Establishment of Echinococcus granulosus EgM123 Recombinant Gene Rabies Virus SRV9 and Identification of Its Biological Characteristics
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.1.1. Virus, Cells, and Serum
2.1.2. Reagents
2.1.3. Primer Design and Synthesis
2.2. Method
2.2.1. Establishment of pcDNA4-N, P, G, L Auxiliary Plasmid of Rabies Virus
2.2.2. Establishment of Eukaryotic Expression Vector of NPM Gene of Rabies Virus SRV9
2.2.3. Establishment of Eukaryotic Expression Vector of GΔCD+EgM123+eGFP of Rabies Virus SRV9
2.2.4. Establishment of N+P+M+GΔCD+EgM123+eGFP Large Segment Vector of Rabies Virus SRV9
2.2.5. Establishment of NPM+GΔCD+EgM123+eGFP+L Full-Length cDNA of Rabies Virus SRV9
2.2.6. Rescue of Echinococcus Granulosus EgM123 Recombinant Gene Rabies Virus SRV9
2.2.7. Genetic Stability of Rescued Virus
2.2.8. Morphological Characteristics of Recombinant Virus
2.2.9. Titer of Recombinant Virus Measured by qRT-PCR
2.2.10. Measurement of Median Lethal Dose (LD50) of Recombinant Virus
3. Results
3.1. Identification of Auxiliary Transfection Plasmids of Rabies Virus SRV9
3.2. Establishment of pcDNA4-N+P+M Eukaryotic Expression Vector and Identification of Recombinant Plasmids
3.3. Identification of pcDNA4-GΔCD+EgM123+eGFP Recombinant Plasmid
3.4. Identification of pcDNA4-NPM+GΔCD+EgM123+eGFP Recombinant Plasmid
3.5. Establishment of pcDNA4-NPM+GΔCD+EgM123+eGFP+L Full-Length cDNA
3.6. Observation of the Rescue Results of the Recombinant Virus Using a Fluorescence Microscope
3.7. Detection of Structural Genes of Recombinant Virus by RT-PCR
3.8. Characterization of Recombinant Virus by TEM
3.9. Titer Measurement of the Virus by qRT-PCR
3.10. Virulence Measurement of Recombinant Virus LD50
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, C.; Cahill, J.D. Epidemiology of Rabies and Current US Vaccine Guidelines. R. I. Med. J. 2020, 103, 51–53. [Google Scholar]
- Kumar, A.; Bhatt, S.; Kumar, A.; Rana, T. Canine rabies: An epidemiological significance, pathogenesis, diagnosis, prevention, and 405 public health issues. Comp. Immunol. Microbiol. Infect. Dis. 2023, 97, 101992. [Google Scholar] [CrossRef]
- Chen, S. Prevention and treatment measures for rabies. Yunnan Agric. 2020, 1, 67–69. [Google Scholar]
- Minghui, R.; Stone, M.; Semedo, M.H.; Nel, L.H. New global strategic plan to eliminate dog-mediated rabies by 2030. Lancet Glob. Health 2018, 6, e828–e829. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Zhang, Y.; Chen, Y.; Zhang, J.; Pei, J.; Cui, M.; Fu, Z.F.; Zhao, L.; Zhou, M. A Novel Oral Rabies Vaccine Enhances the Immunogenicity through Increasing Dendritic Cells Activation and Germinal Center Formation by Expressing U-OMP19 in a Mouse Model. Emerg. Microbes Infect. 2021, 10, 913–928. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Yu, Y. Research progress in oral rabies vaccine and its significance in eliminating rabies. Chin. J. Zoonoses 2022, 38, 733–739+743. [Google Scholar]
- Yan, W.; Xiang, R.; Chen, J.; Huang, C.; Yuan, Z.-G.; Huang, Y.; Luo, S.-J.; Huang, Z.; Xiang, H.; Wang, X.-H. Proteomics analysis of suckling mouse brain infected with attenuated rabies virus strain SRV9. Acta Virol. 2019, 63, 423–432. [Google Scholar] [CrossRef]
- Wang, H.; Jin, H.; Feng, N.; Zheng, X.; Li, L.; Qi, Y.; Liang, M.; Zhao, Y.; Wang, T.; Gao, Y.; et al. Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene. Virus Genes 2015, 50, 299–302. [Google Scholar] [CrossRef]
- Jiao, C.; Liu, D.; Jin, H.; Huang, P.; Zhang, H.; Li, Y.; Wang, H. Immunogenicity evaluation of a bivalent vaccine based on a recombinant rabies virus expressing gB protein of FHV-1 in mice and cats. Vet. J. 2024, 304, 106096. [Google Scholar] [CrossRef] [PubMed]
- Rahim, F.; Toguzbaeva, K.; Dzhusupov, O.K. The Impact of Human Cystic Echinococcosis in the Central Asian Region, 1990–2019. Turk. Parazitolojii Derg. 2024, 48, 89–95. [Google Scholar] [CrossRef]
- Henry, R.E.; Blanton, J.D.; Angelo, K.M.; Pieracci, E.G.; Stauffer, K.; Jentes, E.S.; Allen, J.; Glynn, M.; Brown, C.M.; Friedman, C.R.; et al. A country classification system to inform rabies prevention guidelines and regulations. J. Travel Med. 2022, 29, taac046. [Google Scholar] [CrossRef] [PubMed]
- Rojas, C.A.A.; Mathis, A.; Deplazes, P. Assessing the Contamination of Food and the Environment with Taenia and Echinococcus Eggs and Their Zoonotic Transmission. Curr. Clin. Microbiol. Rep. 2018, 5, 154–163. [Google Scholar] [CrossRef]
- Porcu, F.; Cantacessi, C.; Dessì, G.; Sini, M.F.; Ahmed, F.; Cavallo, L.; Nonnis, F.; Gibson, K.; Varcasia, C.; Joanny, G.; et al. ‘Fight the parasite’: Raising awareness of cystic echinococcosis in primary school 427 children in endemic countries. Parasites Vectors 2022, 15, 449. [Google Scholar] [CrossRef]
- Zhang, Z.Z.; Guo, G.; Li, J.; Shi, B.X.; Zhao, L.; Guo, B.P.; Zhang, X.; Wang, J.W.; Zheng, X.T.; Qi, W.J.; et al. Dog vaccination with EgM proteins against Echinococcus granulosus. Infect. Dis. Poverty 2018, 7, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Xian, J.; Zhao, P.; Zhao, W.; Pu, N.; Jia, X.; Zhang, Y.; Bo, X.; Wang, Z. Analyses of EgM123 Gene Sequence and Differential Expression of EgM Gene Family in Different Development Stages of Echinococcus granulosus. Prog. Vet. Med. 2017, 38, 20–26. [Google Scholar] [CrossRef]
- Zhao, L.; Apaxezi, M.; Wang, J.; Zhang, Z.; Guan, Y.; Wang, B.; Liu, Z.; Munila, T.; Liu, M.; Lv, F.; et al. IgG antibody level monitoring and immunohistochemical localization of dogs immunized with vaccine candidates against Echinococcus granulosus. Chin. J. Prev. Vet. Med. 2018, 40, 538–542. [Google Scholar]
- He, L. Construction of Recombinant Mycobacterium Smegmatis EgM123 from Echinococcus granulosus and Its Immunogenicity. Master’s Thesis, Xinjiang Medical University, Urumqi, China, 2019. [Google Scholar]
- Ilana, A.; Upievich, B.E.; Kenesovich, K.A.; Bekbosynovna, M.S.; Bakitzhanovna, Z.F.; Esmagambetovich, M.K.; Maratovich, S.Y.; Garipullievich, S.B.; Gabdullinovich, A.R. Epizootiology and biological characteristics of echinococcosis in agricultural animals, dogs, wild carnivores, and rodents in the Western region of the Republic of Kazakhstan. Vet. World 2023, 16, 2277–2286. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union One Health 2022 Zoonoses Report. EFSA J. 2023, 21, e8442. [Google Scholar]
- Li, C.; Zhang, Y.; Pang, M.; Zhang, Y.; Hu, C.; Fan, H. Metabolic mechanism and pharmacological study of albendazole in secondary hepatic alveolar echinococcosis (HAE) model rats. Antimicrob. Agents Chemother. 2024, 68, e0144923. [Google Scholar] [CrossRef]
- Sadr, S.; Simab, P.A.; Niazi, M.; Yousefsani, Z.; Lotfalizadeh, N.; Hajjafari, A.; Borji, H. Anti-inflammatory and immunomodulatory effects of mesenchymal stem cell therapy on parasitic drug resistance. Expert Rev. Anti-Infect. Ther. 2024, 22, 435–451. [Google Scholar] [CrossRef] [PubMed]
- Jabbar, A.; Ahmadi, A.; Irm, N.; Naseeb, I.; Madadi, S.; Lucero-Prisno, D.E. Rabies in Pakistan: Policies and recommendations. Public Health Chall. 2024, 3, e168. [Google Scholar] [CrossRef]
- Li, Q.; He, H.; Zhou, Y.; Wang, J.; Chen, H.; Liu, H. A single dose of recombinant adenoviral vector rabies vaccine expressing two copies of glycoprotein protects mice from lethal virus challenge. J. Infect. Dev. Ctries. 2024, 18, 1281–1290. [Google Scholar] [CrossRef]
- Wang, H.; Bi, J.; Feng, N.; Zhao, Y.; Wang, T.; Li, Y.; Yan, F.; Yang, S.; Xia, X. Construction of Recombinant Rabies Virus Vectors Expressing H or F Protein of Peste des Petits Ruminants Virus. Vet. Sci. 2022, 9, 555. [Google Scholar] [CrossRef] [PubMed]
- Yankowski, C.; Wirblich, C.; Kurup, D.; Schnell, M.J. Inactivated rabies-vectored SARS-CoV-2 vaccine provides long-term immune 454 response unaffected by vector immunity. NPJ Vaccines 2022, 7, 110. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.P.; Xing, L. The roles of rabies virus structural proteins in immune evasion and implications for vaccine development. Can. J. Microbiol. 2024, 70, 461–469. [Google Scholar] [CrossRef] [PubMed]
- Jin, H.; Jiao, C.; Cao, Z.; Huang, P.; Chi, H.; Bai, Y.; Liu, D.; Wang, J.; Feng, N.; Li, N.; et al. An inactivated recombinant rabies virus displaying the Zika virus prM-E induces protective immunity against both pathogens. PLoS Neglected Trop. Dis. 2021, 15, e0009484. [Google Scholar] [CrossRef] [PubMed]
- Tian, L.; Yan, L.; Zheng, W.; Lei, X.; Fu, Q.; Xue, X.; Wang, X.; Xia, X.; Zheng, X. A rabies virus vectored severe fever with thrombocytopenia syndrome (SFTS) bivalent candidate vaccine confers protective immune responses in mice. Vet. Microbiol. 2021, 257, 109076. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y. Rescue and Identification of Recombinant Rabies Virus with Chimeric Canine Coronavirus N, S Genes. Master’s Thesis, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China, 2020. [Google Scholar]
- Zhai, S.; Ma, S.; Zhao, S.; Gao, P.; Xia, T.; Su, X.; Yi, Z.; Wei, Y.; Jian, Z. Comparison of Virus Virulence between Rabies Virus rSRV9 Attenuated Strains and Parental SRV9 Strains. J. Xinjiang Agric. Univ. 2012, 35, 282–286. [Google Scholar]
Primer Name | Nucleotide Sequence (5′-3′) |
---|---|
N (F) | GGTACCCTACAATGGATGCCGACAAG |
N (R) | GATATCTCAACTTCTTATGAGTCACTCG |
P (F) | GGTACCCATGAGCAGATCTTTGTCAAT |
P (R) | GATATCTCGGTTAGCAAGATGTATAGCGATT |
G (F) | GGTACCAGGAAAGATGGTTCCTCAGGCTCTC |
G (R) | GATATCTTACAGTCTGGTCTCACCCCAC |
L (F) | GCGGCCGCATGCTCGATC |
L (R) | GTGAGCCTACCGATAAGCTT |
NPM (F) | GGTACCTGTTAAGCGTCTGATG |
NPM (R) | GATATCTTATTCTAGAAGCAG |
EGM123 (F) | GTGAATTTTGCCTGCCCGTT |
EGM123 (R) | AGCACAACCTCAGTCATGGG |
Plasmid Name | Initial Concentration (ng/μL) | Amount Used (μL) | Mass (μL) |
---|---|---|---|
pcDNA4-N | 1.43126 | 1 | 1.5 |
pcDNA4-P | 1.41548 | 1.1 | 1.5 |
pcDNA4-G | 1.39627 | 0.7 | 1 |
pcDNAg-L | 1.21937 | 0.82 | 1 |
pcDNA4-NPM+GΔCD+EgM123+eGFP+L (full-length cDNA) | 0.94863 | 4.22 | 4 |
Group | Virus Dilution Ratio | Number of Suckling Rats | Dose | Number of Deaths (Rats) | Mortality Rate p (%) |
---|---|---|---|---|---|
12th generation | 100 | 14 | 0.03 mL/rat | 13 | 92.86% |
10−1 | 18 | 0.03 mL/rat | 11 | 61.11% | |
10−2 | 9 | 0.03 mL/rat | 3 | 33.33% | |
LD50 titer | 10−1.4/0.03 mL |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Hou, M.; Su, G.; Ma, X.; Su, X.; Li, K.; Liu, S.; Xiao, L.; Yao, J.; Zhai, J.; et al. Establishment of Echinococcus granulosus EgM123 Recombinant Gene Rabies Virus SRV9 and Identification of Its Biological Characteristics. Viruses 2025, 17, 30. https://doi.org/10.3390/v17010030
Yang Y, Hou M, Su G, Ma X, Su X, Li K, Liu S, Xiao L, Yao J, Zhai J, et al. Establishment of Echinococcus granulosus EgM123 Recombinant Gene Rabies Virus SRV9 and Identification of Its Biological Characteristics. Viruses. 2025; 17(1):30. https://doi.org/10.3390/v17010030
Chicago/Turabian StyleYang, Yueqi, Mengdan Hou, Guicheng Su, Xiaoyan Ma, Xiaohui Su, Kunlei Li, Songhan Liu, Luheng Xiao, Jingjing Yao, Jiahao Zhai, and et al. 2025. "Establishment of Echinococcus granulosus EgM123 Recombinant Gene Rabies Virus SRV9 and Identification of Its Biological Characteristics" Viruses 17, no. 1: 30. https://doi.org/10.3390/v17010030
APA StyleYang, Y., Hou, M., Su, G., Ma, X., Su, X., Li, K., Liu, S., Xiao, L., Yao, J., Zhai, J., Wei, X., Zhou, Y., Lai, Q., Dong, Y., Liu, J., & Zhai, S. (2025). Establishment of Echinococcus granulosus EgM123 Recombinant Gene Rabies Virus SRV9 and Identification of Its Biological Characteristics. Viruses, 17(1), 30. https://doi.org/10.3390/v17010030