Next Article in Journal
Synergistic Antiviral Activity of Xanthan Gum and Camostat Against Influenza Virus Infection
Previous Article in Journal
Turkey B Cell Transcriptome Profile During Turkey Hemorrhagic Enteritis Virus (THEV) Infection Highlights Upregulated Apoptosis and Breakdown Pathways That May Mediate Immunosuppression
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Retrospective Screening for Zoonotic Viruses in Encephalitis Cases in Austria, 2019–2023, Reveals Infection with Lymphocytic Choriomeningitis Virus but Not with Rustrela Virus or Tahyna Virus

by
Jeremy V. Camp
1,*,
Norbert Nowotny
2,3,
Stephan W. Aberle
1 and
Monika Redlberger-Fritz
1
1
Center for Virology, Medical University of Vienna, 1095 Vienna, Austria
2
Department of Biological Sciences and Pathobiology, Center of Pathobiology, University of Veterinary Medicine Vienna, 1210 Vienna, Austria
3
Department of Basic Medical Sciences, College of Medicine, Mohammed Bin Rashid University of Medicine and Health Sciences, Dubai Health, Dubai P.O. Box 505055, United Arab Emirates
*
Author to whom correspondence should be addressed.
Viruses 2025, 17(3), 300; https://doi.org/10.3390/v17030300
Submission received: 9 January 2025 / Revised: 14 February 2025 / Accepted: 20 February 2025 / Published: 21 February 2025
(This article belongs to the Section Animal Viruses)

Abstract

:
Zoonotic viruses may be neglected as etiologies of meningoencephalitis in humans. We performed retrospective testing of cerebrospinal fluid from encephalitis cases in biobank material for three zoonotic or potentially zoonotic viruses: rustrela virus (Rubivirus strelense, Matonaviridae); Tahyna virus (Orthobunyavirus tahynaense, Peribunyaviridae); and lymphocytic choriomeningitis virus (“LCMV”, Mammarenavirus choriomeningitidis, Arenaviridae). The cohort consisted of 443 samples, received for routine diagnostic testing year-round between January 2019 and February 2023, and were negative for herpes simplex viruses, varicella zoster virus, and enteroviruses. Using published RT-qPCR protocols, we did not detect rustrela virus or Tahyna virus in any sample. Using a herein described RT-qPCR protocol, we detected LCMV in one sample. Partial genetic sequencing of the virus suggested that the virus was locally acquired. Our study provides information about the incidence of these viruses in humans in Austria when encephalitis is suspected.

1. Introduction

Zoonotic disease monitoring and surveillance is important to better understand the risks posed to public health [1]. A large cohort involving 68 centers in seven European countries (including two in Austria) investigating outcomes of patients with severe meningoencephalitis over 3 years found that 23.7% of cases were due to infectious origin, of which 17.1% were viral, and 26.2% of unknown origin [2]. Similarly, a recent retrospective study of encephalitis cases across three tertiary care hospitals over 10 years in Austria reported 10% with unknown and 73% with infectious etiologies [3]. Moreover, in that study, 21 of the 65 patients classified as having a viral etiology were listed as “undetermined” and 13 of the 108 classified as “infectious etiology” were listed as other/undetermined infectious pathogen, suggesting an additional 30% (34/108) of encephalitis cases were of unknown infectious etiology [3].
The principal viral infections clinicians should consider in cases of encephalitis are typically herpes simplex virus 1, varicella zoster virus, enteroviruses, and human immunodeficiency virus [4]. Although vector-borne and zoonotic agents are underrepresented in diagnostic testing, one study has shown that they were more frequently identified compared to viruses more commonly considered to be associated with encephalitis [5]. This suggests that there is a lack of awareness of zoonotic viruses as potential etiologies of encephalitis. In Austria, several vector-borne and zoonotic viruses should be considered secondarily or depending on epidemiological context (e.g., time of year) in cases of encephalitis: the vector-borne arboviruses (Toscana phlebovirus, West Nile or Usutu flaviviruses, tick-borne encephalitis virus) or mammal-/insectivore-borne viruses (borna disease virus) [4,6,7].
The incidence of some zoonotic viruses known to be endemic in Austria is currently unknown. For example, rustrela virus (“RusV”, Rubivirus strelense) is a recently characterized positive-sense RNA virus, closely related to rubella virus in the family Matonaviridae. RusV has been associated with the long-recognized “staggering disease” in cats [8], and subsequently has been associated with neuroinvasive disease and encephalitis in many mammals [9,10]. The virus is endemic in Austria [11], and is likely maintained in native rodent hosts [12]. No human cases of RusV have ever been reported.
In contrast to RusV, the rodent-borne lymphocytic choriomeningitis virus (“LCMV”, Mammarenavirus choriomeningitidis, family Arenaviridae) is a segmented ambisense RNA virus that has been associated with neurovirulence in humans. First isolated from a house mouse (Mus musculus) in the USA, 1935, LCMV has historically caused outbreaks of meningitis and encephalitis in the USA and Europe [13,14]. With the exception of congenital and transplantation-related cases [15,16], few cases of LCMV have been reported worldwide since then, despite the demonstration that the virus is actively circulating in wild rodents worldwide [17,18,19]. LCMV has been recently detected in rodents in Austria [20] and nearby on the border between Germany and Czechia [21]. Notably, a laboratory strain of LCMV was detected in Japan from a wild-derived mouse strain originating from Austria [22]. Seroconversion has been detected in zoo workers in Vienna, Austria [23], forest workers and hunters in Italy [18,24], and patients in Hungary [25,26]. However, to our knowledge, no acute human cases of LCMV infection have ever been reported from Austria.
Tahyna virus (“TAHV”, Orthobunyavirus tahynaense, family Peribunyaviridae) is a minus-sense segmented RNA virus that is transmitted by mosquitoes [27]. It has a relatively wide geographic distribution, and is known to be present in mosquitoes in central and southern Europe [28,29,30,31] as well as China [32,33], and seroconversion of wildlife in Europe suggests that the virus has a complex ecological maintenance potentially involving multiple vertebrate hosts [34,35]. Human cases were originally detected in Czechia, where the disease was associated with mild flu-like symptoms to more severe meningitis or meningoencephalitis [36,37,38]. Seroconversion in humans has more recently been demonstrated in Czechia, Austria, and Croatia [39,40,41], although the precise association with disease remains unclear. Experimental infections have shown that TAHV is neurovirulent and neuroinvasive in rhesus macaques and laboratory mice, depending on strain [42]. Closely related viruses in the California encephalitis serogroup are known to cause meningitis or meningoencephalitis [43,44]. Nonetheless, to our knowledge, no human cases of TAHV have ever been reported from Austria in the 50 years since it was first identified.
To establish the incidence of these zoonotic or potentially zoonotic viruses in Austria, specifically in cases where encephalitis was suspected, we retrospectively screened biobanked cerebrospinal fluid (CSF) samples using molecular methods.

2. Materials and Methods

2.1. Sample Cohort

To assemble the cohort, we drew upon our biobank of samples, accumulated over time as the national reference laboratory for arboviruses and other viruses, as well as a routine clinical diagnostic laboratory for suspected viral infections serving Vienna and eastern Austria. We queried the biobank for cerebrospinal fluid (CSF) samples from January 2019 to February 2023 where clinical symptoms indicated possible meningitis, meningoencephalitis, or encephalitis (as indicated by the attending physician). In addition to including samples where the physician specifically indicated “encephalitis”, we included samples from patients where symptoms included gait abnormality, limb paralysis, neuropathy, status epilepticus, seizure, aphasia, ataxia, dementia, dysesthesia, or vigilance disorder, sometimes in addition to more nonspecific symptoms (e.g., fever, headache, vomiting, somnolence). We also included samples where the physician specifically requested testing for tick-borne encephalitis virus. Typically, these cases are tested for our standard panel of neurotropic viruses, including Herpes simplex virus-1 (Simplexvirus humanalpha1), Herpes simplex virus-2 (Simplexvirus humanalpha2), Varicella zoster virus (Varicellavirus humanalpha3), or enteroviruses (Picornaviridae). Endemic arbovirus infections from tick-borne encephalitis virus, West Nile virus, or Usutu virus were also tested during summer and early fall. Collection date and city of residence were recorded for each sample; otherwise, no additional identifying information was considered. Apart from the establishment of the biobank (approved by the ethics commission of the Medical University of Vienna, EK1513/2016 and EK1035/2016), no ethical approval was required.

2.2. Nucleic Acid Extraction and Amplification

Total nucleic acids were extracted from CSF using automated easyMag® NucliSENS® kits (bioMérieux Austria, Vienna). A pre-extraction control virus (phocid alphaherpesvirus) was spiked into each sample according to [45]. The samples were tested for TAHV using a previously described RT-qPCR [30] targeting the viral nucleoprotein open reading frame (Table 1). RusV was tested using the previously described “panRusV-2” RT-qPCR protocol [8] (Table 1).
Samples were tested for LCMV using multiple approaches. First, we used forward and reverse primers from an RT-qPCR recommended by a 2021 European external quality assessment for rodent-borne viruses [46] designed to amplify a region of the S segment (originally published in [47]). We modified these primers based on recently published LCMV sequences from central Europe, and validated the assay using the LCMV-Armstrong reference strain. The primers were LCMV_S1 (5′-GGG ATC CTA GGC TTA TTR GAT-3′) and LCMV_AS1 (5′-GCA CWA TWA TRA CAA TGT TGA T-3′). The reaction was performed as a one-step RT-qPCR with SYBR Green (“SuperScript™ III Platinum™ SYBR™ Green One-Step qRT-PCR Kit”, ThermoFisher Scientific, Vienna, Austria) on a real-time PCR thermocycler, acquiring a melting curve after 40 cycles. Putatively positive samples had an exponential-type amplification curve and amplicon melting temperatures ≥ 80 °C. Putatively positive samples were confirmed with a nested, conventional RT-PCR targeting the S segment, combining primers from two sources [48,49] to amplify a 444 nt product (Table 1).
Table 1. Primers and probes used to detect viruses in this study.
Table 1. Primers and probes used to detect viruses in this study.
TargetNameSequence (5′–3′)Reference
TAHV 1TsF205CAGGGGAGGTCGTCAATAAT[30]
TsR291AGCACCCATCTAGCCAAATAC
TsP256[FAM]ATAACAACGATCCTTACCATCCACCGGCTA[BHQ1]
RusV 1RusV_234+CCCCGTGTTCCTAGGCAC[8]
RusV_323-TCGCCCCATTCWACCCAATT
RusV_256_P[FAM]GTGAGCGACCACCCAGCACTCCA[BHQ1]
LCMV 21817V-LCMANATGATGCAGTCCATGAGTGCACA[49]
2477C-LCMTCAGGTGAAGGRTGGCCATACAT
1902V-LCMCCAGCCATATTTGTCCCACACTTT
2346C-LCMAGCAGCAGGYCCRCCTCAGGT
PhHV-1 3ForwardGGGCGAATCACAGATTGAATC[45]
ReverseGCGGTTCCAAACGTACCAA
Probe [TET]TTTTTATGTGTCCGCCACCATCTGGATC
1 Primers and probes for RT-qPCR reactions to target Tahyna virus (“TAHV”) or rustrela virus (“RusV”). 2 A nested conventional RT-PCR using 1817V-LCM and 2477C-LCM as the outer primers in an RT-PCR, and 1902V-LCM and 2346C-LCM as the inner primers in a PCR; used for sequencing. 3 Phocid alphaherpesvirus-1 (PhHV-1) was added to samples pre-extraction and used as a nucleic acid extraction control.

2.3. Phylogenetic Analysis of LCMV

The amplicon was sequenced by the Sanger method. For phylogenetic analysis, we selected reference sequences from GenBank using the discontinuous megablast search algorithm, and selected sequence matches by eliminating laboratory strains, removing exact duplicates and removing pairs with high sequence identity by an iterative method (e.g., when multiple sequences were obtained from the same hosts at the same location at approximately the same time). The reference strain “Armstrong 53b” (NC_004294) was included in the analysis, and Ryukyu virus (“Rat arenavirus-1” [50], Mammarenavirus ryukyuense, NC_039009) was used as an outgroup to root the tree. The phylogenetic tree was inferred over 5000 bootstraps using the TIM3+F+I+I+R2 substitution model, identified with ModelFinder in IQTree2 (v2.2.0.3). The resulting consensus tree was visualized with “ggtree” (v3.10.1) [51] and related packages, including treeio (v1.26.0) and tidytree (v0.4.6), with assistance from the package “ape” (v5.8) in R (v4.3.3).

3. Results

The cohort consisted of 393 samples from patients with suspected meningoencephalitis, and 50 samples from patients thought to have tick-borne encephalitis (all negative by RT-PCR and TBEV-reactive IgM). All samples were negative for RusV and TAHV RNA. One sample was RT-qPCR positive for LCMV, collected from a patient living in Vienna in September 2021, with the physician’s indication “suspected encephalitis”.
The amplified LCMV sequence (Austria/MUW1451606/2021, GenBank PQ799301) matched only three other sequences using the online megablast algorithm from the NCBI standard database: a sequence from Mus musculus in Czechia in 2009 (MZ568449, 85.84% sequence identity); a sequence from Mus musculus in Germany in 2022 (OP958780, 83.56% identity); and a sequence from a patient in Spain in 2008 (JN872495, 83.56% identity). A discontinuous megablast further identified the strain from Japan that originated from wild-caught mice in Illmitz, Austria (AB261990) with 85.84% identity [22]; otherwise, the sequence identities to mammarenaviruses in the GenBank (NCBI) database were less than 85%. Phylogenetic analysis placed the sequence in a well-supported clade (97% bootstrap support) with previously described strains from Germany [52], France [53], Czechia [21], and a patient-derived virus sequence from Australia, with the patient having reported travel to “former Yugoslavia” (the so-called “Dandenong strain” [54]). More specifically, the sequence shared a common ancestor (88% bootstrap support) with the Austrian-derived laboratory strain in Japan (Figure 1).

4. Discussion

The successful detection of viral genetic material in an infected patient is dependent on the course of disease, the samples tested, and—importantly—the specificity of the test. We identified acute infection with LCMV in the CSF of one patient from a cohort of patients with encephalitis. However, we are cautious when inferring the incidence of LCMV, RusV, and TAHV in Austria based on these observations. Our data suggest that approximately 0.2% of encephalitis patients might have LCMV, and less than 0.2% of patients might have RusV or TAHV. However, each of these viruses is assumed to be seasonally abundant in their enzootic transmission cycles, and therefore spillover to humans would also be seasonal. Furthermore, we must be cautious about associating these viruses with a specific course of disease, and interpreting our data in terms of the sensitivity and specificity of our tests. While biobanks are important resources for retrospective analyses such as ours, they introduce additional considerations in sample processing and virus stability during storage that may reduce the likelihood of detection.
We were screening for evidence of acute-phase virus infection in symptomatic patients. LCMV is known to cause meningitis in patients, causes neurological complications particularly in transplant patients, and is a serious congenital infection [55]. Therefore, it is not surprising that we could link a suspected encephalitis case to an infection with LCMV. However, the situation is not as concrete for TAHV, where the precise description of disease has ranged from simple fever to more complicated neurological symptoms [27,36,37,56]. Our findings support the cumulative evidence that TAHV is a relatively rare infection in humans in Austria [40] and in Europe [27,28,29,41] (particularly in cases with neuropathy), while it has a relatively high seroprevalence in wildlife [34] and is focally and seasonally present in mosquitoes [30,39]. Even less is certain about the course of potential human disease for RusV—it is known to infect and cause encephalitis in many, distantly related mammalian species [9,10], and therefore human infection is suspected, but not yet verified. Our study represents the first extensive screening of human clinical samples for evidence of RusV infection.
Our approach was designed with routine diagnostics in mind, to provide insight into benefits and limitations when implementing routine testing for these viruses among patients with suspected meningoencephalitis. We note that our assembled cohort had been previously screened for a number of viruses in our laboratory, including typical neuroinvasive human viruses, tick-borne encephalitis virus, and other mosquito-borne viruses; however, we have no knowledge about the ultimate diagnosis of these patients, whether, for example, another microbiological laboratory was able to associate bacterial infections as the cause of the disease. Our biobank approach allowed us to perform retrospective analyses with the intention of identifying and characterizing these viruses to improve diagnostics.
The most important caveat for our study is that we relied on PCR-based molecular diagnostic methods. Other molecular approaches for detecting viral nucleic acids nonspecifically, such as “shotgun sequencing” or metagenomics, are becoming more feasible for routine diagnosis [57,58,59]. However, these approaches still have low sensitivity compared to RT-qPCR and require either more sample material, high sequencing depth, and/or a relatively high viral load [57,59]. Importantly, prior to screening, we validated our optimized LCMV RT-qPCR primers to show that they have similar sensitivity compared to the published assay as well as the nested conventional RT-PCR described herein for a laboratory strain of LCMV; and, having identified the virus in a patient sample, we were able to show the similarity in sensitivity of these assays against a “wildtype” strain found in Austria. Additionally, alternative methods, involving serological tests to detect virus-specific IgM or IgG, are not commercially available for our three selected viruses. TAHV has remarkably low sequence diversity over time and across its range in Europe [30], providing confidence that our PCR would have detected the virus. Similarly, we used the assay that has been known to be specific to the clade of RusV identified in Austria in cats [8].
In contrast to TAHV, LCMV is known to have very high sequence diversity [21], complicating diagnostic tests [46]. Very few sequences of LCMV from Central Europe are available [26], and, as mentioned, the single LCMV sequence available linked to Austria had uncertain and indirect provenance [22]. Indeed, all available human- and rodent-derived LCMV sequences must be cautiously interpreted in terms of viral phylogeography, as discussed in [21] (Figure 1). Therefore, designing specific primers for PCR-based testing that will detect local strains remains a major hurdle. To our knowledge, there are few, if any, contemporary isolates of LCMV from Europe available for assay validation. Nonetheless, our sequence fits into a strongly supported clade with viruses from central Europe, described from wild-captured rodents [21,52], specifically sharing a direct common ancestor with the laboratory mice reportedly captured in Austria (Figure 1). We are therefore confident that the sequence represents an endemic strain, although we cannot exclude the possibility that it was travel-associated. However, we believe this sequence will assist in further optimizing diagnostic methods to detect autochthonous cases.

5. Conclusions

The rapid expansion of known virus diversity and of newly discovered virus species is evident from the rapidly expanding databases of publicly available virus sequences [60]. Molecular diagnostic tools must keep up with this pace by incorporating new sequence data to update primers and probes, and include tools that are sensitive to novel, emerging, or re-emerging pathogens that may cause similar clinical features in patients—fever, flu-like illness, meningitis, or meningoencephalitis. Our identification of LCMV confirms that human cases occur in Austria, possibly at a low overall incidence, but improved diagnostic methods are necessary to better understand the incidence in the population.

Author Contributions

Conceptualization, J.V.C., S.W.A. and M.R.-F.; data curation, J.V.C. and M.R.-F.; formal analysis, J.V.C.; investigation, J.V.C., S.W.A. and M.R.-F.; methodology, J.V.C., N.N. and S.W.A.; resources, N.N., S.W.A. and M.R.-F.; visualization, J.V.C.; writing—original draft preparation, J.V.C.; writing—review and editing, N.N., S.W.A. and M.R.-F. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The establishment of the anonymized biobank was approved by the ethical review board of the Medical University of Vienna (EK1035/2016 and EK1513/2016). The biobank consists of residual materials collected for routine diagnostic purposes, with the expressed purpose of retrospectively identifying and characterizing viruses, as in this study, and not for direct patient care. Therefore, no additional ethical approval was required.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author. The virus sequence generated by the study is available in GenBank, Accession number PQ799301.

Acknowledgments

The authors acknowledge the excellent technical assistance of Daniela Böhm, Silvia Malik, and Thomas Urbanek.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
LCMVLymphocytic choriomeningitis virus (Mammarenavirus choriomeningitidis)
NCBIU.S. National Center for Biotechnology Information
PhHV-1Phocid alphaherpesvirus-1
RusVRustrela virus (Rubivirus strelense)
TAHVTahyna virus (Orthobunyavirus tahynense)

References

  1. European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union One Health 2022 Zoonoses Report. EFSA J. 2023, 21, e8442. [Google Scholar] [CrossRef]
  2. Sonneville, R.; de Montmollin, E.; Contou, D.; Ferrer, R.; Gurjar, M.; Klouche, K.; Sarton, B.; Demeret, S.; Bailly, P.; da Silva, D.; et al. Clinical features, etiologies, and outcomes in adult patients with meningoencephalitis requiring intensive care (EURECA): An international prospective multicenter cohort study. Intensive Care Med. 2023, 49, 517–529. [Google Scholar] [CrossRef]
  3. Moser, T.; Gruber, J.; Mylonaki, E.; Bohm, V.; Schwarzenhofer, D.; Troscher, A.R.; Lenzenweger, E.; Krehan, I.; Sollradl, E.; Leitinger, M.; et al. Autoimmune and infectious encephalitis: Development of a discriminative tool for early diagnosis and initiation of therapy. J. Neurol. 2024, 271, 7583–7591. [Google Scholar] [CrossRef]
  4. Schibler, M.; Eperon, G.; Kenfak, A.; Lascano, A.; Vargas, M.I.; Stahl, J.P. Diagnostic tools to tackle infectious causes of encephalitis and meningoencephalitis in immunocompetent adults in Europe. Clin. Microbiol. Infect. 2019, 25, 408–414. [Google Scholar] [CrossRef]
  5. Erickson, T.A.; Muscal, E.; Munoz, F.M.; Lotze, T.; Hasbun, R.; Brown, E.; Murray, K.O. Infectious and Autoimmune Causes of Encephalitis in Children. Pediatrics 2020, 145, e20192543. [Google Scholar] [CrossRef]
  6. Ebinger, A.; Santos, P.D.; Pfaff, F.; Durrwald, R.; Kolodziejek, J.; Schlottau, K.; Ruf, V.; Liesche-Starnecker, F.; Ensser, A.; Korn, K.; et al. Lethal Borna disease virus 1 infections of humans and animals—In-depth molecular epidemiology and phylogeography. Nat. Commun. 2024, 15, 7908. [Google Scholar] [CrossRef]
  7. Graninger, M.; Hubmer, S.; Riederer, F.; Kettner, S.; Hauk, M.; Auf, T.; Aberle, J.H.; Stiasny, K.; Aberle, S.W.; Camp, J.V. The First Case of Usutu Virus Neuroinvasive Disease in Austria, 2021. Open Forum Infect. Dis. 2022, 9, ofac255. [Google Scholar] [CrossRef]
  8. Matiasek, K.; Pfaff, F.; Weissenbock, H.; Wylezich, C.; Kolodziejek, J.; Tengstrand, S.; Ecke, F.; Nippert, S.; Starcky, P.; Litz, B.; et al. Mystery of fatal ‘staggering disease’ unravelled: Novel rustrela virus causes severe meningoencephalomyelitis in domestic cats. Nat. Commun. 2023, 14, 624. [Google Scholar] [CrossRef]
  9. Bennett, A.J.; Paskey, A.C.; Ebinger, A.; Pfaff, F.; Priemer, G.; Hoper, D.; Breithaupt, A.; Heuser, E.; Ulrich, R.G.; Kuhn, J.H.; et al. Relatives of rubella virus in diverse mammals. Nature 2020, 586, 424–428. [Google Scholar] [CrossRef]
  10. Pfaff, F.; Breithaupt, A.; Rubbenstroth, D.; Nippert, S.; Baumbach, C.; Gerst, S.; Langner, C.; Wylezich, C.; Ebinger, A.; Hoper, D.; et al. Revisiting Rustrela Virus: New Cases of Encephalitis and a Solution to the Capsid Enigma. Microbiol. Spectr. 2022, 10, e0010322. [Google Scholar] [CrossRef]
  11. Weiss, V.; Weidinger, P.; Matt, J.; Weissenbacher-Lang, C.; Nowotny, N.; Weissenbock, H. Rustrela Virus-Associated Encephalomyelitis (‘Staggering Disease’) in Cats from Eastern Austria, 1994-2016. Viruses 2023, 15, 1621. [Google Scholar] [CrossRef] [PubMed]
  12. Nippert, S.; Rubbenstroth, D.; Geers, J.A.; Ebinger, A.; Hoffmann, D.; Breithaupt, A.; Wylezich, C.; Wang, X.; Haring, V.C.; Starcky, P.; et al. Continuous presence of genetically diverse rustrela virus lineages in yellow-necked field mouse reservoir populations in northeastern Germany. Virus Evol. 2023, 9, vead048. [Google Scholar] [CrossRef] [PubMed]
  13. Ackermann, R.; Stille, W.; Blumenthal, W.; Helm, E.; Keller, K.; Baldus, O. Syrian hamster as a vector of lymphocytic choriomeningitis. Dtsch. Med. Wochenschr. 1972, 97, 1725–1731. (In German) [Google Scholar] [CrossRef]
  14. Gregg, M.B. Recent outbreaks of lymphocytic choriomeningitis in the United States of America. Bull. World Health Organ. 1975, 52, 549–553. [Google Scholar]
  15. Macneil, A.; Stroher, U.; Farnon, E.; Campbell, S.; Cannon, D.; Paddock, C.D.; Drew, C.P.; Kuehnert, M.; Knust, B.; Gruenenfelder, R.; et al. Solid organ transplant-associated lymphocytic choriomeningitis, United States, 2011. Emerg. Infect. Dis. 2012, 18, 1256–1262. [Google Scholar] [CrossRef]
  16. Wright, R.; Johnson, D.; Neumann, M.; Ksiazek, T.G.; Rollin, P.; Keech, R.V.; Bonthius, D.J.; Hitchon, P.; Grose, C.F.; Bell, W.E.; et al. Congenital lymphocytic choriomeningitis virus syndrome: A disease that mimics congenital toxoplasmosis or Cytomegalovirus infection. Pediatrics 1997, 100, E9. [Google Scholar] [CrossRef]
  17. Alburkat, H.; Jaaskelainen, A.J.; Barakat, A.M.; Hasony, H.J.; Sironen, T.; Al-Hello, H.; Smura, T.; Vapalahti, O. Lymphocytic Choriomeningitis Virus Infections and Seroprevalence, Southern Iraq. Emerg. Infect. Dis. 2020, 26, 3002–3006. [Google Scholar] [CrossRef]
  18. Kallio-Kokko, H.; Laakkonen, J.; Rizzoli, A.; Tagliapietra, V.; Cattadori, I.; Perkins, S.E.; Hudson, P.J.; Cristofolini, A.; Versini, W.; Vapalahti, O.; et al. Hantavirus and arenavirus antibody prevalence in rodents and humans in Trentino, Northern Italy. Epidemiol. Infect. 2006, 134, 830–836. [Google Scholar] [CrossRef]
  19. Van Cuong, N.; Carrique-Mas, J.; Vo Be, H.; An, N.N.; Tue, N.T.; Anh, N.L.; Anh, P.H.; Phuc, N.T.; Baker, S.; Voutilainen, L.; et al. Rodents and risk in the Mekong Delta of Vietnam: Seroprevalence of selected zoonotic viruses in rodents and humans. Vector Borne Zoonotic Dis. 2015, 15, 65–72. [Google Scholar] [CrossRef]
  20. Schmidt, S.; Essbauer, S.S.; Mayer-Scholl, A.; Poppert, S.; Schmidt-Chanasit, J.; Klempa, B.; Henning, K.; Schares, G.; Groschup, M.H.; Spitzenberger, F.; et al. Multiple infections of rodents with zoonotic pathogens in Austria. Vector Borne Zoonotic Dis. 2014, 14, 467–475. [Google Scholar] [CrossRef]
  21. Fornuskova, A.; Hiadlovska, Z.; Macholan, M.; Pialek, J.; de Bellocq, J.G. New Perspective on the Geographic Distribution and Evolution of Lymphocytic Choriomeningitis Virus, Central Europe. Emerg. Infect. Dis. 2021, 27, 2638–2647. [Google Scholar] [CrossRef]
  22. Ike, F.; Bourgade, F.; Ohsawa, K.; Sato, H.; Morikawa, S.; Saijo, M.; Kurane, I.; Takimoto, K.; Yamada, Y.K.; Jaubert, J.; et al. Lymphocytic choriomeningitis infection undetected by dirty-bedding sentinel monitoring and revealed after embryo transfer of an inbred strain derived from wild mice. Comp. Med. 2007, 57, 272–281. [Google Scholar]
  23. Juncker-Voss, M.; Prosl, H.; Lussy, H.; Enzenberg, U.; Auer, H.; Lassnig, H.; Muller, M.; Nowotny, N. [Screening for antibodies against zoonotic agents among employees of the Zoological Garden of Vienna, Schonbrunn, Austria]. Berl. Munch. Tierarztl. Wochenschr. 2004, 117, 404–409. [Google Scholar]
  24. Tagliapietra, V.; Rosa, R.; Rossi, C.; Rosso, F.; Hauffe, H.C.; Tommasini, M.; Versini, W.; Cristallo, A.F.; Rizzoli, A. Emerging Rodent-Borne Viral Zoonoses in Trento, Italy. Ecohealth 2018, 15, 695–704. [Google Scholar] [CrossRef]
  25. Koroknai, A.; Nagy, A.; Nagy, O.; Csonka, N.; Mezei, E.; Szomor, K.; Takacs, M. Lymphocytic Choriomeningitis Virus Infections in Hungary between 2017-2023-Investigation of the First Congenital Infections. Diagnostics 2024, 14, 1436. [Google Scholar] [CrossRef]
  26. Pankovics, P.; Nagy, A.; Nyul, Z.; Juhasz, A.; Takats, K.; Boros, A.; Reuter, G. Human cases of lymphocytic choriomeningitis virus (LCMV) infections in Hungary. Arch. Virol. 2023, 168, 275. [Google Scholar] [CrossRef]
  27. Mravcova, K.; Camp, J.V.; Hubalek, Z.; Sikutova, S.; Vaux, A.G.C.; Medlock, J.M.; Rudolf, I. Tahyna virus-A widespread, but neglected mosquito-borne virus in Europe. Zoonoses Public Health 2023, 70, 371–382. [Google Scholar] [CrossRef]
  28. Calzolari, M.; Bonilauri, P.; Grisendi, A.; Dalmonte, G.; Vismarra, A.; Lelli, D.; Chiapponi, C.; Bellini, R.; Lavazza, A.; Dottori, M. Arbovirus Screening in Mosquitoes in Emilia-Romagna (Italy, 2021) and Isolation of Tahyna Virus. Microbiol. Spectr. 2022, 10, e0158722. [Google Scholar] [CrossRef]
  29. Calzolari, M.; Callegari, E.; Grisendi, A.; Munari, M.; Russo, S.; Sgura, D.; Giannini, A.; Dalmonte, G.; Scremin, M.; Dottori, M. Arbovirus screening of mosquitoes collected in 2022 in Emilia-Romagna, Italy, with the implementation of a real-time PCR for the detection of Tahyna virus. One Health 2024, 18, 100670. [Google Scholar] [CrossRef]
  30. Camp, J.V.; Kniha, E.; Obwaller, A.G.; Walochnik, J.; Nowotny, N. The transmission ecology of Tahyna orthobunyavirus in Austria as revealed by longitudinal mosquito sampling and blood meal analysis in floodplain habitats. Parasit. Vectors 2021, 14, 561. [Google Scholar] [CrossRef]
  31. Hubalek, Z.; Rudolf, I.; Bakonyi, T.; Kazdova, K.; Halouzka, J.; Sebesta, O.; Sikutova, S.; Juricova, Z.; Nowotny, N. Mosquito (Diptera: Culicidae) surveillance for arboviruses in an area endemic for West Nile (Lineage Rabensburg) and Tahyna viruses in Central Europe. J. Med. Entomol. 2010, 47, 466–472. [Google Scholar] [CrossRef]
  32. Cai, T.; Liu, R.; Jiang, Y.; Jia, N.; Jian, X.; Cheng, X.; Song, F.; Guo, X.; Zhao, T. Vector competence evaluation of mosquitoes for Tahyna virus PJ01 strain, a new Orthobunyavirus in China. Front. Microbiol. 2023, 14, 1159835. [Google Scholar] [CrossRef]
  33. Li, W.; Cao, Y.; Fu, S.; Wang, J.; Li, M.; Jiang, S.; Wang, X.; Xing, S.; Feng, L.; Wang, Z.; et al. Tahyna virus infection, a neglected arboviral disease in the Qinghai-Tibet Plateau of China. Vector Borne Zoonotic Dis. 2014, 14, 353–357. [Google Scholar] [CrossRef]
  34. Camp, J.V.; Haider, R.; Porea, D.; Oslobanu, L.E.; Forgach, P.; Nowotny, N. Serological surveillance for Tahyna virus (California encephalitis orthobunyavirus, Peribunyaviridae) neutralizing antibodies in wild ungulates in Austria, Hungary and Romania. Zoonoses Public Health 2018, 65, 459–463. [Google Scholar] [CrossRef]
  35. Stevanovic, V.; Vilibic-Cavlek, T.; Savic, V.; Klobucar, A.; Kovac, S.; Curman Posavec, M.; Petrinic, S.; Bogdanic, M.; Santini, M.; Tesic, V.; et al. Surveillance of Tahyna Orthobunyavirus in Urban Areas in Croatia-The “One Health” Approach. Trop. Med. Infect. Dis. 2022, 7, 320. [Google Scholar] [CrossRef]
  36. Simkova, A.; Sluka, F. Isolation of Tahyna virus from the blood of a case of influenza-like disease. Acta Virol. 1973, 17, 94. [Google Scholar]
  37. Sluka, F. Recognition of clinical forms of Valtice fever, a new arbovirus infection. Wien. Med. Wochenschr. 1969, 119, 765–769. [Google Scholar]
  38. Sluka, F.; Simkova, A. Demonstration of human infection in the natural focus of the Valtice fever. Folia Parasitol. 1972, 19, 358. [Google Scholar]
  39. Hubalek, Z.; Zeman, P.; Halouzka, J.; Juricova, Z.; St’ovickova, E.; Balkova, H.; Sikutova, S.; Rudolf, I. Antibodies against mosquito-born viruses in human population of an area of Central Bohemia affected by the flood of 2002. Epidemiol. Mikrobiol. Imunol. 2004, 53, 112–120. [Google Scholar]
  40. Sonnleitner, S.T.; Lundstrom, J.; Baumgartner, R.; Simeoni, J.; Schennach, H.; Zelger, R.; Prader, A.; Schmutzhard, E.; Nowotny, N.; Walder, G. Investigations on California serogroup orthobunyaviruses in the Tyrols: First description of Tahyna virus in the Alps. Vector Borne Zoonotic Dis. 2014, 14, 272–277. [Google Scholar] [CrossRef]
  41. Vilibic-Cavlek, T.; Stevanovic, V.; Savic, V.; Markelic, D.; Sabadi, D.; Bogdanic, M.; Kovac, S.; Santini, M.; Tabain, I.; Potocnik-Hunjadi, T.; et al. Detection of Tahyna Orthobunyavirus-Neutralizing Antibodies in Patients with Neuroinvasive Disease in Croatia. Microorganisms 2022, 10, 1443. [Google Scholar] [CrossRef]
  42. Bennett, R.S.; Gresko, A.K.; Murphy, B.R.; Whitehead, S.S. Tahyna virus genetics, infectivity, and immunogenicity in mice and monkeys. Virol. J. 2011, 8, 135. [Google Scholar] [CrossRef] [PubMed]
  43. Evans, A.B.; Peterson, K.E. Throw out the Map: Neuropathogenesis of the Globally Expanding California Serogroup of Orthobunyaviruses. Viruses 2019, 11, 794. [Google Scholar] [CrossRef]
  44. Evans, A.B.; Winkler, C.W.; Peterson, K.E. Differences in Neuropathogenesis of Encephalitic California Serogroup Viruses. Emerg. Infect. Dis. 2019, 25, 728–738. [Google Scholar] [CrossRef]
  45. Niesters, H.G. Molecular and diagnostic clinical virology in real time. Clin. Microbiol. Infect. 2004, 10, 5–11. [Google Scholar] [CrossRef]
  46. Erdin, M.; Stanoeva, K.R.; Mogling, R.; Korva, M.; Knap, N.; Resman Rus, K.; Domingo, C.; Reimerink, J.H.; de Vries, A.; Alburkat, H.; et al. External quality assessment of orthohantavirus and lymphocytic choriomeningitis virus molecular detection and serology in Europe, 2021. Eurosurveillance 2023, 28, 2300054. [Google Scholar] [CrossRef]
  47. Mangombi, J.B.; N’Dilimabaka, N.; Lekana-Douki, J.B.; Banga, O.; Maghendji-Nzondo, S.; Bourgarel, M.; Leroy, E.; Fenollar, F.; Mediannikov, O. First investigation of pathogenic bacteria, protozoa and viruses in rodents and shrews in context of forest-savannah-urban areas interface in the city of Franceville (Gabon). PLoS ONE 2021, 16, e0248244. [Google Scholar] [CrossRef]
  48. Bowen, M.D.; Peters, C.J.; Nichol, S.T. Phylogenetic analysis of the Arenaviridae: Patterns of virus evolution and evidence for cospeciation between arenaviruses and their rodent hosts. Mol. Phylogenet Evol. 1997, 8, 301–316. [Google Scholar] [CrossRef]
  49. Emonet, S.; Retornaz, K.; Gonzalez, J.P.; de Lamballerie, X.; Charrel, R.N. Mouse-to-human transmission of variant lymphocytic choriomeningitis virus. Emerg. Infect. Dis. 2007, 13, 472–475. [Google Scholar] [CrossRef]
  50. Wu, Z.; Lu, L.; Du, J.; Yang, L.; Ren, X.; Liu, B.; Jiang, J.; Yang, J.; Dong, J.; Sun, L.; et al. Comparative analysis of rodent and small mammal viromes to better understand the wildlife origin of emerging infectious diseases. Microbiome 2018, 6, 178. [Google Scholar] [CrossRef]
  51. Yu, G.; Smith, D.K.; Zhu, H.; Guan, Y.; Lam, T.T.Y. ggtree: An R package for visualization and annotation of phylogenetic trees with their covariates and other associated data. Methods Ecol. Evol. 2017, 8, 28–36. [Google Scholar] [CrossRef]
  52. Mehl, C.; Wylezich, C.; Geiger, C.; Schauerte, N.; Matz-Rensing, K.; Nesseler, A.; Hoper, D.; Linnenbrink, M.; Beer, M.; Heckel, G.; et al. Reemergence of Lymphocytic Choriomeningitis Mammarenavirus, Germany. Emerg. Infect. Dis. 2023, 29, 631–634. [Google Scholar] [CrossRef] [PubMed]
  53. Meritet, J.F.; Krivine, A.; Lewin, F.; Poissonnier, M.H.; Poizat, R.; Loget, P.; Rozenberg, F.; Lebon, P. A case of congenital lymphocytic choriomeningitis virus (LCMV) infection revealed by hydrops fetalis. Prenat. Diagn. 2009, 29, 626–627. [Google Scholar] [CrossRef] [PubMed]
  54. Palacios, G.; Druce, J.; Du, L.; Tran, T.; Birch, C.; Briese, T.; Conlan, S.; Quan, P.L.; Hui, J.; Marshall, J.; et al. A new arenavirus in a cluster of fatal transplant-associated diseases. N. Engl. J. Med. 2008, 358, 991–998. [Google Scholar] [CrossRef]
  55. Vilibic-Cavlek, T.; Savic, V.; Ferenc, T.; Mrzljak, A.; Barbic, L.; Bogdanic, M.; Stevanovic, V.; Tabain, I.; Ferencak, I.; Zidovec-Lepej, S. Lymphocytic Choriomeningitis-Emerging Trends of a Neglected Virus: A Narrative Review. Trop. Med. Infect. Dis. 2021, 6, 88. [Google Scholar] [CrossRef]
  56. Demikhov, V.G.; Chaitsev, V.G. Neurologic characteristics of diseases caused by Inkoo and Tahyna viruses. Vopr. Virusol. 1995, 40, 21–25. [Google Scholar]
  57. Piantadosi, A.; Mukerji, S.S.; Ye, S.; Leone, M.J.; Freimark, L.M.; Park, D.; Adams, G.; Lemieux, J.; Kanjilal, S.; Solomon, I.H.; et al. Enhanced Virus Detection and Metagenomic Sequencing in Patients with Meningitis and Encephalitis. mBio 2021, 12, e0114321. [Google Scholar] [CrossRef]
  58. Tan, J.K.; Servellita, V.; Stryke, D.; Kelly, E.; Streithorst, J.; Sumimoto, N.; Foresythe, A.; Huh, H.J.; Nguyen, J.; Oseguera, M.; et al. Laboratory validation of a clinical metagenomic next-generation sequencing assay for respiratory virus detection and discovery. Nat. Commun. 2024, 15, 9016. [Google Scholar] [CrossRef]
  59. Wilson, M.R.; Sample, H.A.; Zorn, K.C.; Arevalo, S.; Yu, G.; Neuhaus, J.; Federman, S.; Stryke, D.; Briggs, B.; Langelier, C.; et al. Clinical Metagenomic Sequencing for Diagnosis of Meningitis and Encephalitis. N. Engl. J. Med. 2019, 380, 2327–2340. [Google Scholar] [CrossRef]
  60. International Committee on Taxonomy of Viruses Executive Committee. The new scope of virus taxonomy: Partitioning the virosphere into 15 hierarchical ranks. Nat. Microbiol. 2020, 5, 668–674. [Google Scholar] [CrossRef]
Figure 1. The maximum-likelihood phylogenetic tree of lymphocytic choriomeningitis virus (Mammarenavirus choriomeningitidis), including a case of encephalitis in Austria (Austria/MUW1451606/2021, Accession PQ799301, indicated by a black dot). The consensus tree was inferred over 5000 bootstraps, with the TIM3+F+I+I+R2 substitution model identified with ModelFinder in IQTree2 (v2.2.0.3), and nodes with bootstrap support >60% are shown over branches in gray text. Reference sequence names are given as the GenBank accession number, the presumed country of origin (or importation), and the year of collection. The scale bar indicates branch distance in substitutions per site over the 444 nt partial sequence of the viral S segment.
Figure 1. The maximum-likelihood phylogenetic tree of lymphocytic choriomeningitis virus (Mammarenavirus choriomeningitidis), including a case of encephalitis in Austria (Austria/MUW1451606/2021, Accession PQ799301, indicated by a black dot). The consensus tree was inferred over 5000 bootstraps, with the TIM3+F+I+I+R2 substitution model identified with ModelFinder in IQTree2 (v2.2.0.3), and nodes with bootstrap support >60% are shown over branches in gray text. Reference sequence names are given as the GenBank accession number, the presumed country of origin (or importation), and the year of collection. The scale bar indicates branch distance in substitutions per site over the 444 nt partial sequence of the viral S segment.
Viruses 17 00300 g001
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Camp, J.V.; Nowotny, N.; Aberle, S.W.; Redlberger-Fritz, M. Retrospective Screening for Zoonotic Viruses in Encephalitis Cases in Austria, 2019–2023, Reveals Infection with Lymphocytic Choriomeningitis Virus but Not with Rustrela Virus or Tahyna Virus. Viruses 2025, 17, 300. https://doi.org/10.3390/v17030300

AMA Style

Camp JV, Nowotny N, Aberle SW, Redlberger-Fritz M. Retrospective Screening for Zoonotic Viruses in Encephalitis Cases in Austria, 2019–2023, Reveals Infection with Lymphocytic Choriomeningitis Virus but Not with Rustrela Virus or Tahyna Virus. Viruses. 2025; 17(3):300. https://doi.org/10.3390/v17030300

Chicago/Turabian Style

Camp, Jeremy V., Norbert Nowotny, Stephan W. Aberle, and Monika Redlberger-Fritz. 2025. "Retrospective Screening for Zoonotic Viruses in Encephalitis Cases in Austria, 2019–2023, Reveals Infection with Lymphocytic Choriomeningitis Virus but Not with Rustrela Virus or Tahyna Virus" Viruses 17, no. 3: 300. https://doi.org/10.3390/v17030300

APA Style

Camp, J. V., Nowotny, N., Aberle, S. W., & Redlberger-Fritz, M. (2025). Retrospective Screening for Zoonotic Viruses in Encephalitis Cases in Austria, 2019–2023, Reveals Infection with Lymphocytic Choriomeningitis Virus but Not with Rustrela Virus or Tahyna Virus. Viruses, 17(3), 300. https://doi.org/10.3390/v17030300

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop