Mitigative Effect of Graphene Oxide Nanoparticles in Maintaining Gut–Liver Homeostasis against Alcohol Injury
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Methods
2.2.1. Synthesis and Characterization of Graphene Oxide (GO) Nanoparticle
2.2.2. Cell Culture Studies
- (A)
- Toxicity study:
- (B)
- Cell damage analysis:
DAPI Staining
AO-EtBr Staining
Lipid Accumulation Study
ROS Study
Gene Expression
2.3. Statistical Analysis
3. Results
3.1. Characterization of Nanoparticles
3.2. Activity in In Vitro Model
3.2.1. Cell Viability Study
3.2.2. Cell Damage Study
- (A)
- AO-EtBr and DAPI staining:
- (B)
- Lipid accumulation study:
- (C)
- Reactive oxygen spices analysis:
- (D)
- Gene expression analysis:
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Niu, X.; Zhu, L.; Xu, Y.; Zhang, M.; Hao, Y.; Ma, L.; Li, Y.; Xing, H. Global prevalence, incidence, and outcomes of alcohol related liver diseases: A systematic review and meta-analysis. BMC Public Health 2023, 23, 859. [Google Scholar]
- Aghara, H.; Chadha, P.; Zala, D.; Mandal, P. Stress mechanism involved in the progression of alcoholic liver disease and the therapeutic efficacy of nanoparticles. Front. Immunol. 2023, 14, 1205821. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Wang, Y.; Pan, C.Q.; Xing, H. Gut microbiota in alcohol-related liver disease: Pathophysiology and gut-brain cross talk. Front. Pharmacol. 2023, 14, 1258062. [Google Scholar] [CrossRef] [PubMed]
- Subramaniyan, V.; Chakravarthi, S.; Jegasothy, R.; Seng, W.Y.; Fuloria, N.K.; Fuloria, S.; Hazarika, I.; Das, A. Alcohol-associated liver disease: A review on its pathophysiology, diagnosis and drug therapy. Toxicol. Rep. 2021, 8, 376–385. [Google Scholar] [CrossRef] [PubMed]
- Yoon, E.L.; Kim, W. Current and future treatment for alcoholic-related liver diseases. J. Gastroenterol. Hepatol. 2023, 38, 1218–1226. [Google Scholar] [CrossRef] [PubMed]
- Osna, N.A.; Donohue, T.M.; Kharbanda, K.K. Alcoholic Liver Disease: Pathogenesis and Current Management. Alcohol Res. Curr. Rev. 2017, 38, 147. [Google Scholar]
- Zhao, R.; Zhu, M.; Zhou, S.; Feng, W.; Chen, H. Rapamycin-Loaded mPEG-PLGA Nanoparticles Ameliorate Hepatic Steatosis and Liver Injury in Non-alcoholic Fatty Liver Disease. Front. Chem. 2020, 8, 407. [Google Scholar] [CrossRef]
- Hu, R.; Liu, S.; Anwaier, G.; Wang, Q.; Shen, W.; Shen, Q.; Qi, R. Formulation and intestinal absorption of naringenin loaded nanostructured lipid carrier and its inhibitory effects on nonalcoholic fatty liver disease. Nanomedicine 2021, 32, 102310. [Google Scholar] [CrossRef]
- Priyadarsini, S.; Mohanty, S.; Mukherjee, S.; Basu, S.; Mishra, M. Graphene and graphene oxide as nanomaterials for medicine and biology application. J. Nanostruct. Chem. 2018, 8, 123–137. [Google Scholar] [CrossRef]
- Lai, W.F.; Wong, W.T. Use of graphene-based materials as carriers of bioactive agents. Asian J. Pharm. Sci. 2021, 16, 577–588. [Google Scholar] [CrossRef]
- Mukherjee, S.P.; Bottini, M.; Fadeel, B. Graphene and the immune system: A romance of many dimensions. Front. Immunol. 2017, 8, 272794. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Yang, C.; Chen, P.; Zhang, L.; Cao, Y. The uses of transcriptomics and lipidomics indicated that direct contact with graphene oxide altered lipid homeostasis through ER stress in 3D human brain organoids. Sci. Total Environ. 2022, 849, 157815. [Google Scholar] [CrossRef]
- Baali, N.; Khecha, A.; Bensouici, A.; Speranza, G.; Hamdouni, N. Assessment of Antioxidant Activity of Pure Graphene Oxide (GO) and ZnO-Decorated Reduced Graphene Oxide (rGO) Using DPPH Radical and H2O2 Scavenging Assays. C J. Carbon Res. 2019, 5, 75. [Google Scholar] [CrossRef]
- Marcano, D.C.; Kosynkin, D.V.; Berlin, J.M.; Sinitskii, A.; Sun, Z.; Slesarev, A.; Alemany, L.B.; Lu, W.; Tour, J.M. Improved synthesis of graphene oxide. ACS Nano 2010, 4, 4806–4814. [Google Scholar] [CrossRef] [PubMed]
- Habte, A.T.; Ayele, D.W.; Hu, M. Synthesis and Characterization of Reduced Graphene Oxide (rGO) Started from Graphene Oxide (GO) Using the Tour Method with Different Parameters. Adv. Mater. Sci. Eng. 2019, 2019, 5058163. [Google Scholar] [CrossRef]
- Nasirzadeh, N.; Azari, M.R.; Rasoulzadeh, Y.; Mohammadian, Y. An assessment of the cytotoxic effects of graphene nanoparticles on the epithelial cells of the human lung. Toxicol. Ind. Health 2019, 35, 79–87. [Google Scholar] [CrossRef]
- Cummings, B.S.; Schnellmann, R.G. Measurement of Cell Death in Mammalian Cells. Curr. Protoc. Pharmacol. 2004, 25, 12.8.1–12.8.22. [Google Scholar]
- Ribble, D.; Goldstein, N.B.; Norris, D.A.; Shellman, Y.G. A simple technique for quantifying apoptosis in 96-well plates. BMC Biotechnol. 2005, 5, 12. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Liu P cheng Liu, R.; Wu, X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med. Sci. Monit. Basic Res. 2015, 21, 15. [Google Scholar] [CrossRef]
- Kasibhatla, S.; Amarante-Mendes, G.P.; Finucane, D.; Brunner, T.; Bossy-Wetzel, E.; Green, D.R. Acridine Orange/Ethidium Bromide (AO/EB) Staining to Detect Apoptosis. Cold Spring Harb. Protoc. 2006, 2006, pdb-prot4493. [Google Scholar] [CrossRef]
- Kema, V.H.; Khan, I.; Jamal, R.; Vishwakarma, S.K.; Lakki Reddy, C.; Parwani, K.; Patel, F.; Patel, D.; Khan, A.A.; Mandal, P. Protective Effects of Diallyl Sulfide against Ethanol-Induced Injury in Rat Adipose Tissue and Primary Human Adipocytes. Alcohol Clin. Exp. Res. 2017, 41, 1078–1092. [Google Scholar] [CrossRef]
- Patel, F.; Parwani, K.; Patel, D.; Mandal, P. Metformin and Probiotics Interplay in Amelioration of Ethanol-Induced Oxidative Stress and Inflammatory Response in an in Vitro and in Vivo Model of Hepatic Injury. Mediat. Inflamm. 2021, 2021, 6636152. [Google Scholar] [CrossRef] [PubMed]
- Karbowski, M.; Kurono, C.; Wozniak, M.; Ostrowski, M.; Teranishi, M.; Nishizawa, Y.; Usukura, J.; Soji, T.; Wakabayashi, T. Free radical-induced megamitochondria formation and apoptosis. Free. Radic. Biol. Med. 1999, 26, 396–409. [Google Scholar] [CrossRef] [PubMed]
- Emiru, T.F.; Ayele, D.W. Controlled synthesis, characterization and reduction of graphene oxide: A convenient method for large scale production. Egypt. J. Basic Appl. Sci. 2017, 4, 74–79. [Google Scholar] [CrossRef]
- Surekha, G.; Krishnaiah, K.V.; Ravi, N.; Padma Suvarna, R. FTIR, Raman and XRD analysis of graphene oxide films prepared by modified Hummers method. J. Phys. Conf. Ser. 2020, 1495, 12012. [Google Scholar] [CrossRef]
- Khalili, D. Graphene oxide: A promising carbocatalyst for the regioselective thiocyanation of aromatic amines, phenols, anisols and enolizable ketones by hydrogen peroxide/KSCN in water. New J. Chem. 2016, 40, 2547–2553. [Google Scholar] [CrossRef]
- Rhazouani, A.; Gamrani, H.; El Achaby, M.; Aziz, K.; Gebrati, L.; Uddin, M.S.; Aziz, F. Synthesis and Toxicity of Graphene Oxide Nanoparticles: A Literature Review of in Vitro and in Vivo Studies. BioMed Res. Int. 2021, 2021, 5518999. [Google Scholar] [CrossRef] [PubMed]
- Rattana, T.; Chaiyakun, S.; Witit-Anun, N.; Nuntawong, N.; Chindaudom, P.; Oaew, S.; Kedkeaw, C.; Limsuwan, P. Preparation and characterization of graphene oxide nanosheets. Procedia Eng. 2012, 32, 759–764. [Google Scholar] [CrossRef]
- Oh, W.C.; Zhang, F.J. Preparation and characterization of graphene oxide reduced from a mild chemical method. Asian J. Chem. 2011, 23, 875–879. [Google Scholar]
- Rubin, E.; Rottenberg, H. Ethanol-induced injury and adaptation in biological membranes. Fed. Proc. 1982, 41, 2465–2471. [Google Scholar]
- Wang, Q.X.; Ma, X. Liver: A unique immune organ. Zhonghua Gan Zang Bing Za Zhi Zhonghua Ganzangbing Zazhi Chin. J. Hepatol. 2021, 29, 497–499. [Google Scholar]
- Kong, L.Z.; Chandimali, N.; Han, Y.H.; Lee, D.H.; Kim, J.S.; Kim, S.U.; Kim, T.-D.; Jeong, D.K.; Sun, H.-N.; Lee, D.S.; et al. Pathogenesis, early diagnosis, and therapeutic management of alcoholic liver disease. Int. J. Mol. Sci. 2019, 20, 2712. [Google Scholar] [CrossRef]
- Sarkar, D.; Jung, M.K.; Wang, H.J. Alcohol and the immune system. Alcohol Res. Curr. Rev. 2015, 37, 153. [Google Scholar]
- Seitz, H.K.; Bataller, R.; Cortez-Pinto, H.; Gao, B.; Gual, A.; Lackner, C.; Mathurin, P.; Mueller, S.; Szabo, G.; Tsukamoto, H. Alcoholic liver disease. Nat. Rev. Dis. Primers 2018, 4, 16. [Google Scholar] [CrossRef]
- Wu, D.; Cederbaum, A.I. Oxidative stress and alcoholic liver disease. Semin. Liver Dis. 2009, 29, 141–154. [Google Scholar] [CrossRef] [PubMed]
- Moslehi, A.; Hamidi-Zad, Z. Role of SREBPs in liver diseases: A mini-review. J. Clin. Transl. Hepatol. 2018, 6, 332. [Google Scholar] [CrossRef]
- Jung, J.H.; Kim, S.E.; Suk, K.T.; Kim, D.J. Gut microbiota-modulating agents in alcoholic liver disease: Links between host metabolism and gut microbiota. Front. Med. Front. Media 2022, 9, 913842. [Google Scholar] [CrossRef] [PubMed]
- Slevin, E.; Baiocchi, L.; Wu, N.; Ekser, B.; Sato, K.; Lin, E.; Ceci, L.; Chen, L.; Lorenzo, S.R.; Xu, W.; et al. Kupffer Cells: Inflammation Pathways and Cell-Cell Interactions in Alcohol-Associated Liver Disease. Am. J. Pathol. 2020, 190, 2185–2193. [Google Scholar] [CrossRef]
- Milosevic, I.; Vujovic, A.; Barac, A.; Djelic, M.; Korac, M.; Spurnic, A.R.; Gmizic, I.; Stevanovic, O.; Djordjevic, V.; Lekic, N.; et al. Gut-liver axis, gut microbiota, and its modulation in the management of liver diseases: A review of the literature. Int. J. Mol. Sci. 2019, 20, 395. [Google Scholar] [CrossRef]
- Di Mauro, G.; Amoriello, R.; Lozano, N.; Carnasciali, A.; Guasti, D.; Becucci, M.; Cellot, G.; Kostarelos, K.; Ballerini, C.; Ballerini, L. Graphene Oxide Nanosheets Reduce Astrocyte Reactivity to Inflammation and Ameliorate Experimental Autoimmune Encephalomyelitis. ACS Nano 2023, 17, 1965–1978. [Google Scholar] [CrossRef] [PubMed]
- Aliyev, E.; Filiz, V.; Khan, M.M.; Lee, Y.J.; Abetz, C.; Abetz, V. Structural characterization of graphene oxide: Surface functional groups and fractionated oxidative debris. Nanomaterials 2019, 9, 1180. [Google Scholar] [CrossRef]
- Bellier, N.; Baipaywad, P.; Ryu, N.; Lee, J.Y.; Park, H. Recent biomedical advancements in graphene oxide- and reduced graphene oxide-based nanocomposite nanocarriers. Biomater. Res. 2022, 26, 65. [Google Scholar] [CrossRef] [PubMed]
- Kucki, M.; Diener, L.; Bohmer, N.; Hirsch, C.; Krug, H.F.; Palermo, V.; Wick, P. Uptake of label-free graphene oxide by Caco-2 cells is dependent on the cell differentiation status. J. Nanobiotechnol. 2017, 15, 46. [Google Scholar] [CrossRef] [PubMed]
- Qi, W.; Xue, Z.; Yuan, W.; Wang, H. Layer-by-layer assembled graphene oxide composite films for enhanced mechanical properties and fibroblast cell affinity. J. Mater. Chem. B 2014, 2, 325–331. [Google Scholar] [CrossRef] [PubMed]
- Cebadero-Domínguez, O.; Ferrández-Gómez, B.; Sánchez-Ballester, S.; Moreno, J.; Jos, A.; Cameán, A.M. In vitro toxicity evaluation of graphene oxide and reduced graphene oxide on Caco-2 cells. Toxicol. Rep. 2022, 9, 1130–1138. [Google Scholar] [CrossRef]
- Ruiz, O.N.; Fernando, K.A.S.; Wang, B.; Brown, N.A.; Luo, P.G.; McNamara, N.D.; Vangsness, M.; Sun, Y.-P.; Bunker, K.E. Graphene oxide: A nonspecific enhancer of cellular growth. ACS Nano 2011, 5, 8100–8107. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.; Wang, Z.; Owens, A.C.E.; Kulaots, I.; Chen, Y.; Kane, A.B.; Hurt, R.H. Antioxidant chemistry of graphene-based materials and its role in oxidation protection technology. Nanoscale 2014, 6, 11744–11755. [Google Scholar] [CrossRef] [PubMed]
- Patlolla, A.K.; Randolph, J.; Kumari, S.A.; Tchounwou, P.B. Toxicity evaluation of graphene oxidein kidneys of sprague-dawley rats. Int. J. Environ. Res. Public Health 2016, 13, 380. [Google Scholar] [CrossRef]
- Han, J.; Kim, Y.S.; Lim, M.Y.; Kim, H.Y.; Kong, S.; Kang, M.; Choo, Y.W.; Jun, J.H.; Ryu, S.; Jeong, H.-Y. Dual Roles of Graphene Oxide to Attenuate Inflammation and Elicit Timely Polarization of Macrophage Phenotypes for Cardiac Repair. ACS Nano 2018, 12, 1959–1977. [Google Scholar] [CrossRef]
- Marković, Z.M.; Jovanović, S.P.; Mašković, P.Z.; Mojsin, M.M.; Stevanović, M.J.; Danko, M.; Mičušík, M.; Jovanović, D.J.; Kleinová, A.; Špitalský, Z.; et al. Graphene oxide size and structure pro-oxidant and antioxidant activity and photoinduced cytotoxicity relation on three cancer cell lines. J. Photochem. Photobiol. B 2019, 200, 111647. [Google Scholar] [CrossRef]
- De Frutos, S.; Griera, M.; del Prado Lavín-López, M.; Martínez-Rovira, M.; Martínez-Rovira, J.A.; Rodríguez-Puyol, M.; Rodríguez-Puyol, D. A new graphene-based nanomaterial increases lipolysis and reduces body weight gain through integrin linked kinase (ILK). Biomater. Sci. 2023, 11, 4916–4929. [Google Scholar] [CrossRef]
- Liu, J.; Zhao, W.; Song, F.; Huang, C.; Zhang, Z.; Cao, Y. Graphene oxide exposure suppresses immune responses and increases the sensitivities of zebrafishes to lipopolysaccharides via the down-regulation of Toll-like receptors. Ecol. Indic. 2022, 144, 109563. [Google Scholar] [CrossRef]
- Zhang, Y.; Yan, T.; Wang, T.; Liu, X.; Hamada, K.; Sun, D.; Sun, Y.; Yang, Y.; Wang, J.; Takahashi, S.; et al. Crosstalk between CYP2E1 and PPARα substrates and agonists modulate adipose browning and obesity. Acta Pharm. Sin. B 2022, 12, 2224–2238. [Google Scholar] [CrossRef] [PubMed]
- Thomes, P.G.; Osna, N.A.; Davis, J.S.; Donohue, T.M. Cellular steatosis in ethanol oxidizing-HepG2 cells is partially controlled by the transcription factor, early growth response-1. Int. J. Biochem. Cell Biol. 2013, 45, 454–463. [Google Scholar] [CrossRef]
- Castagnola, V.; Deleye, L.; Podestà, A.; Jaho, E.; Loiacono, F.; Debellis, D.; Trevisani, M.; Ciobanu, D.S.; Armirotti, A.; Pisani, F.; et al. Interactions of Graphene Oxide and Few-Layer Graphene with the Blood-Brain Barrier. Nano Lett. 2023, 23, 2981–2990. [Google Scholar] [CrossRef] [PubMed]







| Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| 18S | GATGGTAGTCGCCGTGCC | GCCTGCTGCCTTCCTTGG |
| CYP2E1 | AACTGTCCCCGGGACCTC | GCGCTCTGCACTGTGCTTT |
| EGR1 | AGCCCTACGAGCACCTGAC | GGGCAGTCGAGTGGTTTG |
| SREBP2 | CTCCATTGACTCTGAGCCAGGA | GAATCCGTGAGCGGTCTACCAT |
| Il6 | CATCCTCGACGGCATCTCAG | GCAGAAGAGAGCCAACCAAC |
| TNF | CTCTTCTGCCTGCTGCACTTG | ATGGGCTACAGCTTGTCACTC |
| Il10 | ACTGCTAACCGACTCCTTA | TAAGGAGTCGGTTAGCAGT |
| AMPK | AGGAAGAATCCTGTGACAAGCAC | CCGATCTCTGTGGAGTAGCAGT |
| NrF2 | GAGAGCCCAGTCTTCATTGC | TGCTCAATGTCCTGTTGCAT |
| HO1 | AAGCCGAGAATGCTGAGTTCA | CGGGTGTAGATATGGTACAAGGA |
| Occludin | CTCGAGAAAGTGCTGAGTGCCTGGAC | AAGCTTTCGGTGACCAATTCACCTGA |
| ZO-1 | TATTATGGCACATCAGCACG | TGGGCAAACAGACCAAGC |
| PPAR γ | GGCTTCATGACAAGGGAGTTTC | AACTCAAACTTGGGCTCCATAAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aghara, H.; Chadha, P.; Mandal, P. Mitigative Effect of Graphene Oxide Nanoparticles in Maintaining Gut–Liver Homeostasis against Alcohol Injury. Gastroenterol. Insights 2024, 15, 574-587. https://doi.org/10.3390/gastroent15030042
Aghara H, Chadha P, Mandal P. Mitigative Effect of Graphene Oxide Nanoparticles in Maintaining Gut–Liver Homeostasis against Alcohol Injury. Gastroenterology Insights. 2024; 15(3):574-587. https://doi.org/10.3390/gastroent15030042
Chicago/Turabian StyleAghara, Hiral, Prashsti Chadha, and Palash Mandal. 2024. "Mitigative Effect of Graphene Oxide Nanoparticles in Maintaining Gut–Liver Homeostasis against Alcohol Injury" Gastroenterology Insights 15, no. 3: 574-587. https://doi.org/10.3390/gastroent15030042
APA StyleAghara, H., Chadha, P., & Mandal, P. (2024). Mitigative Effect of Graphene Oxide Nanoparticles in Maintaining Gut–Liver Homeostasis against Alcohol Injury. Gastroenterology Insights, 15(3), 574-587. https://doi.org/10.3390/gastroent15030042

