Large-Scale Staphylococcus aureus Foodborne Disease Poisoning Outbreak among Primary School Children
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Hypothesis
2.2. Study Population and Case Definition
2.3. Outbreak Investigation
2.4. Microbiological Analysis and Characterization of S. aureus
3. Results
3.1. Child Cases, Attack Rate and Clinical Manifestations
3.2. Laboratory Analysis and Investigation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kim, Y.B.; Seo, K.W.; Jeon, H.Y.; Lim, S.K.; Lee, Y.J. Characteristics of the antimicrobial resistance of Staphylococcus aureus isolated from chicken meat produced by different integrated broiler operations in Korea. Poult. Sci. 2018, 97, 962–969. [Google Scholar] [CrossRef] [Scilit]
- Le Loir, Y.; Baron, F.; Gautier, M. Staphylococcus aureus and food poisoning. Genet. Mol. Res. 2003, 2, 63–76. [Google Scholar]
- Wieneke, A.A.; Roberts, D.; Gilbert, R.J. Staphylococcal food poisoning in the United Kingdom, 1969–1990. Epidemiol. Infect. 1993, 110, 519–531. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Huang, J.; Wu, Q.; Zhang, J.; Zhang, F.; Yang, X.; Wu, H.; Zeng, H.; Chen, M.; Ding, Y.; et al. Staphylococcus aureus Isolated From Retail Meat and Meat Products in China: Incidence, Antibiotic Resistance and Genetic Diversity. Front. Microbiol. 2018, 9, 2767. [Google Scholar] [CrossRef] [Scilit]
- Balaban, N.; Rasooly, A. Staphylococcal enterotoxins. Int. J. Food Microbiol. 2000, 61, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Meng, J.; Zhang, J.; Zhou, T.; Zhang, Y.; Yang, B.; Xi, M.; Xia, X. Characterization of Staphylococcus aureus isolated from powdered infant formula milk and infant rice cereal in China. Int. J. Food Microbiol. 2012, 153, 142–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bui, T.M.H.; Zahid, H.M.; Sucharit, B.N.; Afework, K.; Nguyen, V.N.; Alizadeh, M.; Masayuki, Y.; Fusao, O.; Nguyen, T.L.; Ha, T.A.D.; et al. Toxigenicity and genetic diversity of Staphylococcus aureus isolated from Vietnamese ready-to-eat foods. Food Control 2010, 21, 166–171. [Google Scholar]
- Veras, J.F.; do Carmo, L.S.; Tong, L.C.; Shupp, J.W.; Cummings, C.; Dos Santos, D.A.; Cerqueira, M.M.; Cantini, A.; Nicoli, J.R.; Jett, M. A study of the enterotoxigenicity of coagulase-negative and coagulase-positive staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil. Int. J. Infect. Dis. 2008, 12, 410–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshida, R.; Kuwahara-Arai, K.; Baba, T.; Cui, L.; Richardson, J.F.; Hiramatsu, K. Physiological and molecular analysis of a mecA-negative Staphylococcus aureus clinical strain that expresses heterogeneous methicillin resistance. J. Antimicrob. Chemother. 2003, 51, 247–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strommenger, B.; Kettlitz, C.; Weniger, T.; Harmsen, D.; Friedrich, A.W.; Witte, W. Assignment of Staphylococcus isolates to groups by spa typing, SmaI macrorestriction analysis, and multilocus sequence typing. J. Clin. Microbiol. 2006, 44, 2533–2540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Urwin, R.; Maiden, M.C. Multi-locus sequence typing: A tool for global epidemiology. Trends Microbiol. 2003, 11, 479–487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maiden, M.C.; Bygraves, J.A.; Feil, E.; Morelli, G.; Russell, J.E.; Urwin, R.; Zhang, Q.; Zhou, J.; Zurth, K.; Caugant, D.A.; et al. Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. USA 1998, 95, 3140–3145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jolley, K.A.; Maiden, M.C. BIGSdb: Scalable analysis of bacterial genome variation at the population level. BMC Bioinf. 2010, 11, 595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spratt, B.G.; Hanage, W.P.; Li, B.; Aanensen, D.M.; Feil, E.J. Displaying the relatedness among isolates of bacterial species—The eBURST approach. FEMS Microbiol. Lett. 2004, 241, 129–134. [Google Scholar] [CrossRef] [Scilit]
- Feil, E.J.; Li, B.C.; Aanensen, D.M.; Hanage, W.P.; Spratt, B.G. eBURST: Inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J. Bacteriol. 2004, 186, 1518–1530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mellmann, A.; Weniger, T.; Berssenbrugge, C.; Rothganger, J.; Sammeth, M.; Stoye, J.; Harmsen, D. Based Upon Repeat Pattern (BURP): An algorithm to characterize the long-term evolution of Staphylococcus aureus populations based on spa polymorphisms. BMC Microbiol. 2007, 7, 98. [Google Scholar] [CrossRef] [Scilit]
- Argimon, S.; Abudahab, K.; Goater, R.J.E.; Fedosejev, A.; Bhai, J.; Glasner, C.; Feil, E.J.; Holden, M.T.G.; Yeats, C.A.; Grundmann, H.; et al. Microreact: Visualizing and sharing data for genomic epidemiology and phylogeography. Microb. Genom. 2016, 2, e000093. [Google Scholar] [CrossRef] [Scilit]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit]
- Doyle, M.P.; Beuchat, L.R. (Eds.) Staphylococcus aureus. In Food Microbiology: Fundamentals and Frontiers, 3rd ed.; ASM Press: Washington, DC, USA, 2007; pp. 493–518. [Google Scholar]
- Gumbo, A.; Bangure, D.; Gombe, N.T.; Mungati, M.; Tshimanga, M.; Hwalima, Z.; Dube, I. Staphylococcus aureus food poisoning among Bulawayo City Council employees, Zimbabwe, 2014. BMC Res. Notes 2015, 8, 485. [Google Scholar] [CrossRef] [Scilit]
- Pillsbury, A.; Chiew, M.; Bates, J.; Sheppeard, V. An outbreak of staphylococcal food poisoning in a commercially catered buffet. Commun. Dis. Intell. 2013, 37, E144–E148. [Google Scholar]
- Berger-Bachi, B.; Barberis-Maino, L.; Strassle, A.; Kayser, F.H. FemA, a host-mediated factor essential for methicillin resistance in Staphylococcus aureus: Molecular cloning and characterization. Mol. Gen. Genet. 1989, 219, 263–269. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Xie, S. Genotypes, Enterotoxin Gene Profiles, and Antimicrobial Resistance of Staphylococcus aureus Associated with Foodborne Outbreaks in Hangzhou, China. Toxins 2019, 11, 307. [Google Scholar] [CrossRef] [Scilit]
- Li, G.; Wu, S.; Luo, W.; Su, Y.; Luan, Y.; Wang, X. Staphylococcus aureus ST6-t701 isolates from food-poisoning outbreaks (2006–2013) in Xi’an, China. Foodborne Pathog. Dis. 2015, 12, 203–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, F.; Gu, W.; Yang, Z.; Mo, Z.; Fan, L.; Guo, Y.; Fu, X.; Xu, W.; Li, C.; Dai, J. Molecular characteristics of Staphylococcus aureus isolates from food surveillance in southwest China. BMC Microbiol. 2018, 18, 91. [Google Scholar] [CrossRef] [Scilit]
- Yan, X.; Wang, B.; Tao, X.; Hu, Q.; Cui, Z.; Zhang, J.; Lin, Y.; You, Y.; Shi, X.; Grundmann, H. Characterization of Staphylococcus aureus strains associated with food poisoning in Shenzhen, China. Appl. Environ. Microbiol. 2012, 78, 6637–6642. [Google Scholar] [CrossRef] [Scilit]
- Argudin, M.A.; Mendoza, M.C.; Rodicio, M.R. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Denayer, S.; Delbrassinne, L.; Nia, Y.; Botteldoorn, N. Food-Borne Outbreak Investigation and Molecular Typing: High Diversity of Staphylococcus aureus Strains and Importance of Toxin Detection. Toxins 2017, 9, 407. [Google Scholar] [CrossRef] [Scilit]
- Grispoldi, L.; Popescu, P.A.; Karama, M.; Gullo, V.; Poerio, G.; Borgogni, E.; Torlai, P.; Chianese, G.; Fermani, A.G.; Sechi, P.; et al. Study on the Growth and Enterotoxin Production by Staphylococcus aureus in Canned Meat before Retorting. Toxins 2019, 11, 291. [Google Scholar] [CrossRef] [Scilit]

| Gene | Primer | Primer Sequence (5′–3′) | Reference |
|---|---|---|---|
| sea | SEA Fw | GCA GGG AAC AGC TTT AGG C | [8] |
| SEA Rv | GTT CTG TAG AAG TAT GAA ACA CG | ||
| seb | SEB Fw | GTA TGG TGG TGT AAC TGA GC | [8] |
| SEB Rv | CCA AAT AGT GAC GAG TTA GG | ||
| sec | SEC Fw | CTT GTA TGT ATG GAG GAA TAA CAA | [8] |
| SEC Rv | TGC AGG CAT CAT ATC ATA CCA | ||
| sed | SED Fw | GTG GTG AAA TAG ATA GGA CTG C | [8] |
| SED Rv | ATA TGA AGG TGC TCT GTG G | ||
| femA | FemA Fw | AAA AAA GCA CAT AAC AAG CG | [8] |
| FemA Rv | GAT AAA GAA GAA ACC AGC AG | ||
| mecA | MecA Fw | TGCTATCCACCCTCAAACAGG | [9] |
| MecA Rv | AACGTTGTAACCACCCCAAGA | ||
| spa | spa-1113f | TAA AGA CGA TCC TTC GGT GAG C | [10] |
| spa-1514r | CAG CAG TAG TGC CGT TTG CTT |
| Age (years) and Gender | Affected | Unaffected | Attack Rate (%) | Total |
|---|---|---|---|---|
| 6–7 girls | 23 | 0 | 100 | 23 |
| 6–7 boys | 28 | 0 | 100 | 28 |
| 8–10 girls | 18 | 1 | 94.7 | 19 |
| 8–10 boys | 18 | 1 | 94.7 | 19 |
| Total | 87 | 2 | 98.0 | 89 |
| Isolate | Origin | MLST | spa Type | Classical | Virulence Genes | Antimicrobial |
|---|---|---|---|---|---|---|
| Toxins i | Resistance ii | |||||
| 4.1 | Chicken floss | ST6 | t701 | + | coa, sea, sec, femA | TET, PEN |
| 7.1 | Vomit | ST6 | t701 | + | coa, sea, sec, femA | TET, PEN |
| 8.1 | Vomit | ST6 | t701 | + | coa, sea, sec, femA | TET, PEN |
| 8.2 | Vomit | ST6 | t701 | + | coa, sea, sec, femA | TET, PEN |
| 11.1 | Frozen chicken | ST6 | t701 | + | coa, sea, sec, femA | TET, PEN |
| 11.4 | Frozen chicken | ST6 | t701 | + | coa, sea, sec, femA | TET, PEN |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Le, H.H.T.; Dalsgaard, A.; Andersen, P.S.; Nguyen, H.M.; Ta, Y.T.; Nguyen, T.T. Large-Scale Staphylococcus aureus Foodborne Disease Poisoning Outbreak among Primary School Children. Microbiol. Res. 2021, 12, 43-52. https://doi.org/10.3390/microbiolres12010005
Le HHT, Dalsgaard A, Andersen PS, Nguyen HM, Ta YT, Nguyen TT. Large-Scale Staphylococcus aureus Foodborne Disease Poisoning Outbreak among Primary School Children. Microbiology Research. 2021; 12(1):43-52. https://doi.org/10.3390/microbiolres12010005
Chicago/Turabian StyleLe, Hao Hong Thi, Anders Dalsgaard, Paal Skytt Andersen, Huong Minh Nguyen, Yen Thi Ta, and Trung Thanh Nguyen. 2021. "Large-Scale Staphylococcus aureus Foodborne Disease Poisoning Outbreak among Primary School Children" Microbiology Research 12, no. 1: 43-52. https://doi.org/10.3390/microbiolres12010005
APA StyleLe, H. H. T., Dalsgaard, A., Andersen, P. S., Nguyen, H. M., Ta, Y. T., & Nguyen, T. T. (2021). Large-Scale Staphylococcus aureus Foodborne Disease Poisoning Outbreak among Primary School Children. Microbiology Research, 12(1), 43-52. https://doi.org/10.3390/microbiolres12010005

