Detection and Molecular Characterization of Novel Porcine Parvovirus 8 Strains in China
by
,
Wei Chen
†,
Yanqing Hu
†,
Yan Qin
,
Yuying Li
,
Xinyu Zhang
,
Haixin Huang
,
Mengjia Liu
,
Yuping Zheng
,
Xuelian Lu
,
Qiaoqiong Wang
,
Jianuo Yang
,
Liting Kang
,
Lulu Xie
,
Baopeng Zhao
,
Tian Lan
and
Wenchao Sun
* Wenzhou Key Laboratory for Virology and Immunology, Institute of Virology, Wenzhou University, Wenzhou 325035, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Viruses 2025, 17(4), 543; https://doi.org/10.3390/v17040543
Submission received: 21 March 2025
/
Revised: 3 April 2025
/
Accepted: 7 April 2025
/
Published: 8 April 2025
(This article belongs to the Collection Parvoviridae)
Abstract
:Porcine parvovirus 8 (PPV8), the most recently discovered PPV genotype, was first reported in pigs in Guangdong, China, in 2021. In this study, we assessed 69 lung tissue samples collected from animals with high fever or respiratory syndrome on pig farms in Guangxi in 2018. Five nearly full-length genome sequences were characterized and analyzed. The percentage of PPV8-positive samples was 13.04% (9/69), and five complete PPV8 sequences were obtained, which were designated PPV8-A, PPV-B, PPV8-G, PPV8-H, and PPV8-I. The genomic sequence homology among the five PPV8 strains and other PPVs was 25.91–98.84%, with the closest genetic relationship to PPV8-GDJM2021 (98.84%), followed by PPV1 (44.64%). For the NS1 protein, phylogenetic analysis revealed that the identified PPV8-I was closely related to PPV8-GDJM2021 and that PPV8-A was closely related to PPV8-H, whereas PPV8-B and PPV8-G were more distantly related to the other PPV8 strains. For the VP1 protein, phylogenetic analysis revealed a close correlation between PPV8-H and PPV8-GMJM2021, whereas PPV8-A, PPV8-B, PPV8-G, and PPV8-I were more distantly related. In conclusion, five nearly full-length sequences were amplified, and the molecular characteristics of PPV8 were analyzed. These findings improve our understanding of the PPV8 genome.
1. Introduction
Parvovirus is a member of the Parvoviridae family and is a small, flexible, nonenveloped, negative single-stranded linear DNA virus [1,2]. Parvoviridae contains three subfamilies: Parvovirinae and Hamaparvovirinae, which include viruses that infect vertebrate (including human) hosts, and Densovirinae, which includes viruses that infect invertebrate (including insect and arthropod) hosts [3,4]; viruses that infect pigs are of the Parvovirinae and Hamaparvovirinae subfamilies [5]. Currently, there are 9 parvovirus genera, of which Protoparvovirus, Teraparovirus, Chapparvovirus, Copiparvovirus, and Bocaparvovirus infect swine [6,7]. The porcine parvovirus genome is approximately [4,5,6] kb long and contains two major open reading frames, ORF1 and ORF2, which encode nonstructural (NS) proteins and viral capsid (VP) proteins, respectively (Figure 1). The NS proteins play an important role in viral replication, especially in DNA replication, whereas the VP proteins are related to the transcription and translation of the parvovirus genomes [8,9]. In addition, a 5′-untranslated region (UTR) and a 3′-untranslated region (UTR) exist at the ends of the parvovirus genome, which usually form complex palindromic hairpin structures of approximately 120–200 bases [10].
To date, eight genotypes of porcine parvovirus have been identified (PPV1–PPV8), and these have been designated as novel PPVs (nPPVs). Porcine parvovirus 1 (PPV1), which is one of the major causes of reproductive pig disease, was first isolated in Germany in 1965 [11,12]. PPV1 belongs to the genus Protoparvovirus and has been shown to be responsible for stillbirth, mummification, embryonic death, and infertility [7,13]. During the last two decades, several novel parvoviruses have been identified in pigs by molecular methods and have been designated as PPV2–PPV8. PPV2 was discovered in 2001 in Myanmar and was proposed as the primary pathogen of the porcine respiratory disease complex (PRDC) [14,15]. April Nelson et al. reported that the accumulation of PPV2 nucleic acid in the cytoplasm of alveolar macrophages may be due to the phagocytosis of viruses during viremia or active PPV2 replication [16]. PPV3, also known as porcine PARV4 and porcine Hoko virus and closely related to human parvovirus 4 (PARV4), was identified in Hong Kong in 2008 [17]. These viruses all belong to the Tetraparvovirus genus. Three PPVs, PPV4, PPV5, and PPV6, have been identified and belong to the genus Copiparvovirus [10]. PPV7 was discovered in the United States in 2016 and belongs to the genus Chaphamaparvovirus [18]. To date, the specific pathogenic mechanism of the PPV3–PPV8 viruses is unknown, and further research is needed. However, at present, many studies have reported the coinfection of PPVs with other disease-causing pathogens. Komina et al. reported signs of apoptosis and necrosis in cell cultures of SPEV and SK cells infected with PPV6, indicating that the pathogenic mechanism of PPV6 may be closely related to these processes [19]. In addition, PPV1 and PPV6 showed a clear coinfection association with PCV2-associated diseases (PCVADs) regardless of PRRSV infection, and PPV2 and PPV7 showed a clear coinfection association with PRRSV regardless of PCVAD [20]. In addition, Jinhui Mai et al. speculated that PPV7 is an important cofactor of PCV3 that can stimulate the replication of PCV3 and increase its viral load [21]. These findings indicate that porcine parvovirus has a significant effect on the reproduction and breeding of swine, making research on porcine parvovirus particularly important.
In this study, we detected the presence of PPV8 in lung tissue samples from diseased pigs with detection primers, with 9 out of 69 samples showing positivity. Five of the PPV8 strains were sequenced and designated PPV8-A, PPV8-B, PPV8-G, PPV8-H, and PPV8-I. In this experiment, we generated near-complete genome data for five different PPV8 strains and performed sequence alignment and phylogenetic tree analysis, laying the foundation for future research on PPV8.
2. Materials and Methods
2.1. Clinical Samples
In this experiment, we collected 69 lung tissue samples from pigs with high fever or respiratory syndrome on pig farms in Guangxi Province in 2018, homogenized them, and stored them at −80 °C.
2.2. Sample Processing
To investigate the presence of DNA viruses in pigs with high fever or respiratory syndrome, 1.0 g of the 69 lung tissue samples were weighed into 1.5 mL centrifuge tubes, and 300 µL of PBS was added to each tube for homogenization. The tubes were centrifuged at 12,000 rpm for 10 min at 4 °C, and two-thirds of the supernatant was collected and filtered through a 0.45 µm filter [22,23]. We subsequently used a TIANamp virus DNA/RNA Fast Kit (TIANGEN, Beijing, China) to extract total DNA. Next, the extracted DNA was subjected to PCR. In addition, we filtered and sterilized the remaining supernatant with a 0.22 µm filter and stored it at −80 °C for virus isolation.
2.3. PCR Detection of PPV8 and Sequencing
To determine the prevalence of PPV8 in pig farms in Guangxi, the nest-PCR (nPCR) method was used to detect PPV8-positive samples among the 69 clinical samples. A total of 9 positive samples were detected, 5 of which were further characterized. PPV8-specific primers were designed on the basis of the conserved sequence of the PPV8-GDJM2021 strain (GenBank: OP021638.1) [24]. PCR amplification was performed with the outer detection primer pair PPV8-outF/R and the inner detection primer pair PPV8-inF/R. The thermal cycling conditions involved 35 cycles of denaturation, annealing, and extension for nested PCR (Table 1). We sent the positive samples to Sangon Biotech (Shanghai, China) for sequencing and removed the false positive samples through BLAST 1.4.0 identification. Four pairs of primers were subsequently designed on the basis of conserved regions of the nearly full-length sequence of PPV8-GDJM2021 to amplify four DNA fragments [25]. The specific annealing temperatures for each pair of primers and the primer sequences are shown in Table 1. nPCR amplification was performed under the same conditions. The PCR products were analyzed on a 1% agarose gel containing Tris-acetate buffer solution (pH 8.0) and Gelstain (TransGen Biotech, Beijing, China) [26]. We cloned the target fragment into the pMD™18-T vector (TaKaRa, Hong Kong, China) [26] and sent the positive clones to a bioinformatics company for sequencing. These sequences were then assembled with the SeqMan program in the DNASTAR package [27]. Afterward, the splicing results were analyzed for amino acid and nucleotide sequences.
2.4. Sequence Alignment and Phylogenetic Analysis
Sequence comparison was conducted with MEGA 11 to analyze the sequence differences of nucleotides (nt) and amino acids (aa) between PPV8-GDJM2021 and the five DNA sequences assessed in this analysis. A maximum likelihood tree (MLT) model (T92+G) with the Tamura–Nei model was constructed with MEGA 11 software [28]. Bootstrap analysis (1000 replicates) was used to construct a phylogenetic tree [29]. We then used the Evolview optimization tool to construct the evolutionary tree [30]. In addition to those of PPV1–PPV8, the nucleic acid sequences encoding the NS1 protein of several other parvoviruses were obtained from GenBank.
2.5. Nucleotide Sequence Accession Numbers
The obtained sequences were assembled into full genomes with Lasergene software 17.3.1 and deposited in the NCBI GenBank database under the following accession numbers: PP842644–PP842648. For genetic analysis, Parvoviridae family genomes were retrieved from GenBank. The general information and accession numbers of all 46 porcine parvovirus strains are listed in Table A1.
3. Results
3.1. Genomic and Amino Acid Structure Analysis of PPV8
The near-full-length genome of PPV8 contained 4211~4215 bases with a G + C content ranging from 36.14 to 36.74%. The genome sizes are expected to be larger, and sequencing of the ends may have been hampered by palindromic structures 10. Restriction enzyme site analysis was performed with DNAMAN 10.0 software, and strains A, B, G, H, and I had 66, 63, 70, 57, and 62 restriction enzyme sites, respectively.
Putative ORFs were obtained with the NCBI ORF Finder tool and then identified by protein BLAST 1.4.0 analysis with the NCBI RefSeq database [31]. ORF1 is 1806 nt long and encodes a putative nonstructural protein (NSP) of 601 amino acids (aa), and ORF2 is 2106 nt long and encodes a putative capsid protein (VP) of 701 amino acids (aa) (Figure 1). ORF1 and ORF2 overlap by 14 nt, which is consistent with the reported PPV8-GDJM2021 sequence and inconsistent with the ORFs of other PPVs (PPV1–PPV7) [32]. The genomes of the five PPV8 strains in this research contained a 5′-untranslated region (UTR) of more than 200 nt and a 3′-untranslated region (UTR) of more than 191 nt at both ends.
The amino acid sequences of the five PPV8 strains identified in this study were subsequently analyzed. The sequences of the five strains were aligned pairwise, and multiple sequences were aligned with PPV8 with DNAMAN and MEGA 11 software.
Pairwise comparisons were performed for the nucleotide sequences and predicted amino acid sequences of the five PPV8 strains with those of other PPVs. The results revealed that the genomes of the five PPV8 strains shared 25.91–44.64% DNA sequence identity with those of other members of Parvovirinae (PPV1–PPV7) and were most closely related to those of PPV1 (Table A1). Within NS1 (VP1), the five strains presented 98.84–99.67% (98.57–99.43%) and 98.67–99% (97.69–98.53%) sequence homology with the PPV8-GDJM2021 strain at the amino acid and nucleotide levels, respectively.
A comparison of the NS1 sequences of the five PPV8 strains with those of PPV8-GDJM2021, PPV1, PPV2, and PPV3 revealed that they all contain conserved ATP- or GTP-binding Walker A loop (GxxxxGKT/S; GPTSTGKS), Walker B (xxxxEE; LGWFEE), Walker B’ (KxxxxGxxxxxxxK; KALTSGQNIRVDQK), and Walker C (PIxIXXN; PILITSN) aa motifs [33]. In addition, the NS1 protein contains two conserved replication initiator (endonuclease) motifs, xxHuHxxxx (GLHFHVLLW) and YxxxK (YFLKK) (conserved amino acids are indicated at the bottom of the alignment, and “u” indicates a hydrophobic residue) (Figure 2). Similarly, the VP1 protein also has a similar conserved domain. A comparison of the VP1 sequences of the five PPV8 strains with those of other PPVs revealed that they all have a conserved motif in the catalytic center (DxxAxxHDxxY; DAAARKHDIAY) of the putative phospholipase A2 domain and that the five PPV8 strains contain a calcium-binding loop (YLGPF) rather than the “YxGxG” motif found in most PPVs [34] (Figure 3).
3.2. Phylogenetic Analysis of PPV8
A phylogenetic analysis of 51 PPV strains selected from GenBank and the 5 PPV8 strains identified in this investigation was conducted based on the nucleotide sequences of the NS1 protein and the VP1 protein (Table A2). As shown in Figure 4, for the NS1 protein, the five PPV8 strains identified in this analysis clustered with PPV8-GDJM2021 and belonged to the genus Protoparvovirus but branched from other Protoparvovirus strains. In addition, PPV8-I was closely related to PPV8-GDJM2021, and PPV8-A was closely related to PPV8-H. PPV8-B and PPV8-G were closely related to the other PPV8 strains. As shown in Figure 5, the phylogenetic tree of VP1 indicated a close correlation between PPV8-H and PPV8-GMJM2021, whereas PPV8-A, PPV8-B, PPV8-G, and PPV8-I were more distantly related.
4. Discussion and Conclusions
In recent years, increasing attention and research have focused on DNA viruses that infect pigs, especially porcine parvovirus. With the development of sequencing technology, eight types of porcine parvoviruses (PPV1–PPV8) have been identified in swine populations, among which PPV2–PPV8 are known as new PPVs (nPPVs) [15]. On the basis of the homology of the NS1 protein sequence, parvoviruses are classified as Protoparvovirus (PPV1, PPV8), Tetraparvovirus (PPV2–PPV3), Copiparvovirus (PPV4–PPV6), or Chapparvovirus (PPV7) [6,35,36]. Among these, the most recently reported PPV8 was initially identified by high-throughput sequencing (HTS) in porcine reproductive and respiratory syndrome virus (PRRSV)-positive samples collected from swine herds in Guangdong Province in 2021. PPV8 shares 31.86–32.68% aa sequence identity with the NS1 protein of PPV1 and porcine bufavirus (PBuV) and represents a new species within the Protoparvovirus genus [32].
The newly discovered PPV8 and PPV1 strains belong to the same Protoparvovirus genus. PPV8 was discovered four years ago. However, there are currently few reports on the PPV8 strain. To fill this knowledge gap, we conducted genome detection and identification on 69 lung tissue samples from sick swine from a pig farm in Guangxi. The PPV8-positive rate was 13.04% (9/69). In this review, we reported the near-complete genome sequences of five strains (PPV8-A, B, G, H, and I). These strains were identified by BLASTN and were found to have 97.48–97.81% similarity to PPV8-GDJM2021. For the NS1 gene, the five PPV8 strains presented 98.84–99.67% and 98.67–99% sequence homology with the PPV8-GDJM2021 strain at the amino acid and nucleotide levels, respectively. We also conducted a phylogenetic tree analysis of the five strains with other members of the Parvoviridae family and reported that PPV8-I was closely related to PPV8-GDJM2021 and that PPV8-A was closely related to PPV8-H, whereas PPV8-B and PPV8-G were more distantly related to the other PPV8 strains.
In conclusion, five nearly full-length sequences were amplified, and the molecular characteristics of PPV8 were analyzed. These findings improve our understanding of the PPV8 genome. Although we have reported five strains of PPV8, their biological characteristics and relationships with diseases are still not fully understood. Further research on PPV8 in the future will help address these questions.
Author Contributions
Methodology, W.C., Y.H., Y.Q., Y.L. and X.Z.; Resources, X.Z.; Software, W.C., H.H., M.L., Y.Z., X.L., Q.W., J.Y., L.K., L.X. and B.Z.; Writing—original draft, W.C.; Writing—review and editing, W.S. and T.L. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the Wenzhou Basic Agricultural Science and Technology Project (Grant Numbers N2023002 and Y20220136).
Institutional Review Board Statement
All clinical samples used in this experiment were collected with informed consent from veterinarians or farm owners and adhered to a high standard (best practice) of veterinary care. All experiments were carried out in strict accordance with the regulations in the Guide for the Care and Use of Laboratory Animals of the Guangxi Center for Animal Disease Control and Prevention. This study was approved by the Animal Ethics Committee of Wenzhou University (WZU-009) and the Animal Ethics Committee of Guangxi Center for Animal Disease Control and Prevention. All the experiments were reviewed and approved by the Laboratory Animal Ethics Committee of Wenzhou University (Approval number: WZU-2022-014).
Informed Consent Statement
Written informed consent to use the clinical samples in this study was obtained from the animals’ owners.
Data Availability Statement
Whole-genome sequences of PPV8 discovered in this project are available in GenBank under accession nos. PP842644–PP842648.
Acknowledgments
We thank Zheng Min for providing us with tissue samples of porcine parvovirus 8.
Conflicts of Interest
The authors declare no conflicts of interest.
Appendix A
Table A1.
Nucleotide and amino acid identities of the five PPV8 strains compared with those of the PPVs.
Table A1.
Nucleotide and amino acid identities of the five PPV8 strains compared with those of the PPVs.
| PPV8-A | PPV8-B | PPV8-G | PPV8-H | PPV8-I | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Genome (nt) | NS (nt/aa) | VP (nt/aa) | Genome (nt) | NS (nt/aa) | VP (nt/aa) | Genome (nt) | NS (nt/aa) | VP (nt/aa) | Genome (nt) | NS (nt/aa) | VP (nt/aa) | Genome (nt) | NS (nt/aa) | VP (nt/aa) | ||
| Protoparvovirus | PPV1 | 44.44 | 47.89/36.67 | 52.15/34.33 | 44.54 | 47.40/31.80 | 52.56/34.70 | 44.50 | 47.59/31.66 | 52.69/34.43 | 44.54 | 47.59/31.66 | 52.88/34.15 | 44.64 | 47.54/31.66 | 52.92/34.56 |
| PPV8 | 98.36 | 98.67/99.17 | 97.69/98.57 | 98.69 | 98.84/99.00 | 98.53/99.43 | 98.53 | 98.73/99.00 | 98.44/98.86 | 97.77 | 99.00/99.67 | 98.20/99.26 | 98.84 | 98.89/99.67 | 98.48/99.14 | |
| Copiparvovirus | PPV4 | 29.91 | 36.98/19.14 | 40.05/13.93 | 30.26 | 37.29/19.44 | 39.72/13.91 | 30.22 | 37.24/20.64 | 40.04/14.19 | 30.35 | 37.05/19.29 | 40.24/14.04 | 30.29 | 37.93/19.29 | 39.99/13.91 |
| PPV5 | 32.37 | 39.61/16.92 | 29.37/12.70 | 32.90 | 40.38/19.46 | 30.28/12.75 | 31.59 | 39.50/19.91 | 30.27/12.30 | 32.41 | 39.97/19.31 | 30.78/12.40 | 31.93 | 39.9/19.31 | 30.84/12.40 | |
| PPV6 | 26.67 | 34.90/17.44 | 24.06/10.68 | 26.03 | 34.68/17.30 | 23.74/11.17 | 26.45 | 33.75/17.44 | 23.82/10.68 | 26.07 | 34.48/17.57 | 23.89/10.68 | 26.27 | 34.93/17.44 | 23.95/10.77 | |
| Tetraparvovirus | PPV2 | 30.48 | 34.84/28.22 | 26.67/11.75 | 30.55 | 35.23/14.34 | 26.63/12.94 | 30.59 | 34.97/14.48 | 27.51/11.80 | 30.30 | 34.58/14.48 | 26.89/11.70 | 30.40 | 35.01/14.48 | 28.41/12.09 |
| PPV3 | 31.26 | 34.45/14.57 | 29.55/12.09 | 31.02 | 34.50/14.71 | 29.47/12.18 | 31.30 | 34.50/14.71 | 29.56/12.29 | 31.23 | 34.98/14.57 | 30.88/12.39 | 31.52 | 35.16/14.57 | 29.77/12.18 | |
| Chapparvovirus | PPV7 | 37.62 | 37.36/8.74 | 29.69/9.86 | 38.24 | 37.66/8.89 | 29.72/8.26 | 38.80 | 37.41/8.70 | 29.68/9.69 | 37.43 | 37.28/8.89 | 30.00/10.26 | 38.05 | 37.46/9.79 | 29.76/10.11 |
Table A2.
Information on the parvovirus strains used in this study.
| Virus Strain | Date | Origin | Accession No. |
|---|---|---|---|
| Muscovy duck parvovirus | 2020 | China | MT450871.1 |
| Bat adeno-associated virus YNM | 2010 | USA | NC_014468.1 |
| Bearded dragon parvovirus | 2019 | USA | MN480432.1 |
| Goose parvovirus | 2011 | China | JF333590.1 |
| Bovine adeno-associated virus | 2003 | USA | AY388617.1 |
| Bovine parvovirus 2 | 2001 | USA | AF406966.1 |
| Porcine parvovirus 4 | 2009 | USA | GQ387499.1 |
| Porcine parvovirus 5 | 2012 | USA | JX896318.1 |
| Porcine parvovirus 6 | 2013 | China | NC_023860.1 |
| Eidolon helvum parvovirus 1 | 2011 | The Netherlands | NC_016744.1 |
| Eidolon helvum parvovirus 1 | 2011 | The Netherlands | JQ037753.1 |
| Human parv4 G3 | 2008 | UK | EU874248.1 |
| Parvovirus YX-2010/CHN | 2010 | China | GU938300.1 |
| Porcine hokovirus | 2011 | Romania | JF738362.1 |
| Ovine hokovirus 1 | 2011 | China | NC_038547.1 |
| Bovine hokovirus 1 | 2018 | Brazil | MG745679.1 |
| Porcine hokovirus | 2007 | China | EU200677.1 |
| Porcine parvovirus 2 | 2017 | Brazil | KY586144.1 |
| Porcine parvovirus 3 | 2017 | Brazil | KY586145.1 |
| Human parvovirus B19 | 1999 | Japan | AB030673.1 |
| Chipmunk parvovirus | 2009 | USA | NC_038543.1 |
| Simian parvovirus | 2018 | USA | NC_038540.1 |
| Pig-tailed macaque parvovirus | 2018 | USA | NC_038542.1 |
| Raccoon dog amdovirus | 2020 | China | MT498601.1 |
| Gray fox amdovirus | 2011 | USA | NC_038533.1 |
| Aleutian mink disease parvovirus | 2015 | Canada | KT878967.1 |
| Minute virus of mice | 2005 | USA | DQ196317.1 |
| Canine parvovirus | 1988 | Swedeland | M19296.1 |
| Feline panleukopenia virus (FPV) | 1990 | Australia | X55115.1 |
| Sea otter parvovirus 1 | 2016 | USA | KU561552.1 |
| Porcine bufavirus | 2018 | China | MK279317.1 |
| Rat parvovirus 1a | 1997 | USA | NC_038545.1 |
| Protoparvovirus eulipotyphla1 | 2014 | Japan | AB937988.1 |
| Fox parvovirus | 2013 | The Netherlands | KC692368.1 |
| Porcine parvovirus | 1993 | USA | NC_001718. |
| Porcine parvovirus 8 | 2021 | China | OP021638.1 |
| Chicken parvovirus | 2009 | USA | GU214704.1 |
| Pigeon parvovirus A | 2013 | USA | KC876004.1 |
| Bovine parvovirus 1 | 2020 | China | MW032437.1 |
| Porcine bocavirus H18 | 2010 | China | HQ291308.1 |
| Bocaparvovirus primate1 | 2005 | Sweden | DQ000496.1 |
| Porcine bocavirus 2 | 2010 | China | HM053694.2 |
| Porcine bocavirus 1 | 2016 | China | HM053693.2 |
| Porcine bocavirus 3 | 2011 | China | JF429834.1 |
| Porcine bocavirus 4-2 | 2011 | China | JF429836.1 |
| Bocavirus pig/SX/China/2010 | 2010 | China | HQ223038.1 |
| Canine minute virus | 2008 | USA | FJ214110.1 |
| Turkey parvovirus | 2016 | China | KX084398.1 |
| Turkey parvovirus TP1-2012/HUN | 2018 | Hungary | KF880727.1 |
| Eidolon helvum parvovirus 2 | 2012 | UK | JX885610.1 |
| Porcine parvovirus 7 | 2016 | USA | KU563733.1 |
References
- Xie, C.; Tao, Y.; Zhang, Y.; Zhang, P.; Zhu, X.; Ha, Z.; Zhang, H.; Xie, Y.; Xia, X.; Jin, N.; et al. Codon Usage for Genetic Diversity, and Evolutionary Dynamics of Novel Porcine Parvoviruses 2 through 7 (PPV2–PPV7). Viruses 2022, 14, 170. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Wang, X.; Ren, Y.; Cui, S.; Li, G.; Ren, X. Genome Sequence of Chinese Porcine Parvovirus Strain PPV2010. J. Virol. 2012, 86, 2379. [Google Scholar] [CrossRef]
- Cotmore, S.F.; Agbandje-McKenna, M.; Chiorini, J.A.; Mukha, D.V.; Pintel, D.J.; Qiu, J.; Soderlund-Venermo, M.; Tattersall, P.; Tijssen, P.; Gatherer, D.; et al. The Family Parvoviridae. Arch. Virol. 2014, 159, 1239–1247. [Google Scholar] [CrossRef]
- Cotmore, S.F.; Agbandje-McKenna, M.; Canuti, M.; Chiorini, J.A.; Eis-Hubinger, A.M.; Hughes, J.; Mietzsch, M.; Modha, S.; Ogliastro, M.; Pénzes, J.J.; et al. ICTV Virus Taxonomy Profile: Parvoviridae. J. Gen. Virol. 2019, 100, 367–368. [Google Scholar] [CrossRef]
- Li, J.; Xiao, Y.; Qiu, M.; Li, X.; Li, S.; Lin, H.; Li, X.; Zhu, J.; Chen, N.; Jones, C.J. A Systematic Investigation Unveils High Coinfection Status of Porcine Parvovirus Types 1 through 7 in China from 2016 to 2020. Microbiol. Spectr. 2021, 9, e01294-21. [Google Scholar] [CrossRef]
- Wen, S.; Song, Y.; Lv, X.; Meng, X.; Liu, K.; Yang, J.; Diao, F.; He, J.; Huo, X.; Chen, Z.; et al. Detection and Molecular Characterization of Porcine Parvovirus 7 in Eastern Inner Mongolia Autonomous Region, China. Front. Vet. Sci. 2022, 9, 930123. [Google Scholar] [CrossRef]
- Xing, X.; Zhou, H.; Tong, L.; Chen, Y.; Sun, Y.; Wang, H.; Zhang, G. First Identification of Porcine Parvovirus 7 in China. Arch. Virol. 2018, 163, 209–213. [Google Scholar] [CrossRef]
- Streck, A.F.; Truyen, U. Porcine Parvovirus. Curr. Issues Mol. Biol. 2020, 37, 33–45. [Google Scholar] [CrossRef]
- Afolabi, K.O.; Iweriebor, B.C.; Obi, L.C.; Okoh, A.I. Prevalence of Porcine Parvoviruses in Some South African Swine Herds with Background of Porcine Circovirus Type 2 Infection. Acta Trop. 2019, 190, 37–44. [Google Scholar] [CrossRef]
- Streck, A.F.; Canal, C.W.; Truyen, U. Molecular Epidemiology Evolution of Porcine Parvoviruses. In Infection, Genetics and Evolution; Elsevier: Amsterdam, The Netherlands, 2015; pp. 300–306. [Google Scholar] [CrossRef]
- Zhao, K.; Hu, R.; Ni, J.; Liang, J.; He, X.; Du, Y.; Xu, Y.; Zhao, B.; Zhang, Q.; Li, C. Establishment of a Porcine Parvovirus (PPV) LAMP Visual Rapid Detection Method. J. Virol. Methods 2020, 284, 113924. [Google Scholar] [CrossRef]
- Oh, W.T.; Kim, R.Y.; Nguyen, V.G.; Chung, H.C.; Park, B.K. Perspectives on the Evolution of Porcine Parvovirus. Viruses 2017, 9, 196. [Google Scholar] [CrossRef] [PubMed]
- Molini, U.; Coetzee, L.M.; Hemberger, M.Y.; Khaiseb, S.; Cattoli, G.; Dundon, W.G. Evidence Indicating Transmission of Porcine Parvovirus 1 between Warthogs and Domestic Pigs in Namibia. Vet. Res. Commun. 2023, 47, 981–985. [Google Scholar] [CrossRef] [PubMed]
- Hijikata, M.; Abe, K.; Win, K.M.; Shimizu, Y.K.; Keicho, N.; Yoshikura, H. Identification of New Parvovirus DNA Sequence in Swine Sera from Myanmar. Jpn. J. Infect. Dis. 2001, 54, 244–245. [Google Scholar] [CrossRef] [PubMed]
- Vargas-Bermudez, D.S.; Mogollon, J.D.; Franco-Rodriguez, C.; Jaime, J. The Novel Porcine Parvoviruses: Current State of Knowledge and Their Possible Implications in Clinical Syndromes in Pigs. Viruses 2023, 15, 2398. [Google Scholar] [CrossRef]
- Nelsen, A.; Lin, C.M.; Hause, B.M. Porcine Parvovirus 2 Is Predominantly Associated with Macrophages in Porcine Respiratory Disease Complex. Front. Vet. Sci. 2021, 8, 726884. [Google Scholar] [CrossRef]
- Lau, S.K.P.; Woo, P.C.Y.; Tse, H.; Fu, C.T.Y.; Au, W.K.; Chen, X.C.; Tsoi, H.W.; Tsang, T.H.F.; Chan, J.S.Y.; Tsang, D.N.C.; et al. Identification of Novel Porcine and Bovine Parvoviruses Closely Related to Human Parvovirus 4. J. Gen. Virol. 2008, 89, 1840–1848. [Google Scholar] [CrossRef]
- Palinski, R.M.; Mitra, N.; Hause, B.M. Discovery of a Novel Parvovirinae Virus, Porcine Parvovirus 7, by Metagenomic Sequencing of Porcine Rectal Swabs. Virus Genes 2016, 52, 564–567. [Google Scholar] [CrossRef]
- Komina, A.; Anoyatbekova, A.; Krasnikov, N.; Yuzhakov, A. Identification and in Vitro Characterization of a Novel Porcine Parvovirus 6 in Russia. Vet. Res. Commun. 2024, 48, 417–425. [Google Scholar] [CrossRef]
- Kim, S.-C.; Kim, J.-H.; Kim, J.-Y.; Park, G.-S.; Jeong, C.-G.; Kim, W.-I. Prevalence of Porcine Parvovirus 1 through 7 (PPV1-PPV7) and Co-Factor Association with PCV2 and PRRSV in Korea. BMC Vet. Res. 2022, 18, 133. [Google Scholar] [CrossRef]
- Mai, J.; Wang, D.; Zou, Y.; Zhang, S.; Meng, C.; Wang, A.; Wang, N. High Co-Infection Status of Novel Porcine Parvovirus 7 With Porcine Circovirus 3 in Sows That Experienced Reproductive Failure. Front. Vet. Sci. 2021, 8, 695553. [Google Scholar] [CrossRef]
- Sun, X.; Zhang, Q.; Shan, H.; Cao, Z.; Huang, J. Genome Characteristics of Atypical Porcine Pestivirus from Abortion Cases in Shandong Province, China. Virol. J. 2023, 20, 282. [Google Scholar] [CrossRef] [PubMed]
- Miłek, D.; Woźniak, A.; Guzowska, M.; Stadejek, T. Detection Patterns of Porcine Parvovirus (PPV) and Novel Porcine Parvoviruses 2 through 6 (PPV2–PPV6) in Polish Swine Farms. Viruses 2019, 11, 474. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yang, K.K.; Wang, J.; Wang, X.P.; Zhao, L.; Sun, P.; Li, Y.D. Detection and Molecular Characterization of Novel Porcine Parvovirus 7 in Anhui Province from Central-Eastern China. Infect. Genet. Evol. 2019, 71, 31–35. [Google Scholar] [CrossRef]
- Zhao, W.; Sun, Y.; Guo, L.; Zhang, Y.; Huang, B.; Tian, K. Genome Sequence of Chinese Porcine Parvovirus Strain BJ2. Microbiol. Resour. Announc. 2023, 12, e00094-23. [Google Scholar] [CrossRef]
- Lyu, Z.; Zhang, X.; Xue, S.; Yang, X.; Liu, J.; Fan, K.; Dai, A. Detection and Genetic Evolution Analysis of Porcine Parvovirus Type 7 (PPV7) in Fujian Province. Infect. Genet. Evol. 2023, 115, 105515. [Google Scholar] [CrossRef]
- Deng, S.; Zhiyong, H.; Mengjiao, Z.; Shuangqi, F.; Jingyuan, Z.; Yunzhen, H.; Hailuan, X.; Jinding, C. Isolation and Phylogenetic Analysis of a New Porcine Parvovirus Strain GD2013 in China. J. Virol. Methods 2020, 275, 113748. [Google Scholar] [CrossRef]
- Parthiban, S.; Sowndhraya, R.K.V.; Raja, P.; Parthiban, M.; Ramesh, A.; Raj, G.D.; Senthilkumar, K.; Balasubramanyam, D.; Hemalatha, S.; Bharathi, R.; et al. Molecular Detection of Porcine Parvovirus 1–Associated Reproductive Failure in Southern India. Trop. Anim. Health Prod. 2022, 54, 195. [Google Scholar] [CrossRef]
- Thuy, N.T.D.; Trung, N.T.; Dung, T.Q.; Khoa, D.V.A.; Thuy, D.T.N.; Opriessnig, T. First Investigation of the Prevalence of Parvoviruses in Slaughterhouse Pigs and Genomic Characterization of Ungulate Copiparvovirus 2 in Vietnam. Arch. Virol. 2021, 166, 779–788. [Google Scholar] [CrossRef]
- Subramanian, B.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.-H. Evolview v3: A Webserver for Visualization, Annotation, and Management of Phylogenetic Trees. Nucleic Acids Res. 2019, 47, W270–W275. [Google Scholar] [CrossRef]
- Ni, J.; Qiao, C.; Han, X.; Han, T.; Kang, W.; Zi, Z.; Cao, Z.; Zhai, X.; Cai, X. Identification and Genomic Characterization of a Novel Porcine Parvovirus (PPV6) in China. Virol. J. 2014, 11, 203. [Google Scholar] [CrossRef]
- Li, L.-F.; Chen, N.; Zhang, X.; Huang, L.; Guo, Y.; Yan, G.; Chen, S.; Han, H.; Li, J.; Zhang, H.; et al. Identification and Genomic Characterization of a Novel Porcine Parvovirus in China. Front. Vet. Sci. 2022, 9, 1009103. [Google Scholar]
- Hargitai, R.; Boros, Á.; Pankovics, P.; Mátics, R.; Altan, E.; Delwart, E.; Reuter, G. Detection and Genetic Characterization of a Novel Parvovirus (Family Parvoviridae) in Barn Owls (Tyto Alba) in Hungary. Arch. Virol. 2021, 166, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Zádori, Z.; Szelei, J.; Lacoste, M.-C.; Li, Y.; Gariépy, S.; Raymond, P.; Allaire, M.; Nabi, I.R.; Tijssen, P. A Viral Phospholipase A 2 Is Required for Parvovirus Infectivity (Takahashi et al., 1998b) Remain to Be Confirmed (Moore, 2000). Dev. Cell 2001, 1, 291–302. [Google Scholar] [PubMed]
- Zhang, X.; Zheng, C.; Lv, Z.; Xue, S.; Chen, Y.; Liu, Y.; Huang, X.; Luo, G.; Yang, X.; Dai, A. Genetic and Epidemic Characteristics of Porcine Parvovirus 7 in the Fujian and Guangdong Regions of Southern China. Front. Vet. Sci. 2022, 9, 949764. [Google Scholar] [CrossRef]
- Park, G.N.; Song, S.; Cha, R.M.; Choe, S.E.; Shin, J.; Kim, S.Y.; Hyun, B.H.; Park, B.K.; An, D.J. Genetic Analysis of Porcine Parvoviruses Detected in South Korean Wild Boars. Arch. Virol. 2021, 166, 2249–2254. [Google Scholar] [CrossRef]
Figure 1.
Genomic structures of eight species of porcine parvovirus.
Figure 2.
Multiple sequence alignment of the NS1 motif of five PPV8 strains with those of other PPVs. The conserved motifs in the helicase domain of the NS1 proteins and ATP- or GTP-binding regions including xxHuHxxxx (GLHFHVLLW), YxxxK (YFLKK), and Walker motifs (A, B, B’, and C).
Figure 2.
Multiple sequence alignment of the NS1 motif of five PPV8 strains with those of other PPVs. The conserved motifs in the helicase domain of the NS1 proteins and ATP- or GTP-binding regions including xxHuHxxxx (GLHFHVLLW), YxxxK (YFLKK), and Walker motifs (A, B, B’, and C).
Figure 3.
Multiple sequence alignment of the VP1 motif of five PPV8 strains with those of other PPVs. Conserved motifs in the phospholipase A2 (PLA-2) domain and calcium-binding domain (YxGxG) in the VP1 proteins of five PPV8 strains and other PPVs.
Figure 3.
Multiple sequence alignment of the VP1 motif of five PPV8 strains with those of other PPVs. Conserved motifs in the phospholipase A2 (PLA-2) domain and calcium-binding domain (YxGxG) in the VP1 proteins of five PPV8 strains and other PPVs.
Figure 4.
Phylogenetic trees of parvoviruses based on the NS1 protein. Phylogenetic analysis was performed on the basis of the full-length nucleotide sequences of the NS1 protein of PPV8 and other reference strains of nine parvovirus genera retrieved from GenBank by MEGA 11 with the maximum likelihood (ML) method and 1000 bootstrap replicates.
Figure 4.
Phylogenetic trees of parvoviruses based on the NS1 protein. Phylogenetic analysis was performed on the basis of the full-length nucleotide sequences of the NS1 protein of PPV8 and other reference strains of nine parvovirus genera retrieved from GenBank by MEGA 11 with the maximum likelihood (ML) method and 1000 bootstrap replicates.
Figure 5.
Phylogenetic trees of parvoviruses based on the VP1 protein. Phylogenetic analysis was performed on the basis of the full-length nucleotide sequences of the VP1 protein of PPV8 and other reference strains of nine parvovirus genera retrieved from GenBank by MEGA 11 with the maximum likelihood (ML) method and 1000 bootstrap replicates. The colors corresponding to the VP1 sequence in this figure are consistent with those used in Figure 4.
Figure 5.
Phylogenetic trees of parvoviruses based on the VP1 protein. Phylogenetic analysis was performed on the basis of the full-length nucleotide sequences of the VP1 protein of PPV8 and other reference strains of nine parvovirus genera retrieved from GenBank by MEGA 11 with the maximum likelihood (ML) method and 1000 bootstrap replicates. The colors corresponding to the VP1 sequence in this figure are consistent with those used in Figure 4.
Table 1.
Details of the primers and annealing temperatures used in this study.
| Primer | Sequence (5′→3′) | PCR Conditions | |||
|---|---|---|---|---|---|
| Predenaturation | Denaturation, Annealing, Extension | Final Extension | |||
| PPV8 | OutF | TGTTGGTTTGCACCTAGCG | 98 °C 30 s | 98 °C 10 s, 56 °C 15 s, 72 °C 15 s | 72 °C 2 min |
| OutR | TGATGAGATGGTGGAACGC | ||||
| PPV8 | InF | TCCAAGTTGCCCTAGACAGC | 98 °C 30 s | 98 °C 10 s, 56 °C 15 s, 72 °C 15 s | 72 °C 2 min |
| InR | GCCTCGTACATGTGGACCTC | ||||
| ① | 119F | GAAGAAGAATCTGATTAAGGTAAGCC | 94 °C 5 min | 94 °C 30 s, 56 °C 30 s, 72 °C 30 s | 72 °C 7 min |
| 712R | GGATAGTTAATAGTGATAGAAGGAGC | ||||
| ② | 684F | TTACTAACTCAATGGTCAATGCTCCTTC | 94 °C 5 min | 94 °C 30 s, 52 °C 30 s, 72 °C 30 s | 72 °C 7 min |
| 2037R | GATTGTCTTCTAAGGACTGGC | ||||
| ③ | 1960F | CCAATACAGACTCACATCTTCTCTTGA | 94 °C 5 min | 94 °C 30 s, 60 °C 30 s, 72 °C 30 s | 72 °C 7 min |
| 3541R | TGGTTTGTTGTGACATCTCTGCTTCTAA | ||||
| ④ | 3488F | CTCATCATCCAAGAGAAGCTC | 94 °C 5 min | 94 °C 30 s, 55 °C 30 s, 72 °C 30 s | 72 °C 7 min |
| 4311R | ACCCAAGAGCGTTTTCAAAGA | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Chen, W.; Hu, Y.; Qin, Y.; Li, Y.; Zhang, X.; Huang, H.; Liu, M.; Zheng, Y.; Lu, X.; Wang, Q.; et al. Detection and Molecular Characterization of Novel Porcine Parvovirus 8 Strains in China. Viruses 2025, 17, 543. https://doi.org/10.3390/v17040543
AMA Style
Chen W, Hu Y, Qin Y, Li Y, Zhang X, Huang H, Liu M, Zheng Y, Lu X, Wang Q, et al. Detection and Molecular Characterization of Novel Porcine Parvovirus 8 Strains in China. Viruses. 2025; 17(4):543. https://doi.org/10.3390/v17040543
Chicago/Turabian StyleChen, Wei, Yanqing Hu, Yan Qin, Yuying Li, Xinyu Zhang, Haixin Huang, Mengjia Liu, Yuping Zheng, Xuelian Lu, Qiaoqiong Wang, and et al. 2025. "Detection and Molecular Characterization of Novel Porcine Parvovirus 8 Strains in China" Viruses 17, no. 4: 543. https://doi.org/10.3390/v17040543
APA StyleChen, W., Hu, Y., Qin, Y., Li, Y., Zhang, X., Huang, H., Liu, M., Zheng, Y., Lu, X., Wang, Q., Yang, J., Kang, L., Xie, L., Zhao, B., Lan, T., & Sun, W. (2025). Detection and Molecular Characterization of Novel Porcine Parvovirus 8 Strains in China. Viruses, 17(4), 543. https://doi.org/10.3390/v17040543
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
