Pigeon RIG-I Function in Innate Immunity against H9N2 IAV and IBDV
Abstract
:1. Introduction
2. Materials and Methods
2.1. Identification and Cloning of Pigeon RIG-I
2.2. Plasmids
Name | Direction | Sequence (5′–3′) |
---|---|---|
ppCARDs-EGFP | Foward | ATTCTGCAGTCGACGGTACATGACCGCGGAGGAGAAGA |
Reverse | CGACCGGTGGATCCCGGGCGAAATGGTGTTCACAAATCAG | |
ppRIG-I-EGFP | Foward | ATTCTGCAGTCGACGGTACATGACCGCGGAGGAGAAGA |
Reverse | CGACCGGTGGATCCCGGGCGCTGGATGTTTCTTCATCATCA | |
phMAVS-flag | Foward | CGACGATAAGAGCCCGATGCCGTTTGCTGAAGACAAGACCT |
Reverse | ATTCCTGCAGAAGCTTCTAGTGCAGACGCCGCCGGTAC | |
pcMAVS-flag | Foward | CGACGATAAGAGCCCGATGGGTTTCGCCGAGGAC |
Reverse | ATTCCTGCAGAAGCTTCTATTTCTGCAATCGTGTGTACACC | |
ppCARDs-flag | Foward | CGACGATAAGAGCCCGATGACCGCGGAGGAGAAGA |
Reverse | ATTCCTGCAGAAGCTTCTAATGGTGTTCGCAAATCAG |
2.3. Viruses
2.4. Cell Culture, Infections, and Transfections
2.5. Small Interfering RNA Design and Transfection
Name | SiRNA Sequence (5′–3′) |
---|---|
MDA-siRNA1 | GCUGCAAGCCAACCAGUAUTT |
MDA-siRNA2 | GCAUUUACGAAAGGAGUUUTT |
MDA-siRNA3 | GCAGAACACUUGAAGAAAUTT |
MAVS-siRNA1 | GCUGUGAGCUCGGAUGUUUTT |
MAVS-siRNA2 | GCCAAACUCUGCUGCAGAATT |
MAVS-siRNA3 | GGAUCUGAGCAGGUCUCUUTT |
CTR-siRNA | UUCUCCGAACGUGUCACGUTT |
2.6. Confocal Microscopy
2.7. Western Blotting
2.8. Quantitative Real-Time PCR
2.10. Cytotoxicity Assays
2.11. Statistical Analysis
3. Results
3.1. Cloning and Analysis of Pigeon RIG-I Gene
3.2. Overexpression and Cellular Localization of Pigeon RIG-I in Chicken DF-1 Cells and Human 293T Cells
3.4. Pigeon CARDs and RIG-I Transfection Reduced IBDV and Influenza Virus Replication in Chicken DF-1 Cells
4. Discussion
Supplementary Files
Supplementary File 1Acknowledgments
Author Contributions
Conflicts of Interest
References
- Guo, Y.J.; Krauss, S.; Senne, D.A.; Mo, I.P.; Lo, K.S.; Xiong, X.P.; Norwood, M.; Shortridge, K.F.; Webster, R.G.; Guan, Y. Characterization of the pathogenicity of members of the newly established H9N2 influenza virus lineages in Asia. Virology 2000, 267, 279–288. [Google Scholar] [CrossRef] [PubMed]
- Pu, J.; Wang, S.; Yin, Y.; Zhang, G.; Carter, R.A.; Wang, J.; Xu, G.; Sun, H.; Wang, M.; Wen, C.; et al. Evolution of the H9N2 influenza genotype that facilitated the genesis of the novel H7N9 virus. Proc. Natl. Acad. Sci. USA 2015, 112, 548–553. [Google Scholar] [CrossRef] [PubMed]
- Mundt, E.; Köllner, B.; Kretzschmar, D. VP5 of infectious bursal disease virus is not essential for viral replication in cell culture. J. Virol. 1997, 71, 5647–5651. [Google Scholar] [PubMed]
- Barber, M.R.; Aldridge, J.R.; Webster, R.G.; Magor, K.E. Association of RIG-I with innate immunity of ducks to influenza. Proc. Natl. Acad. Sci. USA 2010, 107, 5913–5918. [Google Scholar] [CrossRef] [PubMed]
- Yoneyama, M.; Kikuchi, M.; Natsukawa, T.; Shinobu, N.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Akira, S.; Fujita, T. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 2004, 5, 730–737. [Google Scholar] [CrossRef] [PubMed]
- Saito, T.; Hirai, R.; Loo, Y.-M.; Owen, D.; Johnson, C.L.; Sinha, S.C.; Akira, S.; Fujita, T.; Gale, M., Jr. Regulation of innate antiviral defenses through a shared repressor domain in RIG-I and LGP2. Proc. Natl. Acad. Sci. USA 2007, 104, 582–587. [Google Scholar] [CrossRef] [PubMed]
- Pichlmair, A.; Schulz, O.; Tan, C.P.; Näslund, T.I.; Liljeström, P.; Weber, F.; Reis e Sousa, C. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science 2006, 314, 997–1001. [Google Scholar] [CrossRef] [PubMed]
- Gack, M.U.; Shin, Y.C.; Joo, C.-H.; Urano, T.; Liang, C.; Sun, L.; Takeuchi, O.; Akira, S.; Chen, Z.; Inoue, S.; et al. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 2007, 446, 916–920. [Google Scholar] [CrossRef] [PubMed]
- Seth, R.B.; Sun, L.; Ea, C.-K.; Chen, Z.J. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-κB and IRF3. Cell 2005, 122, 669–682. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Takahashi, K.; Sato, S.; Coban, C.; Kumar, H.; Kato, H.; Ishii, K.J.; Takeuchi, O.; Akira, S. IPS-1, an adaptor triggering RIG-I-and Mda5-mediated type I interferon induction. Nat. Immunol. 2005, 6, 981–988. [Google Scholar] [CrossRef] [PubMed]
- Meylan, E.; Curran, J.; Hofmann, K.; Moradpour, D.; Binder, M.; Bartenschlager, R.; Tschopp, J. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 2005, 437, 1167–1172. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.-G.; Wang, Y.-Y.; Han, K.-J.; Li, L.-Y.; Zhai, Z.; Shu, H.B. VISA is an adapter protein required for virus-triggered IFN-β signaling. Mol. Cell 2005, 19, 727–740. [Google Scholar] [CrossRef] [PubMed]
- McWhirter, S.M.; Fitzgerald, K.A.; Rosains, J.; Rowe, D.C.; Golenbock, D.T.; Maniatis, T. IFN-regulatory factor 3-dependent gene expression is defective in Tbk1-deficient mouse embryonic fibroblasts. Proc. Natl. Acad. Sci. USA 2004, 101, 233–238. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Grandvaux, N.; Zhou, G.-P.; Lin, R.; Hiscott, J. Triggering the interferon antiviral response through an IKK-related pathway. Science 2003, 300, 1148–1151. [Google Scholar] [CrossRef] [PubMed]
- Honda, K.; Yanai, H.; Negishi, H.; Asagiri, M.; Sato, M.; Mizutani, T.; Shimada, N.; Ohba, Y.; Takaoka, A.; Yoshida, N.; et al. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 2005, 434, 772–777. [Google Scholar] [CrossRef] [PubMed]
- Kato, H.; Takeuchi, O.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Matsui, K.; Uematsu, S.; Jung, A.; Kawai, T.; Ishii, K.J.; et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006, 441, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Ding, N.; Ding, S.S.; Yu, S.; Meng, C.; Chen, H.; Qiu, X.; Zhang, S.; Yu, Y.; Zhan, Y.; et al. Goose RIG-I functions in innate immunity against Newcastle disease virus infections. Mol. Immunol. 2013, 53, 321–327. [Google Scholar] [CrossRef] [PubMed]
- Shao, Q.; Xu, W.; Yan, L.; Liu, J.; Rui, L.; Xiao, X.; Yu, X.; Lu, Y.; Li, Z. Function of duck RIG-I in induction of antiviral response against IBDV and avian influenza virus on chicken cells. Virus Res. 2014, 191, 184–191. [Google Scholar] [CrossRef] [PubMed]
- Shao, Q.; Xu, W.; Guo, Q.; Yan, L.; Rui, L.; Liu, J.; Zhao, Y.; Li, Z. RIG-I from waterfowl and mammals differ in their abilities to induce antiviral responses against influenza A viruses. J. Gen. Virol. 2015, 96, 277–287. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.-W.; Jung, K.; Jadhao, S.; Suarez, D. Evaluation of chicken-origin (DF-1) and quail-origin (QT-6) fibroblast cell lines for replication of avian influenza viruses. J. Virol. Meth. 2008, 153, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.-J.; Chen, G.-W.; Wang, C.-H.; Huang, C.-H.; Wang, Y.-C.; Shih, S.R. Differential localization and function of PB1-F2 derived from different strains of influenza A virus. J. Virol. 2010, 84, 10051–10062. [Google Scholar] [CrossRef] [PubMed]
- Liniger, M.; Summerfield, A.; Zimmer, G.; McCullough, K.C.; Ruggli, N. Chicken cells sense influenza A virus infection through MDA5 and CARDIF signaling involving LGP2. J. Virol. 2012, 86, 705–717. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar]
- Lee, C.-C.; Wu, C.C.; Lin, T.L. Chicken melanoma differentiation-associated gene 5 (MDA5) recognizes infectious bursal disease virus infection and triggers MDA5-related innate immunity. Arch. Virol. 2014, 159, 1671–1686. [Google Scholar] [CrossRef] [PubMed]
- Guo, Z.; Chen, L.-M.; Zeng, H.; Gomez, J.A.; Plowden, J.; Fujita, T.; Katz, J.M.; Donis, R.O.; Sambhara, S. NS1 protein of influenza A virus inhibits the function of intracytoplasmic pathogen sensor, RIG-I. Am. J. Respir. Cell Mol. Biol. 2007, 36, 263–269. [Google Scholar] [CrossRef] [PubMed]
- Mibayashi, M.; Martínez-Sobrido, L.; Loo, Y.-M.; Cárdenas, W.B.; Gale, M., Jr.; García-Sastre, A. Inhibition of retinoic acid-inducible gene I-mediated induction of beta interferon by the NS1 protein of influenza A virus. J. Virol. 2007, 81, 514–524. [Google Scholar] [CrossRef] [PubMed]
- Gack, M.U.; Albrecht, R.A.; Urano, T.; Inn, K.-S.; Huang, I.-C.; Carnero, E.; Farzan, M.; Inoue, S.; Jung, J.U.; García-Sastre, A. Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 2009, 5, 439–449. [Google Scholar] [CrossRef] [PubMed]
- Rajsbaum, R.; Albrecht, R.A.; Wang, M.K.; Maharaj, N.P.; Versteeg, G.A.; Nistal-Villán, E.; García-Sastre, A.; Gack, M.U. Species-specific inhibition of RIG-I ubiquitination and IFN induction by the influenza A virus NS1 protein. PLoS Pathog. 2012, 8, e1003059. [Google Scholar] [CrossRef] [PubMed]
- Liedmann, S.; Hrincius, E.R.; Guy, C.; Anhlan, D.; Dierkes, R.; Carter, R.; Wu, G.; Staeheli, P.; Green, D.R.; Wolff, T.; et al. Viral suppressors of the RIG-I-mediated interferon response are pre-packaged in influenza virions. Nat. Commun. 2014, 5. [Google Scholar] [CrossRef] [PubMed]
- Varga, Z.T.; Ramos, I.; Hai, R.; Schmolke, M.; García-Sastre, A.; Fernandez-Sesma, A.; Palese, P. The influenza virus protein PB1-F2 inhibits the induction of type I interferon at the level of the MAVS adaptor protein. PLoS Pathog. 2011, 7, e1002067. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Wang, Y.; Li, X.; Li, X.; Cao, H.; Zheng, S.J. Critical roles of glucocorticoid-induced leucine zipper in infectious bursal disease virus (IBDV)-induced suppression of type I Interferon expression and enhancement of IBDV growth in host cells via interaction with VP4. J. Virol. 2013, 87, 1221–1231. [Google Scholar] [CrossRef] [PubMed]
- Miranzo-Navarro, D.; Magor, K.E. Activation of duck RIG-I by trim25 is independent of anchored ubiquitin. PLoS ONE 2014, 9, e86968. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Ren, H.; Liu, Y.; Teeling, J.L.; Gu, J. Phosphorylation of RIG-I by casein kinase II inhibits its antiviral response. J. Virol. 2011, 85, 1036–1047. [Google Scholar] [CrossRef] [PubMed]
- Gao, D.; Yang, Y.-K.; Wang, R.-P.; Zhou, X.; Diao, F.-C.; Li, M.D.; Zhai, Z.H.; Jiang, Z.F.; Chen, D.Y. REUL is a novel E3 ubiquitin ligase and stimulator of retinoic-acid-inducible gene-I. PLoS ONE 2009, 4, e5760. [Google Scholar] [CrossRef] [PubMed]
- Oshiumi, H.; Matsumoto, M.; Hatakeyama, S.; Seya, T. Riplet/RNF135, a RING finger protein, ubiquitinates RIG-I to promote interferon-β induction during the early phase of viral infection. J. Biol. Chem. 2009, 284, 807–817. [Google Scholar] [CrossRef] [PubMed]
- Magor, K.E.; Navarro, D.M.; Barber, M.R.; Petkau, K.; Fleming-Canepa, X.; Blyth, G.A.; Blaine, A.H. Defense genes missing from the flight division. Dev. Comp. Immunol. 2013, 41, 377–388. [Google Scholar] [CrossRef] [PubMed]
- Yoneyama, M.; Fujita, T. RNA recognition and signal transduction by RIG-I-like receptors. Immunol. Rev. 2009, 227, 54–65. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, W.; Shao, Q.; Zang, Y.; Guo, Q.; Zhang, Y.; Li, Z. Pigeon RIG-I Function in Innate Immunity against H9N2 IAV and IBDV. Viruses 2015, 7, 4131-4151. https://doi.org/10.3390/v7072813
Xu W, Shao Q, Zang Y, Guo Q, Zhang Y, Li Z. Pigeon RIG-I Function in Innate Immunity against H9N2 IAV and IBDV. Viruses. 2015; 7(7):4131-4151. https://doi.org/10.3390/v7072813
Chicago/Turabian StyleXu, Wenping, Qiang Shao, Yunlong Zang, Qiang Guo, Yongchao Zhang, and Zandong Li. 2015. "Pigeon RIG-I Function in Innate Immunity against H9N2 IAV and IBDV" Viruses 7, no. 7: 4131-4151. https://doi.org/10.3390/v7072813
APA StyleXu, W., Shao, Q., Zang, Y., Guo, Q., Zhang, Y., & Li, Z. (2015). Pigeon RIG-I Function in Innate Immunity against H9N2 IAV and IBDV. Viruses, 7(7), 4131-4151. https://doi.org/10.3390/v7072813