Secondary Metabolite Production and Terpenoid Biosynthesis in Endophytic Fungi Cladosporium cladosporioides Isolated from Wild Cymbopogon martinii (Roxb.) Wats

Abstract

Endophytic fungi Cladosporium cladosporioides (F1-MH810309) and Cladosporium tenuissimum (F2-MN715834) from the leaf of wild Cymbopogon martinii (MT90507) were isolated and selected based on the persistent occurrence during different seasons of the year. They were identified based on the morphological features and molecular characterization (ITS sequence), and later deposited at NCBI. Phytochemical studies on F1, F2 and host extracts showed the presence of alkaloids, flavonoids, phenols, terpenoids and tannins. The GC-MS of F1 extract (control) under the axenic condition revealed compounds like hexadecane, heptadecane,2,4-Ditert-butylphenol, E-14 hexadecenal, geraniol, geranyl acetate and cubenol similar to the host. The GC-MS of F2 extract (control) revealed metabolites that were unique. Further, both F1 and F2 were cultured in the supplementation of different concentrations (5%, 10%, 15% and 20%) of the host plant extract (an-axenic condition). The GC-MS of F1 extracts (test) exhibited good growth and showed the gradual increased production of terpenoid compounds whereas the F2 (test) did not show any growth. These compounds such as hyrdoxymenthol, nor-borneol, cedralacetate, α-cyclogeraniol, campesterol, β-cyclogeraniol, linalool oxide,2,3-boranediol, citronellyltiglate and 2,3-pinanediol were produced in a minor quantity and were known as biotransformed forms of the precursor compounds present in the host extract. In comparison, only F1 was able to produce terpenoids similar to the host species both in axenic and an-axenic conditions. Hence from the current study, the endophytic fungus F1 isolated from wild C. martinii for the first time can serve as a better resource for the bioprospection of an important terpenoid and its metabolites.

1. Introduction

Cymbopogon martinii (Roxb.) commonly called ‘‘Rosha’’ grass belongs to the Rusae series and serves as an important species of Cymbopogon, yielding essential oil rich in geraniol [1,2]. The species is found widely distributed in south India and exists in two distinct forms referred to as “motia and sofia” varieties producing quality essential oil [3,4]. The essential oil of C. martinii possesses significant traditional medicinal properties and finds extensive usage in the treatment of rheumatism, arthritis, lumbago and spasms past from ancient times [5]. Furthermore, because of its potential activity it is used in preventing chronic diseases like cancer, diabetes and coronary heart diseases as well as showing antimicrobial, antifungal, antiviral, anthelmintic, antioxidant and cytotoxicity [6,7]. These compounds are produced against biotic and abiotic stress and help in defense mechanisms, communication and attracting pollinators [8]. The essential oil compounds of C. martinii have been extensively used in aromatic industries in the preparation of perfumes, soaps, cosmetics, food and beverage industries. These essential oil compounds show high biodegradability, volatility and negligible toxicity and are replacing the synthetic metabolic compounds in aromatic industries [9]. Even the extracts of Cymbopogons have been known to possess biological activities such as antimicrobial, antioxidant, anti-hypercholesterolaemic potential, and anti-inflammatory and antimutagenic activities [10,11,12] and are commonly used in food preservation, pharmaceuticals and natural medicines [13].

Wild plants species growing in typical agro-geo climatic conditions offer unique niches and lodge a variety of fungi within them [14]. These large groups of endophytic fungi are ubiquitously found asymptomatically associated with the plant tissues during their life cycle without negatively affecting the host [15,16,17] and are variable depending on components, plant genotype, growth stage, physiological status, tissue type and other environmental conditions [18]. They help the host plant adopt to various biotic and abiotic stresses and produce secondary metabolites including alkaloids, flavonoids, phenols, phenylpropanoids, quinines, indole derivatives, steroids, amines and terpenoids maintaining specific bioactivities [15,19,20]. The endophytic fungi associated with the host are identified using traditional taxonomic means and molecular tools like flanking internal transcribed spacers (ITS). They are also known to be a repository of secondary metabolites [17,21] possessing various biological activities, which are used in pharmaceutical applications [22,23].

The association of endophytic fungi with aromatic and medicinal plants is considered to be the prominent source for producing volatile organic or terpenoid compounds [24,25] and they show potential bioactivity and are hence used in pharmaceutical industries [26,27]. The biosynthetic potential of endophytes in producing terpenoid compounds similar to the host plant has gained a lot of commercial importance. Some of the known terpenoid compounds such as Taxol, HupA, 2-Carene, 5,8-diol, bisabolene and cadinene are produced from endophytic fungi along with other secondary metabolites [28,29]. A more intriguing and inexplicable issue with many endophytes that has to be critically evaluated is their ability to produce host metabolites, which can be harnessed on a large scale for potential use in diverse areas [19]. In the present study, the endophytic fungi isolated from wild Cymbopogon martinii were studied for the biogenesis of common terpenoid compounds between them and the biotransformation of plant metabolites into commercially useful terpenoids.

2. Materials and Methods

2.1. Collection and Authentication of Plant

The wild genotype of Cymbopogon martinii was collected from Devarayana Durga hills, Tumkur, Karnataka. The plant was identified and authenticated from Regional Ayurveda Research Institute for Metabolic Disorders (RARIMD), Ministry of AYUSH, Bengaluru, under the accession no. SMPU/RARIMD/BNG/2019-20/352/RRCBI-1052. The herbarium (AC-25/2021) and seeds were deposited at ICAR- National Bureau of Plant Genetic Resources (NBPGR), Pusa, New Delhi and the DNA barcoding sequence of the plant was deposited in GenBank NCBI under accession no. MT90507.

2.2. Plant Extraction Method

The powdered leaf sample (50 g) of the plant was mixed with 150 mL ethyl acetate solvent and kept in a shaker at 120 rpm for 48 h. The extract was filtered through Whatman filter paper grade no. 1. The filtrate obtained was dried at 40 °C using a rotary vacuum evaporator. The residue was dissolved in 1 mL of ethyl acetate and the extract was used for the GC-MS analysis. Furthermore, the powdered leaf (50 g) of the plant was used as the host plant extract for supplementing in the broth culture of endophytic fungi by subjecting it to 48 h of shaking in distilled water and filtering it through Whatman filter paper grade no. 1.

2.3. Isolation and Characterization of Endophytic Fungi

The leaf samples of wild C. martinii were collected and rinsed in distilled water, blot dried and cut into small pieces (10–15 mm length). The leaves were surface sterilized by immersing in Tween-20 for 5 min, followed by two times wash with distilled water; 70% ethanol (3 min), two times wash with distilled water; 4% sodium hypochlorite solution (3 min) and washed thoroughly 4–5 times with distilled water to remove traces of surfactants [30]. The edges of the leaves were trimmed and placed onto the petri plates containing potato dextrose agar (PDA) media and incubated at room temperature for 8–9 days. The endophytic fungi emerging after fourteen days in the culture media were transferred to fresh PDA to obtain the pure culture. The morphological characters of the endophytic fungi were studied based on the macroscopic and microscopic observations.

2.4. Characterization of Endophytic Fungi

The genomic DNA extraction from endophytic fungi was carried out by following the [31]. Extracted DNA was subjected to PCR amplification using forward (ITS1-F CTTGGTCATTTAGAGGAAGTAA) and reverse (ITS4-R TCCGTAGGTGAACCTGCGG) primers. The PCR products were run on agarose gel (0.8%) and the bands were purified using the Nucleo-pore PCR Clean-up Gel Extraction kit (Genetix Biotech Asia Pvt. Ltd., Delhi, India). The amplified DNA was subjected to sequencing using the 3130XL genetic analyzer (Applied Biosystems, Waltham, MA, USA). The DNA sequences of endophytic fungi were aligned using Clustal W and Bio Edit tool version 7.0 and the phylogenetic tree was constructed. The DNA sequences of endophytic fungi were deposited in the NCBI Gen Bank.

2.5. Extraction of Secondary Metabolites

The endophytic fungi were mass cultured using 250 mL of potato dextrose broth (PDB) without supplementing the host plant extract (control—axenic culture) and incubated at room temperature for 21 days under static conditions. The broth culture was filtered through Whatman filter paper grade no. 1 and the filtrate obtained was subjected to extraction using ethyl acetate as the solvent system (1:2). The mixture was subjected for 20 min and was kept aside until two immiscible layers were formed. The ethyl acetate layer was collected using a separating funnel. The extract was concentrated under reduced pressure and evaporated to dryness at 40 °C using the rotary vacuum evaporator, further mixed with 1 mL of ethyl acetate before storing at 4 °C.

The endophytic fungi supplemented with host plant extract (test—an-axenic culture) (5%, 10%, 15% and 20%), were mass cultured using 250 mL of PDB medium under static conditions and incubated at room temperature for 21 days. The broth culture was filtered through Whatman filter paper grade no. 1 and the filtrate obtained was subjected to extraction using ethyl acetate as the solvent system (1:2). The mixture was subjected to mixing for 20 min and was kept aside until two immiscible layers were formed. The extract was concentrated under reduced pressure and evaporated to dryness at 40 °C using the rotary vacuum evaporator and mixed with 1 mL of ethyl acetate before storing at 4 °C. The experiments were conducted in three replicates.

2.6. Phytochemical Analysis

The plant and fungal extracts (F1 and F2) were analyzed for the presence of phytochemical compounds using standard methods [32,33] and screened for the presence of secondary metabolites.

Alkaloids (Wagner’s reagent): About 1 mL plant extract was treated with 4–5 drops of Wagner’s reagent and observed for the formation of a reddish-brown precipitate. Wagner’s reagent is a mixture of 1.27 g of iodine and 2 g potassium iodide in 100 mL of water [34].

Tannins: The fungal crude extract was treated with alcoholic FeCl3 reagent. A bluish-black color, which disappears on the addition of a drop of dilute H2SO4 was followed by the formation of yellowish-brown precipitate [35].

Saponins (foam test): About 6 mL of water was added to 2 mL of extract in a test tube. The mixture was shaken vigorously and observed for the formation of persistent foam confirming saponins’ presence [36].

Terpenoids (Salkowski’s test): About 1 mL of chloroform was added to 2 mL of extract. A reddish-brown precipitate is formed immediately on the addition of a few drops of concentrated HCl [37].

Quinones: About 2 mL of the fungal extract was treated with concentrated HCl. The formation of yellow precipitate or coloration indicated the presence of quinones [38].

Phenols: About 2 mL of fungal extract was taken and mixed with aqueous 5% FeCl3 and observed for deep blue or black color formation [39].

Flavonoids: About 0.5 mL of crude extract was taken in a test to which 5–10 drops of diluted HCl and a small piece of zinc were added and the solution was boiled for a few minutes. Reddish-pink or brown color precipitate indicates the presence of flavonoids [40].

2.7. Gas Chromatography and Mass Spectroscopy-(GC-MS)

The GC-MS analysis of the extracts of endophytic fungi and the host plant was carried out at Kerala Forest Research Institute (KFRI), Kerala. The analysis was carried out on Shimadzu GC-MS gas chromatogram QP2010S using two capillary columns (0.25 mmID), one coated with dimethylsiloxane and the other with Carbowax 30M. Nitrogen was used as a carrier gas at 65.2 kpa inlet pressure and organized the temperature between 26 to 28 °C for 6 °C/min under the dimethylsiloxane column. The split ratio used was 1:50. Helium was used as a carrier gas (1 mL/min) along with the ion source temperature of 20 °C. The identification of the compounds was made by analogizing the relative retention indices of the peaks with literature data 3 ± 10 and peak development co-injection with authentic original samples. Mass spectral data were compared against NIST05 (National Institute of Standards and Technology, Washington, DC, USA), WILEY 8 and FFNSCI.3 (Flavour and Fragrance Natural and Synthetic Compounds) libraries for the identification of bioactive compounds.

3. Results

3.1. Isolation and Identification of Endophytic Fungi

A total of eight isolates of endophytic fungi such as Alternaria species, Aspergillus species, Fusarium species, Trichoderma species, Curvularia species and Cladosporium species were isolated from the inoculants at different seasons of the year. Of the eight isolates, two endophytic fungi such as Cladosporium cladosporioides (F1) and Cladosporium tenuissimum (F2) were isolated consistently at different seasons of the year and hence selected for further studies. The morphological studies and molecular characterization confirmed that the fungi were the Cladosporium species belonging to the Dothideomycetes group of Cladosporiaceae family. Endophytic fungi F1 produced olivaceous colonies with diffused aerial mycelia, woolly-mat finished texture, in reverse of its olive-black color. Conidiophores were straight solitary, unbranched terminal or lateral mycelia bearing 8–9 conidia in chains. Conidia were limoniform, ovoid, light brown and aseptate. Whereas F2 produced velvety, olive gray with white margins, reversed with its reddish-white color; conidiophores were straight, solitary, unbranched, terminal mycelia bearing 3–4 conidia in chains. Conidia were limoniform, ovoid, aseptate and stained blue. The results of the ITS sequences from the genomic DNA were submitted to NCBI Gen Bank with accession nos. F1-MH810309 and F2-MN715834, respectively (Figure 1 and Figure 2). The phylogenetic tree for the same was constructed using the Clustal W tool (Figure 3).

3.2. Phytochemical Screening of Endophytic Fungi

The phytochemical analysis of fungal extracts (F1 and F2) revealed the presence of alkaloids, flavonoids, phenols, terpenoids and tannins (

Table 1. Phytochemical analysis of the extracts from endophytic fungi and host plant.

Sl No.	Test	Host Plant Extract (C. martinii)	PDB (Control) (without Supplementation of Plant Extract)		PDB (Test) (with Supplementation of Plant Extract)
			Cladosporium cladosporioides (F1)	Cladosporium tenuissimum (F2)	Cladosporium cladosporioides (F1)
1	Alkaloid	+ve	+ve	+ve	+ve
2	Flavonoid	+ve	+ve	+ve	+ve
3	Phenol	+ve	+ve	+ve	+ve
4	Tannin	+ve	+ve	−ve	+ve
5	Terpenoid	+ve	+ve	+ve	+ve
6	Quinine	+ve	−ve	−ve	−ve
7	Essential oil	+ve	+ve	−ve	+ve

(+) Presence, (−) Absence.

).

3.3. Analysis of Secondary Metabolites (GC-MS)

The GC-MS analysis of F1 (control—axenic culture) showed the presence of important compounds like hexadecane (19.4%), octadecane (20.99%), eicosane (10.69%), 2,4-ditert-butyl-phenol (9.34%), hexadecanal (9.01%), heptadecanal (6.78%), tricosane (5.23%), geraniol (1.2%), geranyl acetate (0.91%) and cubenol (0.39%). F2 (control—axenic culture) showed the presence of compounds like 4,5,7-trihydroxy-2-octanoic acid (42.26%), 3-(tert-butyl di methyl silyl) oxyiminobutan-2-one (12.48%), 1,2-benzenedicarboxylic acid (6.24%), cyclo- octanone (7.01%) and hexadecane (4.59%) (Figure 4;

Table 2. GC-MS analysis of the extracts of endophytic fungi (F1a and F2) without supplementation of host plant extract.

Sl No.	Compound	Area%
		Extract of Plant C. martinii	Extract of Endophytes
			F1a	F2
1	Tetradecane	2.08	0.97	2.12
2	Dodecane	2.88	-	-
3	1S-Endo-bornyl acetate	3.73	-	-
4	Tridecane	4.39	-	-
5	Geraniol	5.45	1.2	-
6	Farnesane	0.34	-	-
7	Geranyl acetate	21.44	0.91	-
8	Heptadecane	30.39	3.17	-
9	(-)-Beta-caryophyllene	0.63	-	-
10	Decane, 2,3,5,8-tetramethyl-	0.44	-	-
11	Hexadecane	10.95	19.4	4.59
12	Gamma-cadinene	0.63	-
13	2-(3-Isopropenyl-4-methyl-4-vinylcyclohexyl)-2-propanol	0.50	-	-
14	(-)-Beta-caryophyllene epoxide	3.09	-	-
15	Tridecane	2.07	-	-
16	Cubenol	9.81	0.39	-
17	(-)-Guaiol	0.83	-	-
18	Agarospirol	1.79	-	-
19	Beta-eudesmol	0.94	-	-
20	Globulol	3.07	-	-
21	2,4-Ditert-butylphenol	-	9.34	-
22	E-14-Hexadecanal	-	9.01	-
23	Octadecane	-	20.99	-
24	7,9-Di-tert-butyl-1-oxaspiro (4,5) deca-6,9-diene-2,8-dione	-	2.10	1.40
25	Heneicosane, 4-cyclohexyl-	-	2.20	-
26	E-15-heptadecenal	-	6.78	-
27	Eicosane	-	10.69	-
28	Decane 4-cycloheyl-, 4-cyclohexyl-	-	1.25	-
29	Tricosane	-	5.23	-
30	1-Heneicosanol	-	1.96	-
31	Tetracosane	-	2.28	-
32	1,2-Benzenedicarboxylic acid	-	3.62	6.24
33	Cyclooctanone	-	-	7.01
34	Cycloheptanone	-	-	2.66
35	3-Methyl-2-butenoic acid, pentadecyl ester	-	-	2.61
36	Valeric acid, 2-pentadecyl ester	-	-	1.21
37	3-(tert-Butyl dimethylsilyl) oxyiminobutan-2-one	-	-	12.48
38	Pentadecane	-	-	3.12
39	4,5,7-Trihydroxy-2-octenoic acid	-	-	42.26
40	Erythro-cis (1,4), trans (1,4)-4,4-dihyrdoxybicyclooctyl	-	-	9.04
41	Nonadecane	-	-	1.37

). The GC-MS analysis of the host plant extract also revealed the presence of compounds such as geranyl acetate (21.44%), geraniol (5.45%), heptadecane (30.39%), hexadecane (10.95%), cubenol (9.81%), bornyl acetate (3.73%), tridecane (4.39%) and beta-caryophyllene epoxide (3.09%) in higher percentages along with the production of other compounds.

Test organism F1 (an-axenic culture) supplemented with different concentrations of the host plant extract (5%, 10%, 15% and 20%) produced a higher number of secondary metabolites when compared to control (Figure 5;

Table 3. GC-MS analysis of secondary metabolites of endophytic fungi F1 (Cladosporium cladosporioides isolated from wild C. martnii with supplementation of host plant extract at different concentrations).

Sl No.	Compound	Area %
		5 mL	10 mL	15 mL	20 mL
1.	2-Hydroxy menthol	0.11	0.14	0.15	-
2.	Nor-borneol	0.15	0.28	-	0.38
3.	Cedrane	0.14	-	1.06	-
4.	Cedral acetate	2.92	-	-	-
5.	Alpha cyclo geraniol	-	0.4	-	-
6.	Campesterol	-	0.41	-	-
7.	1,4-Epoxynaphthalene-menthol	-	0.55	-	-
8.	Elemicin	-	-	1.26	-
9.	Cetonal	-	-	0.35	-
10.	Limonene 1,2-diol	-	-	-	0.4
11.	Beta-cyclo homo geraniol	-	-	-	0.13
12.	Linalool oxide	-	-	-	0.24
13.	2,3-Bornanediol	-	-	-	1.4
14.	2,3-pinanediol	-	-	-	0.11
15.	Epiglobulol	-	-	-	0.84
16.	Calamenene	-	-	-	0.66
17.	Citronellyl tiglate	-	-	-	1.11

). With supplementation of 5 mL (5%) of the host plant extract, the fungi produced compounds such as exo-nor borneol (0.15%), cedrol acetate (2.92%), hydroxy menthol (0.11%), nonadecene (12.6%), hexadecenoic acid (20.98%), 1,4-epoxynaphthalene-1(2H)-menthol (1.63%) and more (

Table 4. GC-MS analysis of endophytic fungus F1 (cultured with 5 mL host extract).

Sl No.	Compound	Area %	RT
1.	Nonanal	0.04	6.074
2.	1,3-Butanediol, diacetate	0.03	6.361
3.	3-tert-Butyl-2-pyrazolin-5-one	0.06	8.167
4.	Nonanoic acid	0.05	8.292
5.	1-Tetradecene	0.08	9.964
6.	2-hydroxy menthol	0.11	10.054
7.	Cyclohexane butanal,	0.6	10.14
8.	exo-nor borneol	0.15	10.283
9.	Phenol,	0.23	11.542
10.	Benzoic acid,	0.05	11.75
11.	1,7-Dioxaspiro [5.5] undec-2-ene	0.06	11.918
12.	Dodecanoic acid	0.18	12.076
13.	1-Heptadecene	0.85	12.431
14.	Octadecane	0.63	12.512
15.	Oxirane	1.44	12.816
16.	Cedrane	0.14	13.547
17.	Tridecanal	0.08	13.859
18.	E-8-Methyl-9-tetradecen-1-ol acetate	0.92	14.334
19.	1-Nonadecene	12.61	14.662
20.	Spiro [4.5] decan-7-one	0.29	15.334
21.	Cedrol acetate	2.92	16.019
22.	Widdrol hydroxyether	1.43	16.295
23.	n-hexa decanoic acid	20.98	16.447
24.	Oleic Acid	3.32	17.276
25.	1-Octadecanol	0.27	17.568
26.	Octadecanoic acid	7.9	18.307
27.	Decanoic acid,	0.37	19.100
28.	1-Tetracosanol	1.38	20.234
29.	Octadecanal	0.3	20.553
30.	2-palmitoyl glycerol	1.72	21.228
31.	1,2-Benzenedicarboxylic acid, mono (2-ethylhexyl	1.32	21.553
32.	1-Triacontanol	1.86	21.805
33.	10,12,14-Nonacosatriynoic acid	0.72	22.263
34.	Abietic acid	1.3	22.385
35.	Retinoic acid	0.43	22.544
36.	Glyceryl mono acetate	3.99	22.629
37.	Stearin	0.97	22.787
38.	Squalene	0.93	23.568
39.	Corticosterone 21-acetate	0.63	23.796
40.	Trans-beta-lonone	0.58	23.934
41.	Dehydroergosterol 3,5-dinitrobenzoate	0.92	24.848
42.	Cholest-5-en-3-ol (3. beta)	0.24	26.134
43.	Cycloeucalenol	0.36	26.73
44.	Stigmasta-4,7,22-trien-3. alpha-ol	0.88	30.15
45.	Hexa decanoic acid	1.42	30.562
46.	Rhodopin	0.83	31.201
47.	1,4-Epoxynaphthalene-1(2H)-methanol	1.63	32.554
48.	Ergosta-8,24(28)-dien-3-ol, 14-methyl-, (3. beta,5. alpha)	1.79	33.576

Red color indicates the compounds with high percentages. Bold indicates similar compounds present in the essential oil of the host plant. RT: retention time.

); with 10 mL (10%) supplementation it produced 2-hydroxymentol (0.14%), oxo-borneol (0.28%), alpha cyclo geraniol (0.4%), cetonal (0.36%), phthalic acid (14.64%), hexadecenoic acid (7.45%), campesterol (0.41%), 1,4-epoxynaphthalene-1(2H)-menthol (0.55%), gamma-sitosterol (2.22%) and more (

Table 5. GC-MS analysis of endophytic fungus F1 (cultured with 10 mL host extract).

Sl No.	Compound	Area %	R Time
1.	1-Tetradecene	0.1	9.951
2.	2-hydroxymenthol	0.14	10.041
3.	2-hydroxybutyl acrylate	0.45	10.129
4.	Oxo-borneol	0.28	10.271
5.	1-Heptadecene	0.93	12.418
6.	Alpha-cyclo geraniol	0.4	14.319
7.	1-Nonadecene	2.12	14.649
8.	2,11-Dodecadiene	0.4	14.906
9.	Cetonal	0.36	15.318
10.	diisobutyl phthalate	19.28	15.547
11.	l-(+)-Ascorbic acid 2,6-dihexadecanoate	1.12	16.297
12.	n-Hexadecanoic acid	7.45	16.389
13.	Dibutyl phthalate	12.3	16.494
14.	Phthalic acid,	14.64	16.69
15.	Oleic Acid	6.87	18.074
16.	Benzenedicarboxylic acid	2.51	17.017
17.	9-Tricosene	2.52	18.522
18.	1-Tetracosanol	1.22	20.219
19.	1-Triacontanol	0.61	21.793
20.	Oleoyl chloride	0.86	22.617
21.	Tetrapentacontane	0.49	23.255
22.	Tetracosamethyl-cyclododecasiloxane	1.92	24.362
23.	Dehydroergosterol 3,5-dinitrobenzoate	0.36	24.838
24.	Dithianone	0.37	25.048
25.	Cyclononasiloxane	0.88	25.359
26.	Stigmast-5-en-3-ol	1.64	25.909
27.	Isoindole-1,3(1H,3H)-dione	0.78	27.085
28.	Campesterol	0.41	27.241
29.	Chondrillasterol	0.57	27.581
30.	gamma-Sitosterol	2.22	28.297
31.	1,4-Epoxynaphthalene-1(2H)-methanol	0.55	32.525

Red color indicates the compounds in high percentages. Bold indicates similar compounds present in the essential oil of host plant.

); under 15 mL (15%) it produced 2-hydroxymenthol (0.15%), elemicin (1.26%), cedrane (1.06%), cetonal (0.35%), decanoic acid (11.9%), phthalic acid (21.69%), dibutyl phthalate (11.7%) along with other compounds (

Table 6. GC-MS analysis of endophytic fungus F1 (cultured with 15 mL host extract).

Sl No.	Compound	Area %	R Time
1.	Propanoic acid	0.35	5.478
2.	Malic acid	0.18	5.68
3.	Butanedioic acid	0.13	5.856
4.	2-Octenoic acid	0.4	7.513
5.	2-Decenoic acid	11.95	9.538
6.	1-Tetradecene	0.12	9.958
7.	2-Hydroxymenthol	0.15	10.05
8.	Elemicin	1.26	12.069
9.	1-Hexadecanol	1.46	12.438
10.	Cyclodecanamine	3.46	12.629
11.	D-Galactose	0.54	12.945
12.	Cedrane	0.1	13.547
13.	9,10-Dimethyltricyclo [4.2.1.1(2,5)] decane-9,10-diol	0.87	14.333
14.	1-Nonadecene	1.54	14.658
15.	2-Cyclohexen-1-one	0.18	14.83
16.	3.alpha,7 beta-Dihydroxy-5 beta,6 beta-epoxycholestane	0.1	15.127
17.	6-Isopropenyl-4,8a-dimethyl-1,2,3,5,6,7,8,8a-octahydro-naphthalen-2-ol	0.04	15.24
18.	Cetonal	0.35	15.327
19.	Di isobutyl phthalate	7.35	15.556
20.	Phthalic acid	21.69	16.236
21.	n-Hexadecanoic acid	9.16	16.417
22.	Dibutyl phthalate	11.78	16.505
23.	Oleic acid	7.73	17.261
24.	Acetophenone	0.49	18.384
25.	Pentaerythrityl tetrachloride	0.36	18.815
26.	4-Bromobutanoic acid	0.29	19.057
27.	Pentaerythrityl tetrachloride	0.91	19.826
28.	1-Tetracosanol	1.02	20.226
29.	Carbamazepine	0.33	20.651
30.	1-Triacontanol	0.55	21.795
31.	glyceryl mono oleate	2.36	22.621
32.	1-Hexacosanol	0.35	23.255
33.	1-Nonadecene	2.01	18.53

Red color indicates the compounds in high percentages. Bold indicates similar compounds present in the essential oil of host plant.

); and 20 mL (20%) supplementation produced limonene (0.4%), beta-cyclo homo geraniol (0.13%), linalool oxide (0.24%), 2,3-bornanediol (1.4%), nor borneol (0.38%), 2,3-pinanediol (0.1%), epiglobulol (0.84%), di isobutyl phthalate (7.9%), hexadecenoic acid (8.03%), phthalic acid (9.23%) and citronellyl tiglate (1.11%) along with many other compounds (

Table 7. GC-MS analysis of endophytic fungus F1 (cultured with 20 mL host extract).

Sl No.	Compound	Area %	R Time
1.	Glycerine	0.11	4.264
2.	2-Nonadecanone	0.13	7.756
3.	Limonene glycol or P-menth-8-ene	0.4	9.191
4.	Beta-cyclohomo geraniol	0.13	9.487
5.	Linalool oxide	0.24	9.56
6.	2,3-Bornanediol	1.4	10.046
7.	Cyclohexanebutanal	1.15	10.146
8.	2-Norborneol	0.38	10.278
9.	Alpha-campholene aldehyde	0.18	10.418
10.	Lomustine	0.13	10.637
11.	Cyclohexanol	0.14	10.754
12.	10-Methyl-8-tetradecen-1-ol acetate	0.18	11.021
13.	4-Nonanone	0.22	11.245
14.	Benzoic acid, 4-ethoxy-, ethyl ester	0.11	11.742
15.	1,7-Dioxaspiro [5.5] undec-2-ene	0.58	11.908
16.	1-Heptadecene	1.12	12.427
17.	6-Acetyl-4,4,7-trimethylbicyclo [4.1.0] heptan-2-one	0.42	12.735
18.	2,3-pinanediol	0.1	13.03
19.	Bicyclo(3.1.1)heptane-2,3-diol, 2,6,6-trimethyl-	0.67	13.544
20.	1H-Benzocyclohepten-7-ol, 2,3,4,4a,5,6,7,8-octahydro-1,1,4a,7-tetramethyl-	0.23	14.18
21.	1-Cyclohexanone, 2-methyl-2-(3-methyl-2-oxobutyl)	7.3	14.337
22.	1-Nonadecene	3.41	14.662
23.	2,5,9-Tetradecatriene, 3,12-diethyl-	0.23	14.839
24.	2-Dodecen-1-yl (-) succinic anhydride	1.57	14.998
25.	Epiglobulol	0.84	15.131
26.	6-Isopropenyl-4,8a-dimethyl-1,2,3,5,6,7,8,8a-octahydro-naphthalen-2-ol	1.28	15.246
27.	Spiro [4.5] decan-7-one, 1,8-dimethyl-8,9-epoxy-4-isopropyl-	0.42	15.326
28.	Diisobutyl phthalate	7.91	15.556
29.	3-Methyl-5-(1,4,4-trimethylcyclohex-2-enyl) pentan-1-ol	1.72	15.666
30.	Calamenene	0.66	15.780
31.	2,6-Bis-(acetamido)-pyridine	0.93	16.115
32.	Phthalic acid, isobutyl 2-pentyl ester	1.21	16.231
33.	Widdrol hydroxyether	3.35	16.302
34.	n-Hexadecanoic acid	8.03	16.429
35.	Dibutyl phthalate	4.65	16.504
36.	1,2-Benzenedicarboxylic acid, butyl decyl ester	1.53	16.579
37.	Phthalic acid, isobutyl octadecyl ester	9.23	16.709
38.	2,4,7,14-Tetramethyl-4-vinyl-tricyclo [5.4.3.0(1,8)]t	1.38	16.945
39.	1,2-Benzenedicarboxylic acid, butyl 8-methylnonyl ester	0.79	17.024
40.	2-naphthalene butanoic acid	5.94	17.161
41.	2-Methyl-5-(2,6,6-trimethyl-cyclohex-1-enyl)-pentane-2,3-diol	0.35	17.336
42.	Phthalic acid, isobutyl 2-pentyl ester	0.56	17.416
43.	2-[4-methyl-6-(2,6,6-trimethylcyclohex-1-enyl) hexa-1,3,5-trienyl]cy	1.11	17.516
44.	Citronellyl tiglate	1.11	17.761
45.	Oleic acid	5.41	18.110
46.	Octadecanoic acid	1.68	18.288
47.	Benzo[b]dihydropyran, 6-hydroxy-4,4,5,7,8-pentamethyl-	1.6	18.390
48.	1-Tricosanol	2.78	18.529
49.	Beta-sitosterol	0.17	18.867
50.	1-Tetracosanol	1.67	20.226
51.	Oxirane, hexadecyl	0.15	20.546
52.	Hexadecanoic acid,	0.41	21.223
53.	1,2-Benzenedicarboxylic acid,	3.68	21.548
54.	1-Triacontanol	1.06	21.795
55.	10,12,14-Nonacosatriynoic acid	0.24	22.259
56.	Glyceryl monooleate	1.73	22.620
57.	1-Hexacosanol	0.77	23.252
58.	2,6,10,14,18,22-Tetracosahexaene, 2,6,10,15,19,23-hexamethyl-	0.21	23.559
59.	Dehydroergosterol 3,5-dinitrobenzoate	0.44	24.836
60.	9,19-Cycloergost-24(28)-en-3-ol, 4,14-dimethyl-,	0.18	26.716
61.	Ergosta-5,8,22-trien-3-ol, (3 beta,22E)	0.54	27.008
62.	Anthraergostatetraenol	0.13	27.239
63.	Stigmasta-7,25-dien-3-ol, (3 beta, 5 alpha)	0.11	27.831
64.	17-Pentatriacontene	0.14	28.588
65.	Rhodopin	0.96	31.174
66.	1,4-Epoxynaphthalene-1(2H)-methanol, 4,5,7-tris(1,1-dimethylethyl)-3	0.72	32.520
67.	Cholesta-8,14-dien-3-ol, 4,4-dimethyl-	0.43	33.532

Red color indicates the compounds in high percentages. Bold indicates similar compounds present in the essential oil of host plant.

).

4. Discussion

During the present study, six endophytic fungal species like Alternaria, Aspergillus, Fusarium, Trichoderma, Curvularia and Cladosporium were isolated from wild Cymbopogon martinii (MT90507). Furthermore, the Cladosporium species were studied (C. cladosporioides and C. tenuissimum) based on their consistent growth throughout the year. The C. cladosporioides is also reported as endophytic fungi in the genus Cymbopogon such as C. citratus, C. flexuosus and C. caesius [41,42] expressing tremendous ecological adaptability [43].

The phytochemical analysis of C. cladosporioides (F1) and C. tenuissimum (F2) showed the presence of secondary compounds belonging to alkaloids, flavonoids, phenols, terpenoids and tannins which are similar to those of the host plant (wild C. martinii). The GC-MS analysis of ethyl acetate extracts of endophytic fungi F1 and F2 (control-without adding host plant extract) revealed the presence of compounds like 1-octen-3-ol, 3-methyl-1-butanol, hexanol, trans-2-octanol and hexadecanol in similarity with the host plant extract. These compounds are known to possess antimicrobial, anti-inflammatory and antioxidant activities [44]. Sharing of the above mentioned similar secondary metabolite compounds between endophytic fungi and the host plant has been reported earlier [9,45]. Likewise, common compounds were shared between endophytic fungi F1 (control) and the host plant such as octadecane, eicosane, hexadecane, heptadecane and 2,4-ditert-butyl phenol coming under alkanes producing in higher percentages along with the production of geranyl acetate, cubenol and geraniol belonging to monoterpenoids. The production of such an alkane group of compounds has been reported in endophytic fungi including also C. cladosporioides and C. tenuissimum and these are known to possess potential biological activities [46,47,48]. Under in vitro conditions, the endophytic fungus F1 having a pre-existing terpenoid pathway could produce compounds similar to that of the host plant. The transcriptome studies made on endophytic fungus C. cladosporioides expressed the presence of a pathway for terpenoid biosynthesis [49,50,51].

The endophytic fungus F1 (test) produced a large number of plant derived secondary metabolites belonging to hydrocarbons, hydrocarbons esters and monoterpenoid. There are reports on C. cladosporioides as endophyte producing compounds belonging to a monoterpenoid group [26,52,53,54,55]. Studies made on C. cladosporioides isolated from Taxus brevifolia, T. baccata, H. serrata and Tobacco species expressed the production of monoterpenoid compounds similar to that of host plants [28,29,56,57]. Supplementation of the host plant extract at different concentrations (5–20%) to broth culture resulted in variation in monoterpenoid compound production in the endophytic fungi (Table 3). The F1 (test) might utilize the precursor components from the host plant extract and convert them into biotransformed monoterpenoid compounds (Figure 5), and similar studies have been made earlier (Vijay Lakshmi et al., 2019, 56]. These monoterpenoid compounds were produced in low percentages due to the poor catalytic activity of plant derived enzymes in the endophytic system (Sun et al., 2019). The monoterpenoid compounds and their precursors are known to express antioxidant, anticancer and antimicrobial activities [7,58,59]. The present study revealed that the endophytic fungus F1¹ (C. cladosporioides) and the host plant share common Mevalonate (MVA) and Phenylpropanoid (PP) pathways as also documented in earlier studies [7,50].

The endophytes show a strong relationship and long-term association with the host plant and thus mimic the plant for secondary metabolite production [60]. The relationship shared between endophyte and plant could lead to coevolution and adaptation [61], which results in horizontal gene transfer, establishes cross-talk between gene clusters and helps in the biosynthesis of common terpenoid compounds [43,51,62]. There are several reports on revealing the capability of C. cladosporioides for adaptation within the host plant environment thus producing secondary metabolites similar to the host plant [9,21,43,63,64]. The in vitro cultured endophytic fungus F2 (C. tenisimum) could not produce secondary metabolites similar to F1 (C. cladosporioides) or the host plant as the metabolites were produced for their basic survival activity within the host system and thus were not involved in cross-talk with the plant [65].

In the current study, the endophytic fungus F1 has expressed high adoptability and a stronger relationship with the wild genotype of C. martinii and has been successful in producing secondary metabolites similar to the host plant. Further, the mechanism of the molecular interactions happening during secondary metabolite production between endophytic fungi and the host plant needs elaborate studies using ‘omic’ approaches. The interaction of the endophytic fungi with the host plant explains the vital activities taken up by the sessile natured plant.