Ephrin B1 and B2 Mediate Cedar Virus Entry into Egyptian Fruit Bat Cells
Abstract
1. Introduction
2. Material and Methods
2.1. Cell Culture
2.2. Plasmids, Antibodies and Reagents
2.3. Generation of CHO-K1 Cells Stably Expressing ERB Ephrins (CHO-EFN)
2.4. Recombinant Cedar Virus (rCedV-nTurbo635) Generation and Infection
2.5. High-Content Imaging Analysis of CedV Entry
2.6. Immunofluorescence
2.7. Generation of Lentiviral shRNA Plasmids
2.8. Lentivirus Production and Transduction of RaNep Cells
2.9. mRNA Extraction, cDNA Synthesis and qPCR
2.10. Species Identification by Cytochrome c Oxidase Subunit I (COI) PCR
2.11. Flow Cytometry Analysis of rCedV-nTurbo635 Entry
2.12. SDS-PAGE and Western Blot
2.13. Generation of Lentivirus-Based Pseudotyped CedV Particles
2.14. Pseudotyped CedV Infection Assay
2.15. Statistical Data Analysis
3. Results
3.1. CedV Pseudotyped Particles Enter CHO-K1 Cells Expressing ERB Ephrins B1 or B2
3.2. Recombinant Cedar Virus Utilizes ERB Ephrins B1, B2 and A5 for Its Entry
3.3. Ephrin B2 Knockdown Significantly Impairs rCedV-nTurbo635 Entry into ERB Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chua, K.B.; Bellini, W.J.; Rota, P.A.; Harcourt, B.H.; Tamin, A.; Lam, S.K.; Ksiazek, T.G.; Rollin, P.E.; Zaki, S.R.; Shieh, W.; et al. Nipah virus: A recently emergent deadly paramyxovirus. Science 2000, 288, 1432–1435. [Google Scholar] [CrossRef] [PubMed]
- Eaton, B.T.; Broder, C.C.; Middleton, D.; Wang, L.-F. Hendra and Nipah viruses: Different and dangerous. Nature reviews. Microbiology 2006, 4, 23–35. [Google Scholar] [CrossRef] [PubMed]
- Gazal, S.; Sharma, N.; Gazal, S.; Tikoo, M.; Shikha, D.; Badroo, G.A.; Rashid, M.; Lee, S.-J. Nipah and Hendra Viruses: Deadly Zoonotic Paramyxoviruses with the Potential to Cause the Next Pandemic. Pathogens 2022, 11, 1419. [Google Scholar] [CrossRef] [PubMed]
- WOAH—World Organisation for Animal Health. Terrestrial Manual Online Access—WOAH—World Organisation for Animal Health. Chapter 3.1.16. Nipah and Hendra Virus Diseases (Version Adopted in May 2022). Available online: https://www.woah.org/en/what-we-do/standards/codes-and-manuals/terrestrial-manual-online-access/ (accessed on 23 August 2024).
- O'Sullivan, J.D.; Allworth, A.M.; Paterson, D.L.; Snow, T.M.; Boots, R.; Gleeson, L.J.; Gould, A.R.; Hyatt, A.D.; Bradfield, J. Fatal encephalitis due to novel paramyxovirus transmitted from horses. Lancet 1997, 349, 93–95. [Google Scholar] [CrossRef]
- Selvey, L.A.; Wells, R.M.; McCormack, J.G.; Ansford, A.J.; Murray, K.; Rogers, R.J.; Lavercombe, P.S.; Selleck, P.; Sheridan, J.W. Infection of humans and horses by a newly described morbillivirus. Med. J. Aust. 1995, 162, 642–645. [Google Scholar] [CrossRef]
- Murray, K.; Selleck, P.; Hooper, P.; Hyatt, A.; Gould, A.; Gleeson, L.; Westbury, H.; Hiley, L.; Selvey, L.; Rodwell, B. A morbillivirus that caused fatal disease in horses and humans. Science 1995, 268, 94–97. [Google Scholar] [CrossRef]
- Chua, K.B.; Goh, K.J.; Wong, K.T.; Kamarulzaman, A.; Tan, P.S.; Ksiazek, T.G.; Zaki, S.R.; Paul, G.; Lam, S.K.; Tan, C.T. Fatal encephalitis due to Nipah virus among pig-farmers in Malaysia. Lancet 1999, 354, 1257–1259. [Google Scholar] [CrossRef]
- Nipah Virus. Available online: https://www.who.int/news-room/fact-sheets/detail/nipah-virus (accessed on 9 August 2024).
- Wong, K.T.; Shieh, W.-J.; Kumar, S.; Norain, K.; Abdullah, W.; Guarner, J.; Goldsmith, C.S.; Chua, K.B.; Lam, S.K.; Tan, C.T.; et al. Nipah virus infection: Pathology and pathogenesis of an emerging paramyxoviral zoonosis. Am. J. Pathol. 2002, 161, 2153–2167. [Google Scholar] [CrossRef]
- Arunkumar, G.; Chandni, R.; Mourya, D.T.; Singh, S.K.; Sadanandan, R.; Sudan, P.; Bhargava, B. Outbreak Investigation of Nipah Virus Disease in Kerala, India, 2018. J. Infect. Dis. 2019, 219, 1867–1878. [Google Scholar] [CrossRef]
- World Health Organization. Nipah virus outbreak(s) in Bangladesh, January–April 2004. Relev. Epidemiol. Hebd. 2004, 79, 168–171. [Google Scholar]
- Gurley, E.S.; Montgomery, J.M.; Hossain, M.J.; Bell, M.; Azad, A.K.; Islam, M.R.; Molla, M.A.R.; Carroll, D.S.; Ksiazek, T.G.; Rota, P.A.; et al. Person-to-person transmission of Nipah virus in a Bangladeshi community. Emerg. Infect. Dis. 2007, 13, 1031–1037. [Google Scholar] [CrossRef] [PubMed]
- Chua, K.B.; Koh, C.L.; Hooi, P.S.; Wee, K.F.; Khong, J.H.; Chua, B.H.; Chan, Y.P.; Lim, M.E.; Lam, S.K. Isolation of Nipah virus from Malaysian Island flying-foxes. Microbes Infect. 2002, 4, 145–151. [Google Scholar] [CrossRef] [PubMed]
- Halpin, K.; Young, P.L.; Field, H.E.; Mackenzie, J.S. Isolation of Hendra virus from pteropid bats: A natural reservoir of Hendra virus. J. Gen. Virol. 2000, 81, 1927–1932. [Google Scholar] [CrossRef] [PubMed]
- Middleton, D.J.; Morrissy, C.J.; van der Heide, B.M.; Russell, G.M.; Braun, M.A.; Westbury, H.A.; Halpin, K.; Daniels, P.W. Experimental Nipah virus infection in pteropid bats (Pteropus poliocephalus). J. Comp. Pathol. 2007, 136, 266–272. [Google Scholar] [CrossRef]
- Rahman, S.A.; Hassan, S.S.; Olival, K.J.; Mohamed, M.; Chang, L.-Y.; Hassan, L.; Saad, N.M.; Shohaimi, S.A.; Mamat, Z.C.; Naim, M.S.; et al. Characterization of Nipah virus from naturally infected Pteropus vampyrus bats, Malaysia. Emerg. Infect. Dis. 2010, 16, 1990–1993. [Google Scholar] [CrossRef]
- Yob, J.M.; Field, H.; Rashdi, A.M.; Morrissy, C.; van der Heide, B.; Rota, P.; bin Adzhar, A.; White, J.; Daniels, P.; Jamaluddin, A.; et al. Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia. Emerg. Infect. Dis. 2001, 7, 439–441. [Google Scholar] [CrossRef]
- Young, P.L.; Halpin, K.; Selleck, P.W.; Field, H.; Gravel, J.L.; Kelly, M.A.; Mackenzie, J.S. Serologic evidence for the presence in Pteropus bats of a paramyxovirus related to equine morbillivirus. Emerg. Infect. Dis. 1996, 2, 239–240. [Google Scholar] [CrossRef]
- Baker, K.S.; Todd, S.; Marsh, G.; Fernandez-Loras, A.; Suu-Ire, R.; Wood, J.L.N.; Wang, L.F.; Murcia, P.R.; Cunningham, A.A. Co-circulation of diverse paramyxoviruses in an urban African fruit bat population. J. Gen. Virol. 2012, 93, 850–856. [Google Scholar] [CrossRef]
- Iehlé, C.; Razafitrimo, G.; Razainirina, J.; Andriaholinirina, N.; Goodman, S.M.; Faure, C.; Georges-Courbot, M.-C.; Rousset, D.; Reynes, J.-M. Henipavirus and Tioman virus antibodies in pteropodid bats, Madagascar. Emerg. Infect. Dis. 2007, 13, 159–161. [Google Scholar] [CrossRef]
- Hayman, D.T.S.; Suu-Ire, R.; Breed, A.C.; McEachern, J.A.; Wang, L.; Wood, J.L.N.; Cunningham, A.A. Evidence of henipavirus infection in West African fruit bats. PLoS ONE 2008, 3, e2739. [Google Scholar] [CrossRef]
- Drexler, J.F.; Corman, V.M.; Gloza-Rausch, F.; Seebens, A.; Annan, A.; Ipsen, A.; Kruppa, T.; Müller, M.A.; Kalko, E.K.V.; Adu-Sarkodie, Y.; et al. Henipavirus RNA in African bats. PLoS ONE 2009, 4, e6367. [Google Scholar] [CrossRef] [PubMed]
- Weiss, S.; Nowak, K.; Fahr, J.; Wibbelt, G.; Mombouli, J.-V.; Parra, H.-J.; Wolfe, N.D.; Schneider, B.S.; Leendertz, F.H. Henipavirus-related sequences in fruit bat bushmeat, Republic of Congo. Emerg. Infect. Dis. 2012, 18, 1536–1537. [Google Scholar] [CrossRef] [PubMed]
- Benda, P.; Vallo, P.; Hulva, P.; Horáček, I. The Egyptian fruit bat Rousettus aegyptiacus (Chiroptera: Pteropodidae) in the Palaearctic: Geographical variation and taxonomic status. Biologia 2012, 67, 1230–1244. [Google Scholar] [CrossRef]
- Lučan, R.K.; Bartonička, T.; Jedlička, P.; Řeřucha, Š.; Šálek, M.; Čížek, M.; Nicolaou, H.; Horáček, I. Spatial activity and feeding ecology of the endangered northern population of the Egyptian fruit bat (Rousettus aegyptiacus). J. Mammal. 2016, 97, 815–822. [Google Scholar] [CrossRef]
- Strachinis, I.; Kalaentzis, K.; Katsiyiannis, P.; Kazilas, C. First record of the Egyptian fruit bat, Rousettus aegyptiacus (Pteropodidae), from Kastellorizo island, Greece. Mammalia 2018, 82, 611–613. [Google Scholar] [CrossRef]
- Taylor, M.; Tuttle, M.D. (Eds.) Bats. An Illustrated Guide to All Species; Smithsonian Books: Washington, DC, USA, 2018. [Google Scholar]
- Korine, C.; Izhaki, I.; Makin, D. Population structure and emergence order in the fruit-bat (Rousettus aegyptiacus: Mammalia, Chiroptera). J. Zool. 1994, 232, 163–174. [Google Scholar] [CrossRef]
- Mortlock, M.; Geldenhuys, M.; Dietrich, M.; Epstein, J.H.; Weyer, J.; Pawęska, J.T.; Markotter, W. Seasonal shedding patterns of diverse henipavirus-related paramyxoviruses in Egyptian rousette bats. Sci. Rep. 2021, 11, 24262. [Google Scholar] [CrossRef]
- Markotter, W.; Geldenhuys, M.; van Jansen Vuren, P.; Kemp, A.; Mortlock, M.; Mudakikwa, A.; Nel, L.; Nziza, J.; Paweska, J.; Weyer, J. Paramyxo- and Coronaviruses in Rwandan Bats. Trop. Med. Infect. Dis. 2019, 4. [Google Scholar] [CrossRef]
- Drexler, J.F.; Corman, V.M.; Müller, M.A.; Maganga, G.D.; Vallo, P.; Binger, T.; Gloza-Rausch, F.; Cottontail, V.M.; Rasche, A.; Yordanov, S.; et al. Bats host major mammalian paramyxoviruses. Nat. Commun. 2012, 3, 796. [Google Scholar] [CrossRef]
- Wu, Z.; Yang, L.; Yang, F.; Ren, X.; Jiang, J.; Dong, J.; Sun, L.; Zhu, Y.; Zhou, H.; Jin, Q. Novel Henipa-like virus, Mojiang Paramyxovirus, in rats, China, 2012. Emerg. Infect. Dis. 2014, 20, 1064–1066. [Google Scholar] [CrossRef]
- Zhang, X.-A.; Li, H.; Jiang, F.-C.; Zhu, F.; Zhang, Y.-F.; Chen, J.-J.; Tan, C.-W.; Anderson, D.E.; Fan, H.; Dong, L.-Y.; et al. A Zoonotic Henipavirus in Febrile Patients in China. N. Engl. J. Med. 2022, 387, 470–472. [Google Scholar] [CrossRef] [PubMed]
- Madera, S.; Kistler, A.; Ranaivoson, H.C.; Ahyong, V.; Andrianiaina, A.; Andry, S.; Raharinosy, V.; Randriambolamanantsoa, T.H.; Ravelomanantsoa, N.A.F.; Tato, C.M.; et al. Discovery and Genomic Characterization of a Novel Henipavirus, Angavokely Virus, from Fruit Bats in Madagascar. J. Virol. 2022, 96, e0092122. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, S.; Chandran, D.; Mohapatra, R.K.; Islam, M.A.; Alagawany, M.; Bhattacharya, M.; Chakraborty, C.; Dhama, K. Langya virus, a newly identified Henipavirus in China—Zoonotic pathogen causing febrile illness in humans, and its health concerns: Current knowledge and counteracting strategies—Correspondence. Int. J. Surg. 2022, 105, 106882. [Google Scholar] [CrossRef] [PubMed]
- Marsh, G.A.; de Jong, C.; Barr, J.A.; Tachedjian, M.; Smith, C.; Middleton, D.; Yu, M.; Todd, S.; Foord, A.J.; Haring, V.; et al. Cedar virus: A novel Henipavirus isolated from Australian bats. PLoS Pathog. 2012, 8, e1002836. [Google Scholar] [CrossRef]
- Diederich, S.; Babiuk, S.; Boshra, H. A Survey of Henipavirus Tropism-Our Current Understanding from a Species/Organ and Cellular Level. Viruses 2023, 15, 2048. [Google Scholar] [CrossRef]
- Schountz, T.; Campbell, C.; Wagner, K.; Rovnak, J.; Martellaro, C.; DeBuysscher, B.L.; Feldmann, H.; Prescott, J. Differential Innate Immune Responses Elicited by Nipah Virus and Cedar Virus Correlate with Disparate In Vivo Pathogenesis in Hamsters. Viruses 2019, 11, 291. [Google Scholar] [CrossRef]
- Laing, E.D.; Amaya, M.; Navaratnarajah, C.K.; Feng, Y.-R.; Cattaneo, R.; Wang, L.-F.; Broder, C.C. Rescue and characterization of recombinant cedar virus, a non-pathogenic Henipavirus species. Virol. J. 2018, 15, 56. [Google Scholar] [CrossRef]
- Satterfield, B.A.; Cross, R.W.; Fenton, K.A.; Agans, K.N.; Basler, C.F.; Geisbert, T.W.; Mire, C.E. The immunomodulating V and W proteins of Nipah virus determine disease course. Nat. Commun. 2015, 6, 7483. [Google Scholar] [CrossRef]
- Rodriguez, J.J.; Parisien, J.-P.; Horvath, C.M. Nipah virus V protein evades alpha and gamma interferons by preventing STAT1 and STAT2 activation and nuclear accumulation. J. Virol. 2002, 76, 11476–11483. [Google Scholar] [CrossRef]
- Rodriguez, J.J.; Wang, L.-F.; Horvath, C.M. Hendra virus V protein inhibits interferon signaling by preventing STAT1 and STAT2 nuclear accumulation. J. Virol. 2003, 77, 11842–11845. [Google Scholar] [CrossRef]
- Shaw, M.L.; García-Sastre, A.; Palese, P.; Basler, C.F. Nipah virus V and W proteins have a common STAT1-binding domain yet inhibit STAT1 activation from the cytoplasmic and nuclear compartments, respectively. J. Virol. 2004, 78, 5633–5641. [Google Scholar] [CrossRef] [PubMed]
- Ciancanelli, M.J.; Volchkova, V.A.; Shaw, M.L.; Volchkov, V.E.; Basler, C.F. Nipah virus sequesters inactive STAT1 in the nucleus via a P gene-encoded mechanism. J. Virol. 2009, 83, 7828–7841. [Google Scholar] [CrossRef] [PubMed]
- Childs, K.; Randall, R.; Goodbourn, S. Paramyxovirus V proteins interact with the RNA Helicase LGP2 to inhibit RIG-I-dependent interferon induction. J. Virol. 2012, 86, 3411–3421. [Google Scholar] [CrossRef] [PubMed]
- Andrejeva, J.; Childs, K.S.; Young, D.F.; Carlos, T.S.; Stock, N.; Goodbourn, S.; Randall, R.E. The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter. Proc. Natl. Acad. Sci. USA 2004, 101, 17264–17269. [Google Scholar] [CrossRef]
- Enchéry, F.; Dumont, C.; Iampietro, M.; Pelissier, R.; Aurine, N.; Bloyet, L.-M.; Carbonnelle, C.; Mathieu, C.; Journo, C.; Gerlier, D.; et al. Nipah virus W protein harnesses nuclear 14-3-3 to inhibit NF-κB-induced proinflammatory response. Commun. Biol. 2021, 4, 1292. [Google Scholar] [CrossRef]
- Lieu, K.G.; Marsh, G.A.; Wang, L.-F.; Netter, H.J. The non-pathogenic Henipavirus Cedar paramyxovirus phosphoprotein has a compromised ability to target STAT1 and STAT2. Antivir. Res. 2015, 124, 69–76. [Google Scholar] [CrossRef]
- Chen, M.; Tachedjian, M.; Marsh, G.A.; Cui, J.; Wang, L.-F. Distinct Cell Transcriptomic Landscapes Upon Henipavirus Infections. Front. Microbiol. 2020, 11, 986. [Google Scholar] [CrossRef]
- Virtue, E.R.; Marsh, G.A.; Baker, M.L.; Wang, L.-F. Interferon production and signaling pathways are antagonized during henipavirus infection of fruit bat cell lines. PLoS ONE 2011, 6, e22488. [Google Scholar] [CrossRef]
- Escaffre, O.; Borisevich, V.; Carmical, J.R.; Prusak, D.; Prescott, J.; Feldmann, H.; Rockx, B. Henipavirus pathogenesis in human respiratory epithelial cells. J. Virol. 2013, 87, 3284–3294. [Google Scholar] [CrossRef]
- Bossart, K.N.; Tachedjian, M.; McEachern, J.A.; Crameri, G.; Zhu, Z.; Dimitrov, D.S.; Broder, C.C.; Wang, L.-F. Functional studies of host-specific ephrin-B ligands as Henipavirus receptors. Virology 2008, 372, 357–371. [Google Scholar] [CrossRef]
- Hoque, A.F.; Rahman, M.M.; Lamia, A.S.; Islam, A.; Klena, J.D.; Satter, S.M.; Epstein, J.H.; Montgomery, J.M.; Hossain, M.E.; Shirin, T.; et al. In silico prediction of interaction between Nipah virus attachment glycoprotein and host cell receptors Ephrin-B2 and Ephrin-B3 in domestic and peridomestic mammals. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2023, 116, 105516. [Google Scholar] [CrossRef] [PubMed]
- Pernet, O.; Wang, Y.E.; Lee, B. Henipavirus receptor usage and tropism. Curr. Top. Microbiol. Immunol. 2012, 359, 59–78. [Google Scholar] [CrossRef] [PubMed]
- Navaratnarajah, C.K.; Generous, A.R.; Yousaf, I.; Cattaneo, R. Receptor-mediated cell entry of paramyxoviruses: Mechanisms, and consequences for tropism and pathogenesis. J. Biol. Chem. 2020, 295, 2771–2786. [Google Scholar] [CrossRef] [PubMed]
- Bonaparte, M.I.; Dimitrov, A.S.; Bossart, K.N.; Crameri, G.; Mungall, B.A.; Bishop, K.A.; Choudhry, V.; Dimitrov, D.S.; Wang, L.-F.; Eaton, B.T.; et al. Ephrin-B2 ligand is a functional receptor for Hendra virus and Nipah virus. Proc. Natl. Acad. Sci. USA 2005, 102, 10652–10657. [Google Scholar] [CrossRef]
- Negrete, O.A.; Levroney, E.L.; Aguilar, H.C.; Bertolotti-Ciarlet, A.; Nazarian, R.; Tajyar, S.; Lee, B. EphrinB2 is the entry receptor for Nipah virus, an emergent deadly paramyxovirus. Nature 2005, 436, 401–405. [Google Scholar] [CrossRef]
- Negrete, O.A.; Wolf, M.C.; Aguilar, H.C.; Enterlein, S.; Wang, W.; Mühlberger, E.; Su, S.V.; Bertolotti-Ciarlet, A.; Flick, R.; Lee, B. Two key residues in ephrinB3 are critical for its use as an alternative receptor for Nipah virus. PLoS Pathog. 2006, 2, e7. [Google Scholar] [CrossRef]
- Bowden, T.A.; Aricescu, A.R.; Gilbert, R.J.C.; Grimes, J.M.; Jones, E.Y.; Stuart, D.I. Structural basis of Nipah and Hendra virus attachment to their cell-surface receptor ephrin-B2. Nat. Struct. Mol. Biol. 2008, 15, 567–572. [Google Scholar] [CrossRef]
- Lisabeth, E.M.; Falivelli, G.; Pasquale, E.B. Eph receptor signaling and ephrins. Cold Spring Harb. Perspect. Biol. 2013, 5, a009159. [Google Scholar] [CrossRef]
- Frisén, J.; Holmberg, J.; Barbacid, M. Ephrins and their Eph receptors: Multitalented directors of embryonic development. EMBO J. 1999, 18, 5159–5165. [Google Scholar] [CrossRef]
- Himanen, J.P.; Rajashankar, K.R.; Lackmann, M.; Cowan, C.A.; Henkemeyer, M.; Nikolov, D.B. Crystal structure of an Eph receptor-ephrin complex. Nature 2001, 414, 933–938. [Google Scholar] [CrossRef]
- Xu, K.; Chan, Y.-P.; Rajashankar, K.R.; Khetawat, D.; Yan, L.; Kolev, M.V.; Broder, C.C.; Nikolov, D.B. New insights into the Hendra virus attachment and entry process from structures of the virus G glycoprotein and its complex with Ephrin-B2. PLoS ONE 2012, 7, e48742. [Google Scholar] [CrossRef] [PubMed]
- Chang, A.; Dutch, R.E. Paramyxovirus fusion and entry: Multiple paths to a common end. Viruses 2012, 4, 613–636. [Google Scholar] [CrossRef] [PubMed]
- Steffen, D.L.; Xu, K.; Nikolov, D.B.; Broder, C.C. Henipavirus mediated membrane fusion, virus entry and targeted therapeutics. Viruses 2012, 4, 280–308. [Google Scholar] [CrossRef] [PubMed]
- Laing, E.D.; Navaratnarajah, C.K.; Da Cheliout Silva, S.; Petzing, S.R.; Xu, Y.; Sterling, S.L.; Marsh, G.A.; Wang, L.-F.; Amaya, M.; Nikolov, D.B.; et al. Structural and functional analyses reveal promiscuous and species specific use of ephrin receptors by Cedar virus. Proc. Natl. Acad. Sci. USA 2019, 116, 20707–20715. [Google Scholar] [CrossRef]
- Fischer, K.; Groschup, M.H.; Diederich, S. Importance of Endocytosis for the Biological Activity of Cedar Virus Fusion Protein. Cells 2020, 9, 2054. [Google Scholar] [CrossRef]
- Polyethylenimine (PEI), linear (1 mg/mL). Cold Spring Harbor Protocols 2008. [CrossRef]
- Shcherbo, D.; Merzlyak, E.M.; Chepurnykh, T.V.; Fradkov, A.F.; Ermakova, G.V.; Solovieva, E.A.; Lukyanov, K.A.; Bogdanova, E.A.; Zaraisky, A.G.; Lukyanov, S.; et al. Bright far-red fluorescent protein for whole-body imaging. Nat. Methods 2007, 4, 741–746. [Google Scholar] [CrossRef]
- Buchholz, U.J.; Finke, S.; Conzelmann, K.K. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J. Virol. 1999, 73, 251–259. [Google Scholar] [CrossRef]
- Schrell, L.; Fuchs, H.L.; Dickmanns, A.; Scheibner, D.; Olejnik, J.; Hume, A.J.; Reineking, W.; Störk, T.; Müller, M.; Graaf-Rau, A.; et al. Inhibitors of dihydroorotate dehydrogenase synergize with the broad antiviral activity of 4′-fluorouridine. Antivir. Res. 2025, 233, 106046. [Google Scholar] [CrossRef]
- Fiegl, D.; Kägebein, D.; Liebler-Tenorio, E.M.; Weisser, T.; Sens, M.; Gutjahr, M.; Knittler, M.R. Amphisomal route of MHC class I cross-presentation in bacteria-infected dendritic cells. J. Immunol. 2013, 190, 2791–2806. [Google Scholar] [CrossRef]
- Pei, G.; Buijze, H.; Liu, H.; Moura-Alves, P.; Goosmann, C.; Brinkmann, V.; Kawabe, H.; Dorhoi, A.; Kaufmann, S.H.E. The E3 ubiquitin ligase NEDD4 enhances killing of membrane-perturbing intracellular bacteria by promoting autophagy. Autophagy 2017, 13, 2041–2055. [Google Scholar] [CrossRef] [PubMed]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef] [PubMed]
- Friedrichs, V.; Balkema-Buschmann, A.; Dorhoi, A.; Pei, G. Selection and stability validation of reference gene candidates for transcriptional analysis in Rousettus aegyptiacus. Sci. Rep. 2021, 11, 21662. [Google Scholar] [CrossRef] [PubMed]
- Cooper, J.K.; Sykes, G.; King, S.; Cottrill, K.; Ivanova, N.V.; Hanner, R.; Ikonomi, P. Species identification in cell culture: A two-pronged molecular approach. Vitr. Cell. Dev. Biol.-Anim. 2007, 43, 344–351. [Google Scholar] [CrossRef]
- Patch, J.R.; Crameri, G.; Wang, L.-F.; Eaton, B.T.; Broder, C.C. Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein. Virol. J. 2007, 4, 1. [Google Scholar] [CrossRef]
- Dietzel, E.; Kolesnikova, L.; Sawatsky, B.; Heiner, A.; Weis, M.; Kobinger, G.P.; Becker, S.; von Messling, V.; Maisner, A. Nipah Virus Matrix Protein Influences Fusogenicity and Is Essential for Particle Infectivity and Stability. J. Virol. 2015, 90, 2514–2522. [Google Scholar] [CrossRef]
- Ciancanelli, M.J.; Basler, C.F. Mutation of YMYL in the Nipah virus matrix protein abrogates budding and alters subcellular localization. J. Virol. 2006, 80, 12070–12078. [Google Scholar] [CrossRef]
- Huynh-Do, U.; Vindis, C.; Liu, H.; Cerretti, D.P.; McGrew, J.T.; Enriquez, M.; Chen, J.; Daniel, T.O. Ephrin-B1 transduces signals to activate integrin-mediated migration, attachment and angiogenesis. J. Cell Sci. 2002, 115, 3073–3081. [Google Scholar] [CrossRef]
- Pryce, R.; Azarm, K.; Rissanen, I.; Harlos, K.; Bowden, T.A.; Lee, B. A key region of molecular specificity orchestrates unique ephrin-B1 utilization by Cedar virus. Life Sci. Alliance 2020, 3, e201900578. [Google Scholar] [CrossRef]
- Towner, J.S.; Amman, B.R.; Sealy, T.K.; Carroll, S.A.R.; Comer, J.A.; Kemp, A.; Swanepoel, R.; Paddock, C.D.; Balinandi, S.; Khristova, M.L.; et al. Isolation of genetically diverse Marburg viruses from Egyptian fruit bats. PLoS Pathog. 2009, 5, e1000536. [Google Scholar] [CrossRef]
- Towner, J.S.; Pourrut, X.; Albariño, C.G.; Nkogue, C.N.; Bird, B.H.; Grard, G.; Ksiazek, T.G.; Gonzalez, J.-P.; Nichol, S.T.; Leroy, E.M. Marburg virus infection detected in a common African bat. PLoS ONE 2007, 2, e764. [Google Scholar] [CrossRef] [PubMed]
- Albariño, C.G.; Foltzer, M.; Towner, J.S.; Rowe, L.A.; Campbell, S.; Jaramillo, C.M.; Bird, B.H.; Reeder, D.M.; Vodzak, M.E.; Rota, P.; et al. Novel paramyxovirus associated with severe acute febrile disease, South Sudan and Uganda, 2012. Emerg. Infect. Dis. 2014, 20, 211–216. [Google Scholar] [CrossRef] [PubMed]
- Amman, B.R.; Albariño, C.G.; Bird, B.H.; Nyakarahuka, L.; Sealy, T.K.; Balinandi, S.; Schuh, A.J.; Campbell, S.M.; Ströher, U.; Jones, M.E.B.; et al. A Recently Discovered Pathogenic Paramyxovirus, Sosuga Virus, is Present in Rousettus aegyptiacus Fruit Bats at Multiple Locations in Uganda. J. Wildl. Dis. 2015, 51, 774–779. [Google Scholar] [CrossRef] [PubMed]
- Mortlock, M.; Kuzmin, I.V.; Weyer, J.; Gilbert, A.T.; Agwanda, B.; Rupprecht, C.E.; Nel, L.H.; Kearney, T.; Malekani, J.M.; Markotter, W. Novel Paramyxoviruses in Bats from Sub-Saharan Africa, 2007–2012. Emerg. Infect. Dis. 2015, 21, 1840–1843. [Google Scholar] [CrossRef]
- Seifert, S.N.; Letko, M.C.; Bushmaker, T.; Laing, E.D.; Saturday, G.; Meade-White, K.; van Doremalen, N.; Broder, C.C.; Munster, V.J. Rousettus aegyptiacus Bats Do Not Support Productive Nipah Virus Replication. J. Infect. Dis. 2020, 221, S407–S413. [Google Scholar] [CrossRef]
- Mohl, B.-P.; Diederich, S.; Fischer, K.; Balkema-Buschmann, A. Rousettus aegyptiacus Fruit Bats Do Not Support Productive Replication of Cedar Virus upon Experimental Challenge. Viruses 2024, 16, 1359. [Google Scholar] [CrossRef]
- Xu, K.; Rajashankar, K.R.; Chan, Y.-P.; Himanen, J.P.; Broder, C.C.; Nikolov, D.B. Host cell recognition by the henipaviruses: Crystal structures of the Nipah G attachment glycoprotein and its complex with ephrin-B3. Proc. Natl. Acad. Sci. USA 2008, 105, 9953–9958. [Google Scholar] [CrossRef]
- Drescher, U. Eph family functions from an evolutionary perspective. Curr. Opin. Genet. Dev. 2002, 12, 397–402. [Google Scholar] [CrossRef]
- Williamson, M.M.; Hooper, P.T.; Selleck, P.W.; Westbury, H.A.; Slocombe, R.F. A guinea-pig model of Hendra virus encephalitis. J. Comp. Pathol. 2001, 124, 273–279. [Google Scholar] [CrossRef]
- Wong, K.T.; Grosjean, I.; Brisson, C.; Blanquier, B.; Fevre-Montange, M.; Bernard, A.; Loth, P.; Georges-Courbot, M.-C.; Chevallier, M.; Akaoka, H.; et al. A golden hamster model for human acute Nipah virus infection. Am. J. Pathol. 2003, 163, 2127–2137. [Google Scholar] [CrossRef]
- Bossart, K.N.; Zhu, Z.; Middleton, D.; Klippel, J.; Crameri, G.; Bingham, J.; McEachern, J.A.; Green, D.; Hancock, T.J.; Chan, Y.-P.; et al. A neutralizing human monoclonal antibody protects against lethal disease in a new ferret model of acute nipah virus infection. PLoS Pathog. 2009, 5, e1000642. [Google Scholar] [CrossRef] [PubMed]
- Mills, J.N.; Alim, A.N.M.; Bunning, M.L.; Lee, O.B.; Wagoner, K.D.; Amman, B.R.; Stockton, P.C.; Ksiazek, T.G. Nipah virus infection in dogs, Malaysia, 1999. Emerg. Infect. Dis. 2009, 15, 950–952. [Google Scholar] [CrossRef] [PubMed]
- Mungall, B.A.; Middleton, D.; Crameri, G.; Bingham, J.; Halpin, K.; Russell, G.; Green, D.; McEachern, J.; Pritchard, L.I.; Eaton, B.T.; et al. Feline model of acute nipah virus infection and protection with a soluble glycoprotein-based subunit vaccine. J. Virol. 2006, 80, 12293–12302. [Google Scholar] [CrossRef] [PubMed]
- Dups, J.; Middleton, D.; Long, F.; Arkinstall, R.; Marsh, G.A.; Wang, L.-F. Subclinical infection without encephalitis in mice following intranasal exposure to Nipah virus-Malaysia and Nipah virus-Bangladesh. Virol. J. 2014, 11, 102. [Google Scholar] [CrossRef]
- Dhondt, K.P.; Mathieu, C.; Chalons, M.; Reynaud, J.M.; Vallve, A.; Raoul, H.; Horvat, B. Type I interferon signaling protects mice from lethal henipavirus infection. J. Infect. Dis. 2013, 207, 142–151. [Google Scholar] [CrossRef]
- Robert, X.; Gouet, P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014, 42, W320–W324. [Google Scholar] [CrossRef]
shRNA | Target | Targeting Sequence |
---|---|---|
shRNA1 | ERB ephrin B2 | AGGAGACAAATTGGATATTAT |
shRNA2 | ERB ephrin B2 | GCCGGACATTCTGGGAATAAT |
shRNA3 | ERB ephrin B2 | TGTTGGCCAGTATGAATATTA |
shRNA4 | ERB ephrin B1 | TGGTCATCTACCCAAAGATTG |
shRNA5 | ERB ephrin B1 | AGCACCATGATTACTACATTA |
shRNA6 | ERB ephrin B1 | TGTGCTGGTCACCTGCAATAA |
Target | Primer Sequence | Amplicon Size |
---|---|---|
ERB ephrin A1 | F: TGGGCAAGGAGTTCAAAGAG R: AACCTCAAGCACCTGTCTTC | 97 bp |
ERB ephrin A2 | F: GCTCTTCACGCCCTTCTC R: GCCGCACGTAGACCTTC | 122 bp |
ERB ephrin A3 | F: CATGCGGTGTACTGGAACAG R: TTGTAGTGCGGGCAGTAAATATC | 104 bp |
ERB ephrin A4 | F: AAGGAGAGCAAGTCGGAGTC R: TCAGAGAACTCGCAGGAGTC | 147 bp |
ERB ephrin A5 | F: TCTACTGGAACAGCAGCAAC R: GGACATAACGCTCGGTCTTATC | 135 bp |
ERB ephrin B1 | F: GACTGTGAACCAGGAAGAGAAG R: CCGTCAGGAAGATGATGATGAG | 152 bp |
ERB ephrin B2 | F: TGGTACTATACCCACAGATAGGAG R: TTTGGCACAGTTGAGGAGAG | 167 bp |
ERB ephrin B3 | F: GAGAAGGTGAGTGGTGACTATG R: GTAGATGTTTGGAGGACTCTGG | 90 bp |
Egyptian Rousette bat CO1 | F: TTC TAC CCC CAT CTT TTC TTC TTC TAT TAG R: GGA TAG GGC TGG TGG TTT TAT ATT AAT AAT | 250 bp |
Tamarin monkey CO1 | F: TCA ACT TCA TCA CCA CAA TCA TTA ACA TAA R: CTC ATA CGA TAA ACC CTA AAA ATC CGA TAG | 400 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lenhard, L.; Müller, M.; Diederich, S.; Loerzer, L.; Friedrichs, V.; Köllner, B.; Finke, S.; Dorhoi, A.; Pei, G. Ephrin B1 and B2 Mediate Cedar Virus Entry into Egyptian Fruit Bat Cells. Viruses 2025, 17, 573. https://doi.org/10.3390/v17040573
Lenhard L, Müller M, Diederich S, Loerzer L, Friedrichs V, Köllner B, Finke S, Dorhoi A, Pei G. Ephrin B1 and B2 Mediate Cedar Virus Entry into Egyptian Fruit Bat Cells. Viruses. 2025; 17(4):573. https://doi.org/10.3390/v17040573
Chicago/Turabian StyleLenhard, Lea, Martin Müller, Sandra Diederich, Lisa Loerzer, Virginia Friedrichs, Bernd Köllner, Stefan Finke, Anca Dorhoi, and Gang Pei. 2025. "Ephrin B1 and B2 Mediate Cedar Virus Entry into Egyptian Fruit Bat Cells" Viruses 17, no. 4: 573. https://doi.org/10.3390/v17040573
APA StyleLenhard, L., Müller, M., Diederich, S., Loerzer, L., Friedrichs, V., Köllner, B., Finke, S., Dorhoi, A., & Pei, G. (2025). Ephrin B1 and B2 Mediate Cedar Virus Entry into Egyptian Fruit Bat Cells. Viruses, 17(4), 573. https://doi.org/10.3390/v17040573