Novel Artificial 5′UTR Increase Modified mRNA Translation When Injected into Mouse Heart
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of 5′UTR Sequences: Top Heart, Top CMs, and Top Elevated Heart
2.2. Mathematical Method for Consensus Sequence Calculation
- Sequence set definition: Let S = {s1, s2, …, sN} represent the set of RNA sequences, where N is the total number of sequences analyzed. Each sequence sN is defined as sN = (b1, b2, …, bM), where bj ∈ (18T) represents the nucleotide at position j, and L is the sequence length (e.g., 40 base pairs).
- Frequency matrix calculation: For each position i ∈ {1, 2, …, M}, the frequency fi(b) of each nucleotide b ∈ {A, C, G, T} was computed aswhere Count of nucleotide b at position j is the total number of sequences containing nucleotide b at position j, and N is the total number of sequences. The resulting frequency matrix is normalized such that
- Consensus sequence derivation: The consensus nucleotide at each position was determined by selecting the nucleotide with the highest frequency:where arg max identifies the nucleotide bj that maximizes fi(b). If two or more nucleotides had the same maximum frequency, one of them was chosen arbitrarily.
- Handling missing or ambiguous data: If no nucleotide was observed at a given position j (i.e., fi(b) = 0 for all b ∈{A, C, G, T}), the position was marked with an ambiguous nucleotide symbol N.
- Final consensus sequence: The consensus sequence C = (b1*, b2*,…, bL*) was constructed by concatenating the consensus nucleotide bj* for all positions i.
2.3. Construction of DNA Templates and Synthesis of Synthetic mRNA
2.4. Neonatal Mouse Cardiomyocyte Isolation
2.5. Differentiation of Human Induced Pluripotent Stem Cells (hiPSCs)
2.6. FACS Analysis for nGFP Expression
2.7. Bioluminescence Imaging In Vivo
2.8. Comparison of Free Energy Secondary Structures
2.9. Statistical Analysis
3. Results
3.1. Evaluation of 5′UTR Translation Efficiency in Neonatal Mouse Cardiomyocytes
3.2. In Vivo Evaluation of modRNA Translation Efficiency
3.3. Analysis of Sequence Differences and Functional Implications
3.4. Evaluation in Human iPSC-Derived Cardiomyocytes
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mouilleron, H.; Delcourt, V.; Roucou, X. Death of a dogma: Eukaryotic mRNAs can code for more than one protein. Nucleic Acids Res. 2016, 44, 14–23. [Google Scholar] [CrossRef] [Scilit]
- van der Velden, A.W.; Thomas, A.A. The role of the 5′ untranslated region of an mRNA in translation regulation during development. Int. J. Biochem. Cell Biol. 1999, 31, 87–106. [Google Scholar]
- Leppek, K.; Das, R.; Barna, M. Functional 5′ UTR mRNA structures in eukaryotic translation regulation and how to find them. Nat. Rev. Mol. Cell Biol. 2018, 19, 158–174. [Google Scholar] [PubMed]
- Petibon, C.; Ghulam, M.M.; Catala, M.; Elela, S.A. Regulation of ribosomal protein genes: An ordered anarchy. Wiley Interdiscip. Rev. RNA 2021, 12, e1632. [Google Scholar] [CrossRef] [Scilit]
- Karikó, K.; Buckstein, M.; Ni, H.; Weissman, D. Suppression of RNA recognition by Toll-like receptors: The impact of nucleoside modification and the evolutionary origin of RNA. Immunity 2005, 23, 165–175. [Google Scholar] [CrossRef] [Scilit]
- Karikó, K.; Muramatsu, H.; Welsh, F.A.; Ludwig, J.; Kato, H.; Akira, S.; Weissman, D. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol. Ther. 2008, 16, 1833–1840. [Google Scholar] [CrossRef] [Scilit]
- Pilishvili, T.; Gierke, R.; Fleming-Dutra, K.E.; Farrar, J.L.; Mohr, N.M.; Talan, D.A.; Krishnadasan, A.; Harland, K.K.; Smithline, H.A.; Hou, P.C.; et al. Effectiveness of mRNA Covid-19 Vaccine among U.S. Health Care Personnel. N. Engl. J. Med. 2021, 385, e90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El Sahly, H.M.; Baden, L.R.; Essink, B.; Doblecki-Lewis, S.; Martin, J.M.; Anderson, E.J.; Campbell, T.B.; Clark, J.; Jackson, L.A.; Fichtenbaum, C.J.; et al. Efficacy of the mRNA-1273 SARS-CoV-2 Vaccine at Completion of Blinded Phase. N. Engl. J. Med. 2021, 385, 1774–1785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magadum, A.; Kurian, A.A.; Chepurko, E.; Sassi, Y.; Hajjar, R.J.; Zangi, L. Specific Modified mRNA Translation System. Circulation 2020, 142, 2485–2488. [Google Scholar] [CrossRef] [Scilit]
- Labonia, M.; Senti, M.E.; van der Kraak, P.; Brans, M.; Dokter, I.; Streef, T.; Smits, A.; Deshantri, A.; de Jager, S.; Schiffelers, R.; et al. Cardiac delivery of modified mRNA using lipid nanoparticles: Cellular targets and biodistribution after intramyocardial administration. J. Control. Release 2024, 369, 734–745. [Google Scholar] [CrossRef] [Scilit]
- Ascanelli, C.; Dahir, R.; Wilson, C.H. Manipulating Myc for reparative regeneration. Front. Cell Dev. Biol. 2024, 12, 1357589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, A.Y.L.; Chang, Y.-C.; Chen, K.-H.; Loh, C.Y.Y. Potential Application of Modified mRNA in Cardiac Regeneration. Cell Transplant. 2024, 33, 9636897241248956. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Shen, S.; Xu, H.; Cai, S.; Yuan, X.; Wang, C.; Zhang, X.; Chen, S.; Chen, J.; Shi, D.-L.; et al. IGF2BP3 promotes adult myocardial regeneration by stabilizing MMP3 mRNA through interaction with m6A modification. Cell Death Discov. 2023, 9, 164. [Google Scholar] [CrossRef] [Scilit]
- Warren, L.; Manos, P.D.; Ahfeldt, T.; Loh, Y.-H.; Li, H.; Lau, F.; Ebina, W.; Mandal, P.K.; Smith, Z.D.; Meissner, A.; et al. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 2010, 7, 618–630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Cesare, M.; Perel, P.; Taylor, S.; Kabudula, C.; Bixby, H.; Gaziano, T.A.; McGhie, D.V.; Mwangi, J.; Pervan, B.; Narula, J.; et al. The Heart of the World. Glob. Heart 2024, 19, 11. [Google Scholar] [CrossRef] [Scilit]
- Magadum, A.; Kaur, K.; Zangi, L. mRNA-Based Protein Replacement Therapy for the Heart. Mol. Ther. 2019, 27, 785–793. [Google Scholar] [CrossRef] [Scilit]
- Sultana, N.; Hadas, Y.; Sharkar, M.T.K.; Kaur, K.; Magadum, A.; Kurian, A.A.; Hossain, N.; Alburquerque, B.; Ahmed, S.; Chepurko, E.; et al. Optimization of 5′ Untranslated Region of Modified mRNA for Use in Cardiac or Hepatic Ischemic Injury. Mol. Ther.—Methods Clin. Dev. 2020, 17, 622–633. [Google Scholar] [CrossRef] [Scilit]
- Hinnebusch, A.G.; Ivanov, I.P.; Sonenberg, N. Translational control by 5′-untranslated regions of eukaryotic mRNAs. Science 2016, 352, 1413–1416. [Google Scholar] [CrossRef] [Scilit]
- Ma, Q.; Zhang, X.; Yang, J.; Li, H.; Hao, Y.; Feng, X. Optimization of the 5ʹ untranslated region of mRNA vaccines. Sci. Rep. 2024, 14, 19845. [Google Scholar] [CrossRef] [Scilit]
- Anttila, V.; Saraste, A.; Knuuti, J.; Hedman, M.; Jaakkola, P.; Laugwitz, K.-L.; Krane, M.; Jeppsson, A.; Sillanmäki, S.; Rosenmeier, J.; et al. Direct intramyocardial injection of VEGF mRNA in patients undergoing coronary artery bypass grafting. Mol. Ther. 2023, 31, 866–874. [Google Scholar] [CrossRef] [Scilit]
- Asrani, K.H.; Farelli, J.D.; Stahley, M.R.; Miller, R.L.; Cheng, C.J.; Subramanian, R.R.; Brown, J.M. Optimization of mRNA untranslated regions for improved expression of therapeutic mRNA. RNA Biol. 2018, 15, 756–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castillo-Hair, S.; Fedak, S.; Wang, B.; Linder, J.; Havens, K.; Certo, M.; Seelig, G. Optimizing 5′UTRs for mRNA-delivered gene editing using deep learning. Nat. Commun. 2024, 15, 5284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trepotec, Z.; Aneja, M.K.; Geiger, J.; Hasenpusch, G.; Plank, C.; Rudolph, C. Maximizing the Translational Yield of mRNA Therapeutics by Minimizing 5′-UTRs. Tissue Eng. Part A 2019, 25, 69–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haimov, O.; Sinvani, H.; Dikstein, R. Cap-dependent, scanning-free translation initiation mechanisms. Biochim. Biophys. Acta (BBA)—Gene Regul. Mech. 2015, 1849, 1313–1318. [Google Scholar] [CrossRef] [Scilit]
- Chu, Y.; Yu, D.; Li, Y.; Huang, K.; Shen, Y.; Cong, L.; Zhang, J.; Wang, M. A 5′ UTR Language Model for Decoding Untranslated Regions of mRNA and Function Predictions. Nat. Mach. Intell. 2024, 6, 449–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, J.; Novoa, E.M.; Zhang, Z.; Chen, W.C.W.; Liu, D.; Choi, G.C.G.; Wong, A.S.L.; Wehrspaun, C.; Kellis, M.; Lu, T.K. High-throughput 5′ UTR engineering for enhanced protein production in non-viral gene therapies. Nat. Commun. 2021, 12, 4138. [Google Scholar] [CrossRef] [Scilit]
- Sample, P.J.; Wang, B.; Reid, D.W.; Presnyak, V.; McFadyen, I.J.; Morris, D.R.; Seelig, G. Human 5′ UTR design and variant effect prediction from a massively parallel translation assay. Nat. Biotechnol. 2019, 37, 803–809. [Google Scholar] [CrossRef] [Scilit]
- Wang, K.; Lee, P.; Mirams, G.R.; Sarathchandra, P.; Borg, T.K.; Gavaghan, D.J.; Kohl, P.; Bollensdorff, C. Cardiac tissue slices: Preparation, handling, and successful optical mapping. Am. J. Physiol. Heart Circ. Physiol. 2015, 308, H1112–H1125. [Google Scholar]
- Wiechert, S.; El-Armouche, A.; Rau, T.; Zimmermann, W.-H.; Eschenhagen, T. 24-h Langendorff-perfused neonatal rat heart used to study the impact of adenoviral gene transfer. Am. J. Physiol. Circ. Physiol. 2003, 285, H907–H914. [Google Scholar] [CrossRef] [Scilit]





| Top 1000 genes sorted by total expression in heart (n = 1000) | ||||||||||||||||||||||||||||||||||||||||
| Base/Pos | −40 | −39 | −38 | −37 | −36 | −35 | −34 | −33 | −32 | −31 | −30 | −29 | −28 | −27 | −26 | −25 | −24 | −23 | −22 | −21 | −20 | −19 | −18 | −17 | −16 | −15 | −14 | −13 | −12 | −11 | −10 | −9 | −8 | −7 | −6 | −5 | −4 | −3 | −2 | −1 |
| A | 16 | 16 | 14 | 14 | 17 | 15 | 16 | 16 | 16 | 15 | 16 | 18 | 15 | 15 | 14 | 15 | 14 | 17 | 15 | 17 | 18 | 17 | 16 | 17 | 20 | 17 | 19 | 19 | 17 | 21 | 24 | 21 | 16 | 19 | 17 | 12 | 21 | 52 | 28 | 15 |
| T | 19 | 21 | 20 | 20 | 21 | 22 | 21 | 21 | 19 | 18 | 17 | 19 | 18 | 19 | 18 | 17 | 18 | 19 | 17 | 19 | 17 | 18 | 17 | 17 | 18 | 18 | 15 | 18 | 17 | 16 | 17 | 14 | 16 | 15 | 15 | 19 | 7 | 3 | 10 | 5 |
| G | 29 | 29 | 31 | 29 | 28 | 28 | 27 | 30 | 31 | 31 | 35 | 31 | 31 | 32 | 34 | 32 | 34 | 32 | 30 | 34 | 30 | 29 | 33 | 27 | 26 | 33 | 31 | 29 | 30 | 25 | 24 | 39 | 28 | 25 | 45 | 27 | 18 | 41 | 16 | 25 |
| C | 36 | 34 | 35 | 37 | 35 | 34 | 36 | 32 | 34 | 35 | 32 | 32 | 35 | 34 | 35 | 35 | 33 | 32 | 38 | 30 | 34 | 36 | 34 | 38 | 37 | 32 | 35 | 34 | 35 | 38 | 35 | 25 | 40 | 41 | 23 | 42 | 54 | 5 | 47 | 54 |
| tot | C | C | C | C | C | C | C | C | C | C | G | C | C | C | C | C | G | G | C | G | C | C | C | C | C | G | C | C | C | C | C | G | C | C | G | C | C | A | C | C |
| Top 1000 genes sorted by total expression in cardiomyocytes (n = 1000) | ||||||||||||||||||||||||||||||||||||||||
| A | 19 | 17 | 17 | 17 | 16 | 16 | 16 | 16 | 16 | 16 | 17 | 18 | 15 | 18 | 16 | 18 | 17 | 19 | 17 | 18 | 21 | 18 | 16 | 19 | 18 | 17 | 19 | 19 | 19 | 22 | 22 | 21 | 18 | 21 | 19 | 17 | 23 | 51 | 31 | 17 |
| T | 20 | 20 | 21 | 20 | 22 | 23 | 23 | 21 | 20 | 20 | 20 | 21 | 21 | 20 | 20 | 20 | 19 | 20 | 16 | 19 | 18 | 18 | 18 | 19 | 18 | 19 | 16 | 19 | 19 | 17 | 17 | 18 | 16 | 18 | 14 | 17 | 9 | 3 | 11 | 6 |
| G | 30 | 30 | 30 | 30 | 28 | 28 | 27 | 33 | 33 | 32 | 32 | 31 | 32 | 31 | 34 | 29 | 34 | 32 | 32 | 34 | 31 | 32 | 33 | 28 | 28 | 31 | 33 | 28 | 31 | 25 | 27 | 38 | 29 | 26 | 48 | 27 | 21 | 41 | 16 | 26 |
| C | 32 | 32 | 31 | 33 | 35 | 33 | 34 | 30 | 31 | 32 | 32 | 30 | 32 | 32 | 30 | 34 | 30 | 29 | 35 | 29 | 30 | 31 | 32 | 35 | 35 | 33 | 32 | 33 | 31 | 35 | 34 | 23 | 37 | 36 | 19 | 39 | 46 | 5 | 42 | 50 |
| tot | C | C | C | C | C | C | C | G | G | C | G | G | C | C | G | C | G | G | C | G | G | G | G | C | C | C | G | C | C | C | C | G | C | C | G | C | C | A | C | C |
| Elevated genes in heart (n = 348) | ||||||||||||||||||||||||||||||||||||||||
| A | 16 | 18 | 18 | 18 | 20 | 18 | 18 | 21 | 19 | 19 | 22 | 16 | 17 | 17 | 20 | 18 | 19 | 18 | 18 | 18 | 22 | 19 | 15 | 22 | 20 | 20 | 15 | 14 | 18 | 23 | 19 | 22 | 21 | 20 | 19 | 19 | 20 | 49 | 28 | 17 |
| T | 18 | 18 | 21 | 19 | 20 | 20 | 21 | 20 | 20 | 18 | 22 | 22 | 20 | 16 | 22 | 18 | 19 | 18 | 16 | 18 | 16 | 19 | 17 | 17 | 17 | 18 | 20 | 22 | 16 | 19 | 14 | 18 | 18 | 20 | 15 | 15 | 12 | 6 | 11 | 6 |
| G | 30 | 30 | 32 | 31 | 26 | 31 | 29 | 27 | 31 | 28 | 31 | 32 | 29 | 31 | 29 | 32 | 35 | 32 | 30 | 31 | 26 | 32 | 36 | 28 | 28 | 31 | 36 | 31 | 32 | 26 | 28 | 36 | 29 | 26 | 42 | 28 | 22 | 38 | 20 | 26 |
| 20 | 36 | 34 | 29 | 33 | 35 | 31 | 32 | 32 | 29 | 34 | 25 | 30 | 35 | 37 | 30 | 32 | 27 | 32 | 36 | 33 | 35 | 30 | 31 | 33 | 46 | 31 | 29 | 34 | 35 | 32 | 38 | 24 | 32 | 34 | 25 | 38 | 45 | 7 | 40 | 51 |
| tot | C | C | G | C | C | C | C | C | G | C | G | G | C | C | C | C | G | G | C | C | C | G | G | C | C | G | G | C | C | C | C | G | C | C | G | C | C | A | C | C |
| Top 1000 Genes Sorted by Total Expression in Heart (n = 1000) | ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Base/Pos | −40 | −39 | −38 | −37 | −36 | −35 | −34 | −33 | −32 | −31 | −30 | −29 | −28 | −27 | −26 | −25 | −24 | −23 | −22 | −21 | −20 | −19 | −18 | −17 | −16 | −15 | −14 | −13 | −12 | −11 | −10 | −9 | −8 | −7 | −6 | −5 | −4 | −3 | −2 | −1 |
| The best 5′UTR | C | C | C | C | C | C | C | C | C | C | G | C | G | C | C | C | G | G | C | G | C | C | C | C | C | G | C | C | C | C | C | G | C | C | G | C | C | A | C | C |
| The worse 5′UTR | C | C | C | C | C | C | C | G | G | C | G | G | C | C | G | C | G | G | C | G | G | G | G | C | C | C | G | C | C | C | C | G | C | C | G | C | C | A | C | C |
| 1. 5′UTRcontrol: AAATAAGAGAGAAAATAAGAGTAAGAAGAAATATAAGAGCCACC |
| 2. 5′UTR Top Heart: CCCCCCCCCCGCCCCCGGCGCCCCCGCCCCCGCCGCCACC |
| 3. 5′UTR Top CMs: CCCCCCCGGCGGCCGCGGCGGGGCCCGCCCCGCCGCCACC |
| 4. 5′UTR Top Elevated Heart: CCGCCCCCGCGGCCCCGGCCCGGCCGGCCCCGCCGCCACC |
| 5. 5′UTR Top Heart A 50%: CCCCCCCCCCGCCCCCGGCGGGGCCCGCCCCGCCGCCACC |
| 6. 5′UTR Top Heart B 50%: CCCCCCCGGCGGCCGCGGCGCCCCCGCCCCCGCCGCCACC |
| Luc ORF | atggccgatgctaagaacattaagaagggccctgctcccttctaccctctggaggatggcac cgctggcgagcagctgcacaaggccatgaagaggtatgccctggtgcctggcaccattgcct tcaccgatgcccacattgaggtggacatcacctatgccgagtacttcgagatgtctgtgcgc ctggccgaggccatgaagaggtacggcctgaacaccaaccaccgcatcgtggtgtgctctga gaactctctgcagttcttcatgccagtgctgggcgccctgttcatcggagtggccgtggccc ctgctaacgacatttacaacgagcgcgagctgctgaacagcatgggcatttctcagcctacc gtggtgttcgtgtctaagaagggcctgcagaagatcctgaacgtgcagaagaagctgcctat catccagaagatcatcatcatggactctaagaccgactaccagggcttccagagcatgtaca cattcgtgacatctcatctgcctcctggcttcaacgagtacgacttcgtgccagagtctttc gacagggacaaaaccattgccctgatcatgaacagctctgggtctaccggcctgcctaaggg cgtggccctgcctcatcgcaccgcctgtgtgcgcttctctcacgcccgcgaccctattttcg gcaaccagatcatccccgacaccgctattctgagcgtggtgccattccaccacggcttcggc atgttcaccaccctgggctacctgatttgcggctttcgggtggtgctgatgtaccgcttcga ggaggagctgttcctgcgcagcctgcaagactacaaaattcagtctgccctgctggtgccaa ccctgttcagcttcttcgctaagagcaccctgatcgacaagtacgacctgtctaacctgcac gagattgcctctggcggcgccccactgtctaaggaggtgggcgaagccgtggccaagcgctt tcatctgccaggcatccgccagggctacggcctgaccgagacaaccagcgccattctgatta ccccagagggcgacgacaagcctggcgccgtgggcaaggtggtgccattcttcgaggccaag gtggtggacctggacaccggcaagaccctgggagtgaaccagcgcggcgagctgtgtgtgcg cggccctatgattatgtccggctacgtgaataaccctgaggccacaaacgccctgatcgaca aggacggctggctgcactctggcgacattgcctactgggacgaggacgagcacttcttcatc gtggaccgcctgaagtctctgatcaagtacaagggctaccaggtggccccagccgagctgga gtctatcctgctgcagcaccctaacattttcgacgccggagtggccggcctgcccgacgacg atgccggcgagctgcctgccgccgtcgtcgtgctggaacacggcaagaccatgaccgagaag gagatcgtggactatgtggccagccaggtgacaaccgccaagaagctgcgcggcggagtggt gttcgtggacgaggtgcccaagggcctgaccggcaagctggacgcccgcaagatccgcgaga tcctgatcaaggctaagaaaggcggcaagatcgccgtgtaa |
| nGFP ORF | atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacgg cgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggca agctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacga cttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacg acggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaa ctacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaact tcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaac acccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgc cctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccg ccgggatcactctcggcatggacgagctgtacaagggagatccaaaaaagaagagaaaggta ggcgatccaaaaaagaagagaaaggtaggtgatccaaaaaagaagagaaaggtataa |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kurian, A.A.; Ghiringhelli, M.; Shalom, E.; Mainkar, G.; Żak, M.M.; Adjmi, M.; Downey, J.; Yoon, S.; Dubois, N.; Swirski, F.K.; et al. Novel Artificial 5′UTR Increase Modified mRNA Translation When Injected into Mouse Heart. Pharmaceutics 2025, 17, 490. https://doi.org/10.3390/pharmaceutics17040490
Kurian AA, Ghiringhelli M, Shalom E, Mainkar G, Żak MM, Adjmi M, Downey J, Yoon S, Dubois N, Swirski FK, et al. Novel Artificial 5′UTR Increase Modified mRNA Translation When Injected into Mouse Heart. Pharmaceutics. 2025; 17(4):490. https://doi.org/10.3390/pharmaceutics17040490
Chicago/Turabian StyleKurian, Ann Anu, Matteo Ghiringhelli, Eyal Shalom, Gayatri Mainkar, Magdalena M. Żak, Matthew Adjmi, Jeffrey Downey, Seonghun Yoon, Nicole Dubois, Filip K. Swirski, and et al. 2025. "Novel Artificial 5′UTR Increase Modified mRNA Translation When Injected into Mouse Heart" Pharmaceutics 17, no. 4: 490. https://doi.org/10.3390/pharmaceutics17040490
APA StyleKurian, A. A., Ghiringhelli, M., Shalom, E., Mainkar, G., Żak, M. M., Adjmi, M., Downey, J., Yoon, S., Dubois, N., Swirski, F. K., & Zangi, L. (2025). Novel Artificial 5′UTR Increase Modified mRNA Translation When Injected into Mouse Heart. Pharmaceutics, 17(4), 490. https://doi.org/10.3390/pharmaceutics17040490

