Common Acquisition of Broadly Neutralizing Antibodies in an HTLV-1c+ First Nations Cohort from Central Australia
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sample Preparation
2.3. HTLV-1 Serologic and Molecular Studies
2.4. Genomic DNA Isolation
2.5. HTLV-1 Proviral Load Measurement
2.6. Plasmids
2.7. Expression and Purification of Env Proteins
2.8. SDS-PAGE/Western Blot
2.9. ELISA
2.10. Peptide ELISA
2.11. RsFcγR Dimer-Binding ELISA
2.12. Pseudovirus (PSV) Neutralization Assay
3. Results
3.1. Individuals Confirmed with HTLV-1c Infection Commonly Develop Env-Directed Ab Responses
3.2. Anti-Env Responses Exhibit Neutralizing Activity and Breadth in HTLV-1c+ Individuals
3.3. Mapping of Ab Binding Epitopes from HTLV-1c+ Individuals
3.4. Correlation Between Anti-Env Responses and PVL
3.5. Correlation Between Anti-Env Responses and Clinical Disease
3.6. Anti-Env IgG from HTLV-1c+ Individuals Bind FcγRs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ADCC | Antibody-dependent cellular cytotoxicity |
| ADCP | Antibody-dependent cellular phagocytosis |
| ATL | Adult T-cell leukemia |
| CKD | Chronic kidney disease |
| ddPCR | Droplet digital PCR |
| GLUT1 | Glucose transporter type 1 |
| HAM | HTLV-1-associated myelopathy |
| HAPD | HTLV-1-associated pulmonary disease |
| HTLV-1 | Human T-cell leukemia virus type-1 |
| HSPG | Heparin sulphate proteoglycans |
| MTCT | Mother-to-child-transmission |
| NRP1 | Neuropilin 1 |
| PRR | Proline rich region |
| PVL | Proviral load |
References
- Gessain, A.; Cassar, O. Epidemiological aspects and world distribution of HTLV-1 infection. Front. Microbiol. 2012, 3, 388. [Google Scholar] [CrossRef]
- Einsiedel, L.; Woodman, R.J.; Flynn, M.; Wilson, K.; Cassar, O.; Gessain, A. Human T-Lymphotropic Virus type 1 infection in an Indigenous Australian population: Epidemiological insights from a hospital-based cohort study. BMC Public Health 2016, 16, 787. [Google Scholar] [CrossRef] [PubMed]
- Kaplan, J.E.; Osame, M.; Kubota, H.; Igata, A.; Nishitani, H.; Maeda, Y.; Khabbaz, R.F.; Janssen, R.S. The risk of development of HTLV-I-associated myelopathy/tropical spastic paraparesis among persons infected with HTLV-I. J. Acquir. Immune Defic. Syndr. 1990, 3, 1096–1101. [Google Scholar]
- Verdonck, K.; González, E.; Van Dooren, S.; Vandamme, A.-M.; Vanham, G.; Gotuzzo, E. Human T-lymphotropic virus 1: Recent knowledge about an ancient infection. Lancet Infect. Dis. 2007, 7, 266–281. [Google Scholar] [CrossRef]
- Einsiedel, L.; Pham, H.; Wilson, K.; Walley, R.; Turpin, J.; Bangham, C.; Gessain, A.; Woodman, R.J. Human T-Lymphotropic Virus type 1c subtype proviral loads, chronic lung disease and survival in a prospective cohort of Indigenous Australians. PLoS Negl. Trop. Dis. 2018, 12, e0006281. [Google Scholar] [CrossRef]
- Talukder, M.R.; Woodman, R.; Pham, H.; Wilson, K.; Gessain, A.; Kaldor, J.; Einsiedel, L. High Human T-Cell Leukemia Virus Type 1c Proviral Loads Are Associated With Diabetes and Chronic Kidney Disease: Results of a Cross-Sectional Community Survey in Central Australia. Clin. Infect. Dis. 2023, 76, e820–e826. [Google Scholar] [CrossRef] [PubMed]
- Li, H.-C.; Biggar, R.J.; Miley, W.J.; Maloney, E.M.; Cranston, B.; Hanchard, B.; Hisada, M. Provirus load in breast milk and risk of mother-to-child transmission of human T lymphotropic virus type I. J. Infect. Dis. 2004, 190, 1275–1278. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, D.U.; Proietti, F.A.; Ribas, J.G.R.; Araújo, M.G.; Pinheiro, S.R.; Guedes, A.C.; Carneiro-Proietti, A.B.F. Epidemiology, treatment, and prevention of human T-cell leukemia virus type 1-associated diseases. Clin. Microbiol. Rev. 2010, 23, 577–589. [Google Scholar] [CrossRef]
- Fan, N.; Gavalchin, J.; Paul, B.; Wells, K.; Lane, M.; Poiesz, B. Infection of peripheral blood mononuclear cells and cell lines by cell-free human T-cell lymphoma/leukemia virus type I. J. Clin. Microbiol. 1992, 30, 905–910. [Google Scholar] [CrossRef]
- Derse, D.; Hill, S.A.; Lloyd, P.A.; Chung, H.-k.; Morse, B.A. Examining human T-lymphotropic virus type 1 infection and replication by cell-free infection with recombinant virus vectors. J. Virol. 2001, 75, 8461–8468. [Google Scholar] [CrossRef]
- Igakura, T.; Stinchcombe, J.C.; Goon, P.K.; Taylor, G.P.; Weber, J.N.; Griffiths, G.M.; Tanaka, Y.; Osame, M.; Bangham, C.R. Spread of HTLV-I between lymphocytes by virus-induced polarization of the cytoskeleton. Science 2003, 299, 1713–1716. [Google Scholar] [CrossRef]
- Pais-Correia, A.-M.; Sachse, M.; Guadagnini, S.; Robbiati, V.; Lasserre, R.; Gessain, A.; Gout, O.; Alcover, A.; Thoulouze, M.-I. Biofilm-like extracellular viral assemblies mediate HTLV-1 cell-to-cell transmission at virological synapses. Nat. Med. 2010, 16, 83–89. [Google Scholar] [CrossRef]
- Wang, T.T.; Hirons, A.; Doerflinger, M.; Morris, K.V.; Ledger, S.; Purcell, D.F.; Kelleher, A.D.; Ahlenstiel, C.L. Current state of therapeutics for HTLV-1. Viruses 2024, 16, 1616. [Google Scholar] [CrossRef]
- Afonso, P.V.; Cassar, O.; Gessain, A. Molecular epidemiology, genetic variability and evolution of HTLV-1 with special emphasis on African genotypes. Retrovirology 2019, 16, 39. [Google Scholar] [CrossRef]
- Gessain, A.; Gallo, R.C.; Franchini, G. Low degree of human T-cell leukemia/lymphoma virus type I genetic drift in vivo as a means of monitoring viral transmission and movement of ancient human populations. J. Virol. 1992, 66, 2288–2295. [Google Scholar] [CrossRef]
- Gessain, A.; Boeri, E.; Yanagihara, R.; Gallo, R.; Franchini, G. Complete nucleotide sequence of a highly divergent human T-cell leukemia (lymphotropic) virus type I (HTLV-I) variant from Melanesia: Genetic and phylogenetic relationship to HTLV-I strains from other geographical regions. J. Virol. 1993, 67, 1015–1023. [Google Scholar] [CrossRef]
- Hirons, A.; Yurick, D.; Jansz, N.; Ellenberg, P.; Franchini, G.; Einsiedel, L.; Khoury, G.; Purcell, D.F. High level of genomic divergence in orf-I p12 and hbz genes of HTLV-1 subtype-C in Central Australia. Retrovirology 2024, 21, 14. [Google Scholar] [CrossRef] [PubMed]
- Santana, C.S.; Andrade, F.d.O.; da Silva, G.C.S.; de Souza Nascimento, J.O.; Campos, R.F.; Giovanetti, M.; Santos, L.A.; Gois, L.L.; Alcantara, L.C.J.; Barreto, F.K. Advances in preventive vaccine development against HTLV-1 infection: A systematic review of the last 35 years. Front. Immunol. 2023, 14, 1073779. [Google Scholar] [CrossRef] [PubMed]
- Yamada, A.; Yasunaga, J.I.; Liang, L.; Zhang, W.; Sunagawa, J.; Nakaoka, S.; Iwami, S.; Kogure, Y.; Ito, Y.; Kataoka, K.; et al. Anti-HTLV-1 immunity combined with proviral load as predictive biomarkers for adult T-cell leukemia-lymphoma. Cancer Sci. 2024, 115, 310–320. [Google Scholar] [CrossRef] [PubMed]
- Blanco, S.; Lingua, G.; del Pilar Gómez, L.; Mangeaud, A.; Gallego, S.V.J.M.P. Neutralizing Antibodies and the Pathogenesis of HTLV-1: Insights from Clinical Cohorts. Microb. Pathog. 2025, 210, 108190. [Google Scholar] [CrossRef]
- Manel, N.; Kim, F.J.; Kinet, S.; Taylor, N.; Sitbon, M.; Battini, J.-L. The ubiquitous glucose transporter GLUT-1 is a receptor for HTLV. Cell 2003, 115, 449–459. [Google Scholar] [CrossRef]
- Pinon, J.D.; Klasse, P.; Jassal, S.R.; Welson, S.; Weber, J.; Brighty, D.W.; Sattentau, Q.J. Human T-cell leukemia virus type 1 envelope glycoprotein gp46 interacts with cell surface heparan sulfate proteoglycans. J. Virol. 2003, 77, 9922–9930. [Google Scholar] [CrossRef]
- Ghez, D.; Lepelletier, Y.; Lambert, S.; Fourneau, J.-M.; Blot, V.; Janvier, S.; Arnulf, B.; van Endert, P.M.; Heveker, N.; Pique, C.; et al. Neuropilin-1 is involved in human T-cell lymphotropic virus type 1 entry. J. Virol. 2006, 80, 6844–6854. [Google Scholar] [CrossRef]
- Jin, Q.; Agrawal, L.; VanHorn-Ali, Z.; Alkhatib, G. Infection of CD4+ T lymphocytes by the human T cell leukemia virus type 1 is mediated by the glucose transporter GLUT-1: Evidence using antibodies specific to the receptor’s large extracellular domain. Virology 2006, 349, 184–196. [Google Scholar] [CrossRef]
- Palker, T.; Riggs, E.; Spragion, D.; Muir, A.; Scearce, R.; Randall, R.; McAdams, M.; McKnight, A.; Clapham, P.; Weiss, R.; et al. Mapping of homologous, amino-terminal neutralizing regions of human T-cell lymphotropic virus type I and II gp46 envelope glycoproteins. J. Virol. 1992, 66, 5879–5889. [Google Scholar] [CrossRef]
- Kuroki, M.; Nakamura, M.; Itoyama, Y.; Tanaka, Y.; Shiraki, H.; Baba, E.; Esaki, T.; Tatsumoto, T.; Nagafuchi, S.; Nakano, S.; et al. Identification of new epitopes recognized by human monoclonal antibodies with neutralizing and antibody-dependent cellular cytotoxicity activities specific for human T cell leukemia virus type 1. J. Immunol. 1992, 149, 940–948. [Google Scholar] [CrossRef]
- Baba, E.; Nakamura, M.; Tanaka, Y.; Kuroki, M.; Itoyama, Y.; Nakano, S.; Niho, Y. Multiple neutralizing B-cell epitopes of human T-cell leukemia virus type 1 (HTLV-1) identified by human monoclonal antibodies. A basis for the design of an HTLV-1 peptide vaccine. J. Immunol. 1993, 151, 1013–1024. [Google Scholar] [CrossRef] [PubMed]
- Desgranges, C.; Souche, S.; Vernant, J.-C.; Smadja, D.; Vahlne, A.; Horal, P. Identification of novel neutralization-inducing regions of the human T cell lymphotropic virus type I envelope glycoproteins with human HTLV-I-seropositive sera. AIDS Res. Hum. Retroviruses 1994, 10, 163–173. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y.; Zeng, L.; Shiraki, H.; Shida, H.; Tozawa, H. Identification of a neutralization epitope on the envelope gp46 antigen of human T cell leukemia virus type I and induction of neutralizing antibody by peptide immunization. J. Immunol. 1991, 147, 354–360. [Google Scholar] [CrossRef]
- Mizuguchi, M.; Takahashi, Y.; Tanaka, R.; Fukushima, T.; Tanaka, Y. Conservation of a Neutralization Epitope of Human T-cell Leukemia Virus Type 1 (HTLV-1) among Currently Endemic Clinical Isolates in Okinawa, Japan. Pathogens 2020, 9, 82. [Google Scholar] [CrossRef] [PubMed]
- Cooney, J.P.; Hirons, A.; Jansz, N.; Allison, C.C.; Hickey, P.; Teh, C.E.; Tan, T.; Dagley, L.F.; Yousef, J.; Yurick, D.; et al. Combination antiretroviral therapy and MCL-1 inhibition mitigate HTLV-1 infection in vivo. Cell 2025, 188, 4896–4912.e19. [Google Scholar] [CrossRef]
- Haynes, B.F.; Gilbert, P.B.; McElrath, M.J.; Zolla-Pazner, S.; Tomaras, G.D.; Alam, S.M.; Evans, D.T.; Montefiori, D.C.; Karnasuta, C.; Sutthent, R.; et al. Immune-correlates analysis of an HIV-1 vaccine efficacy trial. N. Engl. J. Med. 2012, 366, 1275–1286. [Google Scholar] [CrossRef]
- Wines, B.D.; Vanderven, H.A.; Esparon, S.E.; Kristensen, A.B.; Kent, S.J.; Hogarth, P.M. Dimeric FcγR ectodomains as probes of the Fc receptor function of anti-influenza virus IgG. J. Immunol. 2016, 197, 1507–1516. [Google Scholar] [CrossRef]
- Forthal, D.N.; Finzi, A. Antibody-dependent cellular cytotoxicity in HIV infection. Aids 2018, 32, 2439–2451. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y.; Tanaka, R.; Imaizumi, N.; Mizuguchi, M.; Takahashi, Y.; Hayashi, M.; Miyagi, T.; Uchihara, J.; Ohshiro, K.; Masuzaki, H.; et al. A protective role of HTLV-1 gp46-specific neutralizing and antibody-dependent cellular cytotoxicity-inducing antibodies in progression to adult T-cell leukemia (ATL). Front. Immunol. 2022, 13, 921606. [Google Scholar] [CrossRef] [PubMed]
- Matsuzaki, T.; Nakagawa, M.; Nagai, M.; Usuku, K.; Higuchi, I.; Arimura, K.; Kubota, H.; Izumo, S.; Akiba, S.; Osame, M. HTLV-I proviral load correlates with progression of motor disability in HAM/TSP: Analysis of 239 HAM/TSP patients including 64 patients followed up for 10 years. J. NeuroVirol. 2001, 7, 228–234. [Google Scholar]
- Montanheiro, P.A.; Penalva de Oliveira, A.; Posada-Vergara, M.; Milagres, A.; Tauil, C.; Marchiori, P.; Duarte, A.J.S.; Casseb, J. Human T-cell lymphotropic virus type I (HTLV-I) proviral DNA viral load among asymptomatic patients and patients with HTLV-I-associated myelopathy/tropical spastic paraparesis. Braz. J. Med. Biol. Res. 2005, 38, 1643–1647. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Miyata, H.; Kamahora, T.; Iha, S.; Katamine, S.; Miyamoto, T.; Hino, S. Dependency of antibody titer on provirus load in human T lymphotropic virus type I carriers: An interpretation for the minor population of seronegative carriers. J. Infect. Dis. 1995, 171, 1455–1460. [Google Scholar] [CrossRef]
- Yurick, D.; Khoury, G.; Clemens, B.; Loh, L.; Pham, H.; Kedzierska, K.; Einsiedel, L.; Purcell, D. A Multiplex Droplet Digital PCR Assay for Quantification of HTLV-1c DNA Proviral Load and T-Cells from Blood and Respiratory Exudates Sampled in a Remote Setting. J. Clin. Microbiol. 2019, 57, e01063-18. [Google Scholar] [CrossRef]
- Kramski, M.; Center, R.J.; Wheatley, A.K.; Jacobson, J.C.; Alexander, M.R.; Rawlin, G.; Purcell, D.F. Hyperimmune bovine colostrum as a low-cost, large-scale source of antibodies with broad neutralizing activity for HIV-1 envelope with potential use in microbicides. Antimicrob. Agents Chemother. 2012, 56, 4310–4319. [Google Scholar] [CrossRef]
- Edwards, J.M.; Heydarchi, B.; Khoury, G.; Salazar-Quiroz, N.A.; Gonelli, C.A.; Wines, B.; Hogarth, P.M.; Kristensen, A.B.; Parsons, M.S.; Purcell, D.F. Enhancement of Antibody-Dependent Cellular Cytotoxicity and Phagocytosis in Anti-HIV-1 Human-Bovine Chimeric Broadly Neutralizing Antibodies. J. Virol. 2021, 95, e00219-21. [Google Scholar] [CrossRef]
- Tanaka, Y.; Takahashi, Y.; Tanaka, R.; Kodama, A.; Fujii, H.; Hasegawa, A.; Kannagi, M.; Ansari, A.A.; Saito, M. Elimination of human T cell leukemia virus type-1-infected cells by neutralizing and antibody-dependent cellular cytotoxicity-inducing antibodies against human t cell leukemia virus type-1 envelope gp46. AIDS Res. Hum. Retroviruses 2014, 30, 542–552. [Google Scholar] [CrossRef]
- Ikeda, M.; Fujino, R.; Matsui, T.; Yoshida, T.; Komoda, H.; Imai, J. A new agglutination test for serum antibodies to adult T-cell leukemia virus. GANN Jpn. J. Cancer Res. 1984, 75, 845–848. [Google Scholar]
- Asigbee, T.W.; Nakamura-Hoshi, M.; Kuse, N.; Ishii, H.; Ishikawa, K.; Kawana-Tachikawa, A.; Horibe, E.; Nakashima, M.; Yamano, Y.; Uchimaru, K.; et al. Virus-host immune interaction in asymptomatic HTLV-1 carriers. Microbiol. Spectr. 2025, 13, e02507-24. [Google Scholar] [CrossRef]
- Burbelo, P.D.; Meoli, E.; Leahy, H.P.; Graham, J.; Yao, K.; Oh, U.; Janik, J.E.; Mahieux, R.; Kashanchi, F.; Iadarola, M.J.; et al. Anti-HTLV antibody profiling reveals an antibody signature for HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Retrovirology 2008, 5, 1–11. [Google Scholar] [CrossRef]
- Jones, K.S.; Lambert, S.; Bouttier, M.; Bénit, L.; Ruscetti, F.W.; Hermine, O.; Pique, C. Molecular aspects of HTLV-1 entry: Functional domains of the HTLV-1 surface subunit (SU) and their relationships to the entry receptors. Viruses 2011, 3, 794–810. [Google Scholar] [CrossRef]
- Fujii, H.; Shimizu, M.; Miyagi, T.; Kunihiro, M.; Tanaka, R.; Takahashi, Y.; Tanaka, Y. A potential of an anti-HTLV-I GP46 neutralizing monoclonal antibody (lat-27) for passive immunization against both horizontal and mother-to-child vertical infection with human T cell leukemia virus type-I. Viruses 2016, 8, 41. [Google Scholar] [CrossRef] [PubMed]
- Einsiedel, L.; Cassar, O.; Goeman, E.; Spelman, T.; Au, V.; Hatami, S.; Joseph, S.; Gessain, A. Higher Human T-Lymphotropic Virus Type 1 Subtype C Proviral Loads Are Associated With Bronchiectasis in Indigenous Australians: Results of a Case-Control Study. Open Forum Infect. Dis. 2014, 1, ofu023. [Google Scholar] [CrossRef] [PubMed]
- Cook, L.B.; Melamed, A.; Niederer, H.; Valganon, M.; Laydon, D.; Foroni, L.; Taylor, G.P.; Matsuoka, M.; Bangham, C.R. The role of HTLV-1 clonality, proviral structure, and genomic integration site in adult T-cell leukemia/lymphoma. Blood 2014, 123, 3925–3931. [Google Scholar] [CrossRef]
- Artesi, M.; Marçais, A.; Durkin, K.; Rosewick, N.; Hahaut, V.; Suarez, F.; Trinquand, A.; Lhermitte, L.; Asnafi, V.; Avettand-Fenoel, V.; et al. Monitoring molecular response in adult T-cell leukemia by high-throughput sequencing analysis of HTLV-1 clonality. Leukemia 2017, 31, 2532–2535. [Google Scholar] [CrossRef] [PubMed]
- Einsiedel, L.J.; Woodman, R. Two nations: Racial disparities in bloodstream infections recorded at Alice Springs Hospital, central Australia 2001–2005. Med. J. Aust. 2010, 192, 567–571. [Google Scholar] [CrossRef]
- Einsiedel, L.; Spelman, T.; Goeman, E.; Cassar, O.; Arundell, M.; Gessain, A. Clinical associations of Human T-Lymphotropic Virus type 1 infection in an indigenous Australian population. PLoS Negl. Trop. Dis. 2014, 8, e2643. [Google Scholar] [CrossRef]
- Einsiedel, L.; Cassar, O.; Spelman, T.; Joseph, S.; Gessain, A. Higher HTLV-1c proviral loads are associated with blood stream infections in an Indigenous Australian population. J. Clin. Virol. 2016, 78, 93–98. [Google Scholar] [CrossRef]
- Miyakoshi, H.; Koide, H.; Aoki, T. In vitro antibody-dependent cellular cytotoxicity against human T-cell leukemia/lymphoma virus (HTLV)-producing cells. Int. J. Cancer 1984, 33, 287–291. [Google Scholar] [CrossRef]
- Sinclair, A.L.; Habeshaw, J.A.; Muir, L.; Chandler, P.; Forster, S.; Cruickshank, K.; Dalgleish, A.G. Antibody-dependent cell-mediated cytotoxicity: Comparison between HTLV-I and HIV-1 assays. Aids 1988, 2, 465–472. [Google Scholar] [CrossRef] [PubMed]
- Pise-Masison, C.A.; Rahman, M.A.; Masison, D.C.; Gutowska, A.; Moles, R.; Bissa, M.; Sarkis, S.; Schifanella, L.; Zhou, T.; Jones, J.; et al. Development and optimization of human T-cell leukemia virus-specific antibody-dependent cell-mediated cytotoxicity (ADCC) assay directed to the envelope protein. J. Virol. 2025, 99, e02268-24. [Google Scholar] [CrossRef] [PubMed]
- Madhavi, V.; Wines, B.D.; Amin, J.; Emery, S.; Group, E.S.; Lopez, E.; Kelleher, A.; Group, S.L.S.; Center, R.J.; Hogarth, P.M.; et al. HIV-1 Env-and Vpu-specific antibody-dependent cellular cytotoxicity responses associated with elite control of HIV. J. Virol. 2017, 91, e00700-17. [Google Scholar] [CrossRef] [PubMed]
- Mohanty, S.; Harhaj, E.W. Mechanisms of innate immune sensing of HTLV-1 and viral immune evasion. Pathogens 2023, 12, 735. [Google Scholar] [CrossRef]






| Characteristic | Cases (n = 62) |
|---|---|
| Age, years (mean ± SD) | 54.4 ± 12.7 |
| Sex (n, %) | Men = 22 (34.9) Women = 40 (64.5) |
| Comorbidities (n, %) | |
| Diabetes | 39/62 (62.9) |
| Asthma | 5/62 (8.1) |
| IHD | 14/62 (22.6) |
| CLD | 10/62 (16.1) |
| CKD | 38/62 (61.3) |
| Possible HTLV-1-associated conditions (n, %) | |
| Bronchiectasis | 20/62 (32.3) |
| COPD | 5/62 (8.1) |
| BSI * | 28/62 (45.2) |
| Strongyloidiasis seropositive | 11/61 (18.0) Ø |
| Lifestyle (n, %) | |
| Smoking history | 21/55 (38.2) Ø |
| Alcohol history | 28/58 (48.3) Ø |
| Name | Target | Sequence (5′-3′) |
|---|---|---|
| ODP 3085 (forward) | HTLV-1c tax region | TCCAGGCCTTATTTGGACAT |
| ODP 3086 (reverse) | HTLV-1c tax region | CGTGTGAGAGTAGGACTGAG |
| ODP 3318 tax probe | HTLV-1c tax region | 6FAM-CATGATTTCCGGGCCTTGC-MGBNFQ * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Grimley, S.L.; Monard, S.C.; Hirons, A.; Yap, A.H.Y.; Collins, S.; Yurick, D.; Khoury, G.; Ellenberg, P.C.; Pellegrini, M.; Einsiedel, L.J.; et al. Common Acquisition of Broadly Neutralizing Antibodies in an HTLV-1c+ First Nations Cohort from Central Australia. Viruses 2026, 18, 402. https://doi.org/10.3390/v18040402
Grimley SL, Monard SC, Hirons A, Yap AHY, Collins S, Yurick D, Khoury G, Ellenberg PC, Pellegrini M, Einsiedel LJ, et al. Common Acquisition of Broadly Neutralizing Antibodies in an HTLV-1c+ First Nations Cohort from Central Australia. Viruses. 2026; 18(4):402. https://doi.org/10.3390/v18040402
Chicago/Turabian StyleGrimley, Samantha L., Sarah C. Monard, Ashley Hirons, Ashley H. Y. Yap, Sarah Collins, David Yurick, Georges Khoury, Paula C. Ellenberg, Marc Pellegrini, Lloyd J. Einsiedel, and et al. 2026. "Common Acquisition of Broadly Neutralizing Antibodies in an HTLV-1c+ First Nations Cohort from Central Australia" Viruses 18, no. 4: 402. https://doi.org/10.3390/v18040402
APA StyleGrimley, S. L., Monard, S. C., Hirons, A., Yap, A. H. Y., Collins, S., Yurick, D., Khoury, G., Ellenberg, P. C., Pellegrini, M., Einsiedel, L. J., & Purcell, D. F. J. (2026). Common Acquisition of Broadly Neutralizing Antibodies in an HTLV-1c+ First Nations Cohort from Central Australia. Viruses, 18(4), 402. https://doi.org/10.3390/v18040402

