Development of a Luciferase Immunosorbent Assay for Detecting Crimean–Congo Hemorrhagic Fever Virus IgG Antibodies Based on Nucleoprotein
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Serum Samples
2.2. Construction of Recombinant Expression Plasmid
2.3. Expression of Recombinant Luciferase Fusion Proteins
2.4. Western Blot
2.5. Preparation of Mice Serum
2.6. Development of CCHFV LISA Based on Different NP Fusion Proteins
2.7. Development of CCHFV ELISA Based on Different NP Fusion Proteins
2.8. Statistical Analysis
3. Results
3.1. Expression of CCHFV NP Antigens Fused with Nano-Luciferase
3.2. Establishment of the LISA for the Detection of CCHFV IgG Antibody
3.3. Optimal Structural Domain for CCHFV IgG Antibody Detection
3.4. Comparison of the Novel LISA with the Commercial ELISA for Detecting Anti-CCHFV IgG
3.5. Repeatability and Cross-Reactivity of CCHFV-LISA
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hawman, D.W.; Feldmann, H. Crimean-Congo haemorrhagic fever virus. Nat. Rev. Microbiol. 2023, 21, 463–477. [Google Scholar] [CrossRef] [PubMed]
- Spengler, J.R.; Bente, D.A.; Bray, M.; Burt, F.; Hewson, R.; Korukluoglu, G.; Mirazimi, A.; Weber, F.; Papa, A. Second International Conference on Crimean-Congo Hemorrhagic Fever. Antivir. Res. 2018, 150, 137–147. [Google Scholar] [CrossRef]
- Gargili, A.; Estrada-Peña, A.; Spengler, J.R.; Lukashev, A.; Nuttall, P.A.; Bente, D.A. The role of ticks in the maintenance and transmission of Crimean-Congo hemorrhagic fever virus: A review of published field and laboratory studies. Antivir. Res. 2017, 144, 93–119. [Google Scholar] [CrossRef] [PubMed]
- Lindeborg, M.; Barboutis, C.; Ehrenborg, C.; Fransson, T.; Jaenson, T.G.; Lindgren, P.E.; Lundkvist, A.; Nyström, F.; Salaneck, E.; Waldenström, J.; et al. Migratory birds, ticks, and crimean-congo hemorrhagic fever virus. Emerg. Infect. Dis. 2012, 18, 2095–2097. [Google Scholar] [CrossRef] [PubMed]
- Rainey, T.; Occi, J.L.; Robbins, R.G.; Egizi, A. Discovery of Haemaphysalis longicornis (Ixodida: Ixodidae) Parasitizing a Sheep in New Jersey, United States. J. Med. Entomol. 2018, 55, 757–759. [Google Scholar] [CrossRef]
- Ergonul, O. Crimean-Congo hemorrhagic fever virus: New outbreaks, new discoveries. Curr. Opin. Virol. 2012, 2, 215–220. [Google Scholar] [CrossRef]
- Yuan, S. Crimean-Congo haemorrhagic fever in Iraq. Lancet Microbe 2023, 4, e669. [Google Scholar] [CrossRef]
- Kumar, H.; Qureshi, A.A.; Minhaj, A.; Kumar, B. Urgent call for holistic action: Addressing the Crimean-Congo hemorrhagic fever (CCHF) crisis in Pakistan’s healthcare system. New Microbes New Infect. 2024, 60-61, 101418. [Google Scholar] [CrossRef]
- Mehand, M.S.; Al-Shorbaji, F.; Millett, P.; Murgue, B. The WHO R&D Blueprint: 2018 review of emerging infectious diseases requiring urgent research and development efforts. Antivir. Res. 2018, 159, 63–67. [Google Scholar]
- Papa, A.; Tsergouli, K.; Tsioka, K.; Mirazimi, A. Crimean-Congo Hemorrhagic Fever: Tick-Host-Virus Interactions. Front. Cell Infect. Microbiol. 2017, 7, 213. [Google Scholar] [CrossRef]
- González Gordon, L.; Bessell, P.R.; Nkongho, E.F.; Ngwa, V.N.; Tanya, V.N.; Sander, M.; Ndip, L.; Morgan, K.L.; Handel, I.G.; Mazeri, S.; et al. Seroepidemiology of Crimean-Congo Haemorrhagic Fever among cattle in Cameroon: Implications from a One Health perspective. PLoS Neglected Trop. Dis. 2022, 16, e0010217. [Google Scholar] [CrossRef] [PubMed]
- Spengler, J.R.; Estrada-Peña, A.; Garrison, A.R.; Schmaljohn, C.; Spiropoulou, C.F.; Bergeron, É.; Bente, D.A. A chronological review of experimental infection studies of the role of wild animals and livestock in the maintenance and transmission of Crimean-Congo hemorrhagic fever virus. Antivir. Res. 2016, 135, 31–47. [Google Scholar] [CrossRef] [PubMed]
- Omoga, D.C.A.; Tchouassi, D.P.; Venter, M.; Ogola, E.O.; Osalla, J.; Kopp, A.; Slothouwer, I.; Torto, B.; Junglen, S.; Sang, R. Transmission Dynamics of Crimean-Congo Haemorrhagic Fever Virus (CCHFV): Evidence of Circulation in Humans, Livestock, and Rodents in Diverse Ecologies in Kenya. Viruses 2023, 15, 1891. [Google Scholar] [CrossRef] [PubMed]
- Ngom, D.; Khoulé, A.; Faye, E.T.; Sène, O.; Diop, S.M.; Sagne, S.N.; Diallo, M.K.; Dia, M.; Barry, M.A.; Diaw, Y.; et al. Crimean-Congo haemorrhagic fever outbreak in Northern Senegal in 2022: Prevalence of the virus in livestock and ticks, associated risk factors and epidemiological implications. Zoonoses Public Health 2024, 71, 696–707. [Google Scholar] [CrossRef] [PubMed]
- Shepherd, A.J.; Swanepoel, R.; Leman, P.A.; Shepherd, S.P. Field and laboratory investigation of Crimean-Congo haemorrhagic fever virus (Nairovirus, family Bunyaviridae) infection in birds. Trans. R. Soc. Trop. Med. Hyg. 1987, 81, 1004–1007. [Google Scholar] [CrossRef]
- Zeller, H.G.; Cornet, J.P.; Camicas, J.L. Experimental transmission of Crimean-Congo hemorrhagic fever virus by west African wild ground-feeding birds to Hyalomma marginatum rufipes ticks. Am. J. Trop. Med. Hyg. 1994, 50, 676–681. [Google Scholar] [CrossRef]
- Swanepoel, R.; Leman, P.A.; Burt, F.J.; Jardine, J.; Verwoerd, D.J.; Capua, I.; Brückner, G.K.; Burger, W.P. Experimental infection of ostriches with Crimean-Congo haemorrhagic fever virus. Epidemiol. Infect. 1998, 121, 427–432. [Google Scholar] [CrossRef]
- Ergönül, O. Crimean-Congo haemorrhagic fever. Lancet Infect. Dis. 2006, 6, 203–214. [Google Scholar] [CrossRef]
- Guo, Y.; Wang, W.; Ji, W.; Deng, M.; Sun, Y.; Zhou, H.; Yang, C.; Deng, F.; Wang, H.; Hu, Z.; et al. Crimean-Congo hemorrhagic fever virus nucleoprotein reveals endonuclease activity in bunyaviruses. Proc. Natl. Acad. Sci. USA 2012, 109, 5046–5051. [Google Scholar] [CrossRef]
- Carter, S.D.; Surtees, R.; Walter, C.T.; Ariza, A.; Bergeron, É.; Nichol, S.T.; Hiscox, J.A.; Edwards, T.A.; Barr, J.N. Structure, function, and evolution of the Crimean-Congo hemorrhagic fever virus nucleocapsid protein. J. Virol. 2012, 86, 10914–10923. [Google Scholar] [CrossRef]
- Vapalahti, O.; Kallio-Kokko, H.; Närvänen, A.; Julkunen, I.; Lundkvist, A.; Plyusnin, A.; Lehväslaiho, H.; Brummer-Korvenkontio, M.; Vaheri, A.; Lankinen, H. Human B-cell epitopes of Puumala virus nucleocapsid protein, the major antigen in early serological response. J. Med. Virol. 1995, 46, 293–303. [Google Scholar] [CrossRef] [PubMed]
- Garrison, A.R.; Moresco, V.; Zeng, X.; Cline, C.R.; Ward, M.D.; Ricks, K.M.; Olschner, S.P.; Cazares, L.H.; Karaaslan, E.; Fitzpatrick, C.J.; et al. Nucleocapsid protein-specific monoclonal antibodies protect mice against Crimean-Congo hemorrhagic fever virus. Nat. Commun. 2024, 15, 1722. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Dutta, S.; Karlberg, H.; Devignot, S.; Weber, F.; Hao, Q.; Tan, Y.J.; Mirazimi, A.; Kotaka, M. Structure of Crimean-Congo hemorrhagic fever virus nucleoprotein: Superhelical homo-oligomers and the role of caspase-3 cleavage. J. Virol. 2012, 86, 12294–12303. [Google Scholar] [CrossRef] [PubMed]
- Mazzola, L.T.; Kelly-Cirino, C. Diagnostic tests for Crimean-Congo haemorrhagic fever: A widespread tickborne disease. BMJ Glob. Health 2019, 4, e001114. [Google Scholar] [CrossRef]
- Belij-Rammerstorfer, S.; Limon, G.; Maze, E.A.; Hannant, K.; Hughes, E.; Tchakarova, S.R.; Alexandrov, T.; Mmbaga, B.T.; Willett, B.; Booth, G.; et al. Development of anti-Crimean-Congo hemorrhagic fever virus Gc and NP-specific ELISA for detection of antibodies in domestic animal sera. Front. Vet. Sci. 2022, 9, 913046. [Google Scholar] [CrossRef]
- Lombe, B.P.; Miyamoto, H.; Saito, T.; Yoshida, R.; Manzoor, R.; Kajihara, M.; Shimojima, M.; Fukushi, S.; Morikawa, S.; Yoshikawa, T.; et al. Purification of Crimean-Congo hemorrhagic fever virus nucleoprotein and its utility for serological diagnosis. Sci. Rep. 2021, 11, 2324. [Google Scholar] [CrossRef]
- Gülce-İz, S.; Elaldı, N.; Can, H.; Şahar, E.A.; Karakavuk, M.; Gül, A.; Kumoğlu, G.; Döşkaya, A.D.; Gürüz, A.Y.; Özdarendeli, A.; et al. Development of a novel recombinant ELISA for the detection of Crimean-Congo hemorrhagic fever virus IgG antibodies. Sci. Rep. 2021, 11, 5936. [Google Scholar] [CrossRef]
- Li, X.; Wan, X.; Liu, J.; Wang, H.; Li, A.; Ke, C.; Tang, S.; Zhao, W.; Cai, S.; Wan, C. Luciferase Immunosorbent Assay Based on Multiple E Antigens for the Detection of Chikungunya Virus-Specific IgG Antibodies. Microbiol. Spectr. 2022, 10, e0228222. [Google Scholar]
- Dai, S.; Deng, F.; Wang, H.; Ning, Y. Crimean-Congo Hemorrhagic Fever Virus: Current Advances and Future Prospects of Antiviral Strategies. Viruses 2021, 13, 1195. [Google Scholar] [CrossRef]
- Sorvillo, T.E.; Rodriguez, S.E.; Hudson, P.; Carey, M.; Rodriguez, L.L.; Spiropoulou, C.F.; Bird, B.H.; Spengler, J.R.; Bente, D.A. Towards a Sustainable One Health Approach to Crimean-Congo Hemorrhagic Fever Prevention: Focus Areas and Gaps in Knowledge. Trop. Med. Infect. Dis. 2020, 5, 113. [Google Scholar] [CrossRef]
- Wang, S.; Li, W.; Wang, Z.; Yang, W.; Li, E.; Xia, X.; Yan, F.; Chiu, S. Emerging and reemerging infectious diseases: Global trends and new strategies for their prevention and control. Signal Transduct. Target. Ther. 2024, 9, 223. [Google Scholar] [PubMed]
- Álvarez-Rodríguez, B.; Tiede, C.; Hoste, A.C.R.; Surtees, R.A.; Trinh, C.H.; Slack, G.S.; Chamberlain, J.; Hewson, R.; Fresco, A.; Sastre, P.; et al. Characterization and applications of a Crimean-Congo hemorrhagic fever virus nucleoprotein-specific Affimer: Inhibitory effects in viral replication and development of colorimetric diagnostic tests. PLoS Neglected Trop. Dis. 2020, 14, e0008364. [Google Scholar] [CrossRef] [PubMed]
- Spengler, J.R.; Patel, J.R.; Chakrabarti, A.K.; Zivcec, M.; García-Sastre, A.; Spiropoulou, C.F.; Bergeron, É. RIG-I Mediates an Antiviral Response to Crimean-Congo Hemorrhagic Fever Virus. J. Virol. 2015, 89, 10219–10229. [Google Scholar] [CrossRef]
- Sakshi; Dhaka, P.; Bedi, J.S.; Aulakh, R.S.; Singh, R.; Gill, J.P.S. Assessing and Prioritizing Zoonotic Diseases in Punjab, India: A One Health Approach. EcoHealth 2023, 20, 300–322. [Google Scholar] [CrossRef]
- Deyde, V.M.; Khristova, M.L.; Rollin, P.E.; Ksiazek, T.G.; Nichol, S.T. Crimean-Congo hemorrhagic fever virus genomics and global diversity. J. Virol. 2006, 80, 8834–8842. [Google Scholar] [CrossRef]
- Dowall, S.D.; Richards, K.S.; Graham, V.A.; Chamberlain, J.; Hewson, R. Development of an indirect ELISA method for the parallel measurement of IgG and IgM antibodies against Crimean-Congo haemorrhagic fever (CCHF) virus using recombinant nucleoprotein as antigen. J. Virol. Methods 2012, 179, 335–341. [Google Scholar] [CrossRef]
- Surtees, R.; Stern, D.; Ahrens, K.; Kromarek, N.; Lander, A.; Kreher, P.; Weiss, S.; Hewson, R.; Punch, E.K.; Barr, J.N.; et al. Development of a multiplex microsphere immunoassay for the detection of antibodies against highly pathogenic viruses in human and animal serum samples. PLoS Neglected Trop. Dis. 2020, 14, e0008699. [Google Scholar] [CrossRef]
- Burt, F.J.; Samudzi, R.R.; Randall, C.; Pieters, D.; Vermeulen, J.; Knox, C.M. Human defined antigenic region on the nucleoprotein of Crimean-Congo hemorrhagic fever virus identified using truncated proteins and a bioinformatics approach. J. Virol. Methods 2013, 193, 706–712. [Google Scholar] [CrossRef]
- Monteil, V.M.; Wright, S.C.; Dyczynski, M.; Kellner, M.J.; Appelberg, S.; Platzer, S.W.; Ibrahim, A.; Kwon, H.; Pittarokoilis, I.; Mirandola, M.; et al. Crimean-Congo haemorrhagic fever virus uses LDLR to bind and enter host cells. Nat. Microbiol. 2024, 9, 1499–1512. [Google Scholar] [CrossRef]
- Cui, H.; Shen, S.; Chen, L.; Fan, Z.; Wen, Q.; Xing, Y.; Wang, Z.; Zhang, J.; Chen, J.; La, B.; et al. Global epidemiology of severe fever with thrombocytopenia syndrome virus in human and animals: A systematic review and meta-analysis. Lancet Reg. Health West. Pac. 2024, 48, 101133. [Google Scholar] [CrossRef]
- Zhang, X.A.; Ma, Y.D.; Zhang, Y.F.; Hu, Z.Y.; Zhang, J.T.; Han, S.; Wang, G.; Li, S.; Wang, X.; Tang, F.; et al. A New Orthonairovirus Associated with Human Febrile Illness. N. Engl. J. Med. 2024, 391, 821–831. [Google Scholar] [CrossRef]
Amplified Gene | Primer Name | Primer Sequence | Fragment Size | Restriction Site |
---|---|---|---|---|
NP-C1 | C1-F | GGCGCGATCGCTTCCGAATTCGCCACCATGCTCAAA | 563 | EcoRI |
C1-R | CAGCCAACTCAGCAAGCGGCCGCTTAAGCGTAATCTGGTACGTCGTATGGGTAATTGACACGGAAACC | NotI | ||
NP-C2 | C2-F | GGCGCGATCGCTTCCGAATTCGCCAACACAGCAGCT | 554 | EcoRI |
C2-R | CAGCCAACTCAGCAAGCGGCCGCTTAAGCGTAATCTGGTACGTCGTATGGGTATGCGCTTTGTGCACG | NotI | ||
NP-C3 | C3-F | GGCGCGATCGCTTCCGAATTCCAGATTGACACTGCT | 614 | EcoRI |
C3-R | CAGCCAACTCAGCAAGCGGCCGCTTAAGCGTAATCTGG | NotI |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Fang, Y.; Zhang, N.; Wan, C. Development of a Luciferase Immunosorbent Assay for Detecting Crimean–Congo Hemorrhagic Fever Virus IgG Antibodies Based on Nucleoprotein. Viruses 2025, 17, 32. https://doi.org/10.3390/v17010032
Chen Q, Fang Y, Zhang N, Wan C. Development of a Luciferase Immunosorbent Assay for Detecting Crimean–Congo Hemorrhagic Fever Virus IgG Antibodies Based on Nucleoprotein. Viruses. 2025; 17(1):32. https://doi.org/10.3390/v17010032
Chicago/Turabian StyleChen, Qi, Yuting Fang, Ning Zhang, and Chengsong Wan. 2025. "Development of a Luciferase Immunosorbent Assay for Detecting Crimean–Congo Hemorrhagic Fever Virus IgG Antibodies Based on Nucleoprotein" Viruses 17, no. 1: 32. https://doi.org/10.3390/v17010032
APA StyleChen, Q., Fang, Y., Zhang, N., & Wan, C. (2025). Development of a Luciferase Immunosorbent Assay for Detecting Crimean–Congo Hemorrhagic Fever Virus IgG Antibodies Based on Nucleoprotein. Viruses, 17(1), 32. https://doi.org/10.3390/v17010032