL12R | GTCGTGAGTTCAGGAGCATAG | ||||
bal_009677 | Prohibitin (PHB) domain-containing protein | 2.63 | F1_120 h | BAL18F | ATGTCGGCTATGCGGTAGTA |
BAL18R | CCAGGTTAGGACAATGGACTTG | ||||
bal_017266 | Putative ATP-dependent permease ADP1 | 2.01 | F2_48 h | BAL26F | GCCGTGTTGCTGCTATTATG |
BAL26R | GCTGGTCTTTCCTCCTCTTATG | ||||
bal_014485 | ADP ribosylation factor (Arf) GTPase Arf1 | −3.52 | F2_48 h | BAL28F | GGATGAACCACTTCCTCTCTTT |
BAL28R | GGAGACTGCCGTGTTAGTTT | ||||
bal_023111 | Alanine-phosphoribitol ligase | −4.53 | F2_48 h | BAL29F | CATCACCTTGGCGTTCTCTC |
BAL29R | CCAGCGTCAAACCACTTACA | ||||
bal_004934 | Fibroblast growth factor receptor 3-like | 3.22 | F2_96 h | BAL31F | CATCGAGGTGGACAGTTATGAG |
BAL31R | GTCAGAGTTAAGGTCCGTCAAG | ||||
bal_016491 | Ditrans, polycis-polyprenyl diphosphate synthase | 2.55 | F2_120 h | BAL37F | TCCTCTGTAGTCGGGAATGT |
BAL37R | GGCTCAGTGGATGAAAGAGAG | ||||
bal_017433 | Wingless-related integration site (Wnt)-activated receptor activity | 3.61 | F2_120 h | BAL38F | CCGAGGTTGATGGATCGTATTG |
BAL38R | TCTCTCCTTCCAGATCCACTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gonzalez-Zuñiga, L.D.; Gonzalez-Galaviz, J.R.; Cruz-Mendívil, A.; Lares Villa, F.; Gutiérrez-Grijalva, E.P.; López-Cervantes, J.; Sánchez-Machado, D.I.; Lares-Jiménez, L.F.; Rodriguez-Anaya, L.Z. Transcriptomic Response of Balamuthia mandrillaris to Lippia graveolens Extract Fractions. Microbiol. Res. 2025, 16, 40. https://doi.org/10.3390/microbiolres16020040
Gonzalez-Zuñiga LD, Gonzalez-Galaviz JR, Cruz-Mendívil A, Lares Villa F, Gutiérrez-Grijalva EP, López-Cervantes J, Sánchez-Machado DI, Lares-Jiménez LF, Rodriguez-Anaya LZ. Transcriptomic Response of Balamuthia mandrillaris to Lippia graveolens Extract Fractions. Microbiology Research. 2025; 16(2):40. https://doi.org/10.3390/microbiolres16020040
Chicago/Turabian StyleGonzalez-Zuñiga, Leobardo Daniel, Jose Reyes Gonzalez-Galaviz, Abraham Cruz-Mendívil, Fernando Lares Villa, Erick Paul Gutiérrez-Grijalva, Jaime López-Cervantes, Dalia I. Sánchez-Machado, Luis Fernando Lares-Jiménez, and Libia Zulema Rodriguez-Anaya. 2025. "Transcriptomic Response of Balamuthia mandrillaris to Lippia graveolens Extract Fractions" Microbiology Research 16, no. 2: 40. https://doi.org/10.3390/microbiolres16020040
APA StyleGonzalez-Zuñiga, L. D., Gonzalez-Galaviz, J. R., Cruz-Mendívil, A., Lares Villa, F., Gutiérrez-Grijalva, E. P., López-Cervantes, J., Sánchez-Machado, D. I., Lares-Jiménez, L. F., & Rodriguez-Anaya, L. Z. (2025). Transcriptomic Response of Balamuthia mandrillaris to Lippia graveolens Extract Fractions. Microbiology Research, 16(2), 40. https://doi.org/10.3390/microbiolres16020040