Immune Responses Induced by a Recombinant Lactiplantibacillus plantarum Surface-Displaying the gD Protein of Pseudorabies Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Viruses, Plasmids, and Cells
2.2. Construction of the pMG36e-LPxTG Recombinant Plasmid
2.3. Generation of the Recombinant pMG36e-NC8-PRV Plasmids
2.4. Flow Cytometry
2.5. Immunofluorescence Assay (IFA)
2.6. Western Blotting Analysis of the Recombinant Protein Expressed by rNC8-LP3065-EGFP
2.7. Immunization Protocols in Mice
2.8. Enzyme-Linked Immunosorbent Assay (ELISA)
2.9. Isolation of T Cells from the Spleens of the Immunized Mice
2.10. Analysis of CD4+ and CD8+ T Cells by Flow Cytometry
2.11. Measurement of PRV Genomic Copies in the Challenged Mice by Quantitative PCR (qPCR)
2.12. Ethics Statements
2.13. Statistical Analysis
3. Results
3.1. LP3065 Surface-Anchoring Motif Expressed EGFP Significantly
3.2. rNC8-LP3065-EGFP Can Bind to the DCs
3.3. The Extracellular Domain of gD Was Surface-Expressed in rNC8-LP3065-gD
3.4. Protein Expression of gD Antigen Anchored with LP3065 on the Surface of rNC8
3.5. rNC8-LP3065-gD Induced a Rapid Production of Adaptive Immune Response in Mice Injected by I.V.
3.6. rNC8-LP3065-gD-Immunized Mice Were Protected from PRV TJ Challenge
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, H.; Duan, X.; Liu, G.; Li, Y.; Dong, S.; Lin, J.; Zhang, R.; Cai, X.; Shan, H. Comparative Transcriptomic Analysis of PK15 Cells Infected with A PRV Variant and the Bartha-K/61 Vaccine Strain. Front. Microbiol. 2023, 14, 1164170. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Auclert, L.Z.; Zhai, X.; Wong, G.; Zhang, C.; Zhu, H.; Xing, G.; Wang, S.; He, W.; Li, K. Interspecies Transmission, Genetic Diversity, and Evolutionary Dynamics of Pseudorabies Virus. J. Infect. Dis. 2019, 219, 1705–1715. [Google Scholar] [CrossRef]
- Dong, L.X.; Hong, F.S.; Yan, C.L.; Fan, L.; Hua, D.J.; Cheng, L.X.; Yu, W.H.; Gong, T.K. Detection of Pseudorabies Virus Antibodies in Human Encephalitis Cases. Biomed. Environ. Sci. 2020, 33, 444–447. [Google Scholar]
- Berdeu, I.; Spataru, D.; Paraschiv, A. Vaccines: Past, Present and Future. One Health Risk Manag. 2021, 2, 27–35. [Google Scholar] [CrossRef]
- Karger, A.; Mettenleiter, T.C. Identification of Cell Surface Molecules that Interact with Pseudorabies Virus. J. Virol. 1996, 70, 2138–2145. [Google Scholar] [CrossRef] [PubMed]
- Abid, M.; Teklue, T.; Li, Y.; Wu, H.; Wang, T.; Qiu, H.J.; Sun, Y. Generation and Immunogenicity of a Recombinant Pseudorabies Virus Co-Expressing Classical Swine Fever Virus E2 Protein and Porcine Circovirus Type 2 Capsid Protein Based on Fosmid Library Platform. Pathogens 2019, 8, 279. [Google Scholar] [CrossRef] [PubMed]
- Pomeranz, L.E.; Reynolds, A.E.; Hengartner, C.J. Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine. Microbiol. Mol. Biol. Rev. 2005, 69, 462–500. [Google Scholar] [CrossRef]
- Kopp, M.; Granzow, H.; Fuchs, W.; Klupp, B.; Mettenleiter, T.C. Simultaneous Deletion of Pseudorabies Virus Tegument Protein UL11 and Glycoprotein M Severely Impairs Secondary Envelopment. J. Virol. 2004, 78, 3024–3034. [Google Scholar] [CrossRef]
- Peeters, B.; Bienkowska-Szewczyk, K.; Hulst, M.; Gielkens, A.; Kimman, T. Biologically Safe, Non-Transmissible Pseudorabies Virus Vector Vaccine Protects Pigs against Both Aujeszky’s Disease and Classical Swine Fever. J. Gen. Virol. 1997, 78, 3311–3315. [Google Scholar] [CrossRef]
- Jiang, Z.; Zhu, L.; Cai, Y.; Yan, J.; Fan, Y.; Lv, W.; Gong, S.; Yin, X.; Yang, X.; Sun, X.; et al. Immunogenicity and Protective Efficacy Induced By an mRNA Vaccine Encoding gD Antigen against Pseudorabies Virus Infection. Vet. Microbiol. 2020, 251, 108886. [Google Scholar] [CrossRef]
- Luo, Y.; Li, N.; Cong, X.; Wang, C.H.; Du, M.; Li, L.; Zhao, B.; Yuan, J.; Liu, D.D.; Li, S.; et al. Pathogenicity and Genomic Characterization of a Pseudorabies Virus Variant Isolated from Bartha-K61-Vaccinated Swine Population in China. Vet. Microbiol. 2014, 174, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Chen, Y.; Zhao, Y.; Lung, D.C.; Ye, Z.; Song, W.; Liu, F.F.; Cai, J.P.; Wong, W.M.; Yip, C.C.Y. Intravenous Injection of Coronavirus Disease 2019 (COVID-19) mRNA Vaccine Can Induce Acute Myopericarditis in Mouse Model. Clin. Infect. Dis. 2022, 74, 1933–1950. [Google Scholar] [CrossRef] [PubMed]
- Nicolai, L.; Leunig, A.; Pekayvaz, K.; Esefeld, M.; Anjum, A.; Rath, J.; Riedlinger, E.; Ehreiser, V.; Mader, M.; Eivers, L. Thrombocytopenia and Splenic Platelet-Directed Immune Responses after IV ChAdOx1 nCov-19 Administration. Blood 2022, 140, 478–490. [Google Scholar] [CrossRef] [PubMed]
- Larson, E.C.; Ellis Connell, A.L.; Rodgers, M.A.; Gubernat, A.K.; Gleim, J.L.; Moriarty, R.V.; Balgeman, A.J.; Ameel, C.L.; Jauro, S.; Tomko, J.A. Intravenous Bacille Calmette–Guérin Vaccination Protects Simian Immunodeficiency Virus-Infected Macaques from Tuberculosis. Nat. Microbiol. 2023, 8, 2080–2092. [Google Scholar] [CrossRef] [PubMed]
- Baharom, F.; Ramirez-Valdez, R.A.; Tobin, K.K.S.; Yamane, H.; Dutertre, C.A.; Khalilnezhad, A.; Reynoso, G.V.; Coble, V.L.; Lynn, G.M.; Mule, M.P.; et al. Intravenous Nanoparticle Vaccination Generates Stem-like TCF1(+) Neoantigen-Specific CD8+ T cells. Nat. Immunol. 2021, 22, 41–52. [Google Scholar] [CrossRef]
- Seder, R.A.; Chang, L.J.; Enama, M.E.; Zephir, K.L.; Sarwar, U.N.; Gordon, I.J.; Holman, L.A.; James, E.R.; Billingsley, P.F.; Gunasekera, A.; et al. Protection against Malaria by Intravenous Immunization with a Nonreplicating Sporozoite Vaccine. Science 2013, 341, 1359–1365. [Google Scholar] [CrossRef]
- Darrah, P.A.; Zeppa, J.J.; Maiello, P.; Hackney, J.A.; Wadsworth, M.H., 2nd; Hughes, T.K.; Pokkali, S.; Swanson, P.A., 2nd; Grant, N.L.; Rodgers, M.A.; et al. Prevention of Tuberculosis in Macaques after Intravenous BCG Immunization. Nature 2020, 577, 95–102. [Google Scholar] [CrossRef]
- Baharom, F.; Ramirez-Valdez, R.A.; Khalilnezhad, A.; Khalilnezhad, S.; Dillon, M.; Hermans, D.; Fussell, S.; Tobin, K.K.S.; Dutertre, C.A.; Lynn, G.M.; et al. Systemic Vaccination Induces CD8+ T Cells and Remodels the Tumor Microenvironment. Cell 2022, 185, 4317–4332. [Google Scholar] [CrossRef]
- Sunmola, A.A.; Ogbole, O.O.; Faleye, T.O.C.; Adetoye, A.; Adeniji, J.A.; Ayeni, F.A. Antiviral Potentials of Lactobacillus plantarum, Lactobacillus amylovorus, and Enterococcus hirae against Selected Enterovirus. Folia Microbiol. 2019, 64, 257–264. [Google Scholar] [CrossRef]
- Al Kassaa, I.; Hamze, M.; Hober, D.; Chihib, N.E.; Drider, D. Identification of Vaginal Lactobacilli with Potential Probiotic Properties Isolated from Women in North Lebanon. Microb. Ecol. 2014, 67, 722–734. [Google Scholar] [CrossRef]
- Jiang, Y.; Hu, J.; Guo, Y.; Yang, W.; Ye, L.; Shi, C.; Liu, Y.; Yang, G.; Wang, C. Construction and Immunological Evaluation of Recombinant Lactobacillus plantarum Expressing HN of Newcastle Disease virus and DC-Targeting Peptide Fusion Protein. J. Biotechnol. 2015, 216, 82–89. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Jiang, H.; Yang, R.; Zhang, S.; Zhao, W.; Hu, J.; Jiang, Y.; Yang, W.; Huang, H.; Shi, C. Construction and Evaluation of Recombinant Lactobacillus plantarum NC8 Delivering One Single or Two Copies of G protein Fused with a DC-Targeting Peptide (DCpep) As Novel Oral Rabies Vaccine. Vet. Microbiol. 2020, 251, 108906. [Google Scholar] [CrossRef] [PubMed]
- Huang, K.Y.; Yang, G.L.; Jin, Y.B.; Liu, J.; Chen, H.L.; Wang, P.-B.; Jiang, Y.L.; Shi, C.W.; Huang, H.B.; Wang, J.Z. Construction and Immunogenicity Analysis of Lactobacillus plantarum Expressing a Porcine Epidemic Diarrhea Virus S Gene Fused to A DC-Targeting Peptide. Virus Res. 2018, 247, 84–93. [Google Scholar] [CrossRef] [PubMed]
- Lopusiewicz, L.; Drozłowska, E.; Tarnowiecka-Kuca, A.; Bartkowiak, A.; Mazurkiewicz-Zapalowicz, K.; Salachna, P. Biotransformation of Flaxseed Oil Cake into Bioactive Camembert-Analogue Using Lactic Acid Bacteria, Penicillium camemberti and Geotrichum candidum. Microorganism 2020, 8, 1266. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.T.; Yang, G.L.; Shi, S.H.; Liu, Y.Y.; Huang, H.B.; Jiang, Y.L.; Wang, J.Z.; Shi, C.W.; Jing, Y.B.; Wang, C.F. Protection of Chickens against H9N2 Avian Influenza Virus Challenge with Recombinant Lactobacillus plantarum Expressing Conserved Antigens. Appl. Microbiol. Biotechnol. 2017, 101, 4593–4603. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, Q.; Jiang, Y.; Yang, W.; Huang, H.; Shi, C.; Yang, G.; Wang, C. Surface-Displayed Porcine IFN-λ3 in Lactobacillus plantarum Inhibits Porcine Enteric Coronavirus Infection of Porcine Intestinal Epithelial Cells. J. Microbiol. Biotechnol. 2020, 30, 515–525. [Google Scholar] [CrossRef]
- Michon, C.; Langella, P.; Eijsink, V.; Mathiesen, G.; Chatel, J.M. Display of Recombinant Proteins at the Surface of Lactic Acid Bacteria: Strategies and Applications. Microb. Cell Fact. 2016, 15, 70. [Google Scholar] [CrossRef] [PubMed]
- Fischetti, V.A.; Pancholi, V.; Schneewind, O. Conservation of A Hexapeptide Sequence in the Anchor Region of Surface Proteins from Gram-Positive Cocci. Mol. Microbiol. 1990, 4, 1603–1605. [Google Scholar] [CrossRef]
- Mazmanian, S.K.; Liu, G.; Ton That, H.; Schneewind, O. Staphylococcus aureus Sortase, An Enzyme that Anchors Surface Proteins to the Cell Wall. Science 1999, 285, 760–763. [Google Scholar] [CrossRef]
- Lu, Y.; Liu, Z.H.; Li, Y.X.; Xu, H.L.; Fang, W.H.; He, F. Targeted Delivery of Nanovaccine to Dendritic Cells via DC-Binding Peptides Induces Potent Antiviral Immunity in vivo. Int. J. Nanomed. 2022, 17, 1593–1608. [Google Scholar] [CrossRef] [PubMed]
- Curiel, T.J.; Morris, C.; Brumlik, M.; Landry, S.J.; Finstad, K.; Nelson, A.; Joshi, V.; Hawkins, C.; Alarez, X.; Lackner, A.; et al. Peptides Identified Through Phage Display Direct Immunogenic Antigen to Dendritic Cells. J. Immunol. 2004, 172, 7425–7431. [Google Scholar] [CrossRef] [PubMed]
- Lane, P.J.; Gaspal, F.M.; Kim, M.Y. Two Sides of a Cellular Coin: CD4+CD3+ Cells Regulate Memory Responses and Lymph Node Organization. Nat. Rev. Immunol. 2005, 5, 655–660. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Huang, L.; Li, J.; Wang, G.; Shi, Y. An Attempt of a New Strategy in PRV Prevention: Co-Injection with Inactivated Enterococcus faecium and Inactivated Pseudorabies Virus Intravenously. Viruses 2023, 15, 1755. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequence a (5′-3′) |
---|---|
LP1447-F | GGCGGCCGCGGCGGATCTAGAATGGCTAAATTCAGGCGTCTAGTT |
LP1447-R | ACGTGCTGTAATTTGAAGCTTTCACTCCCTTCGGCGTTGCAT |
LP2940-F | GGCGGCCGCGGCGGATCTAGAATGTCAAAAGCGCTTAAGATAGTGA |
LP2940-R | ACGTGCTGTAATTTGAAGCTTTTAATCAGTTGTTTTATGGCGCC |
LP3065-F | GGCGGCCGCGGCGGATCTAGAATGCCGAATAAATGGTGGCGATT |
LP3065-R | CACGTGCTGTAATTTGAAGCTTTTACGCATTCCGTTCACCCCCAT |
LPxTG-EGFP-F | GGCGGCGGAGGTTCACTCGAGATGGTGAGCAAGGGCGAGGAGC |
LPxTG-EGFP-R | GGTGGGACCAGGCTGAGGATCCCTTGTACAGCTCGTCCATGCCG |
pMG36e-EGFP-F | CGCCCGGGGATCGATCCTCTAGAATGGTGAGCAAGGGCGAGGAGC |
pMG36e-EGFP-R | GTTTTCAGACTTTGCAAGCTTTTACTTGTACAGCTCGTCCATGCC |
LP3065-gD-F | AAGGCGGCGGAGGTTCACTCGAGATGCTGCTCGCAGCGCTATT |
LP3065-gD-R | GTGGGACCAGGCTGAGGATCCCGAGA GCCCGGCGCGGCGGTGGTCC |
PRV-F (qPCR) | TCCTCGACGATGCAGTTGAC |
PRV-R (qPCR) | ACCAACGACACCTACACCAAG |
Groups | Inoculum | Number of Mice | Dose per Mouse | PRV TJ Challenge |
---|---|---|---|---|
1 | rNC8-LP3065-gD | 13 | 109 CFU, 200 µL | Yes |
2 | rNC8-pMG36e | 13 | 109 CFU, 200 µL | Yes |
3 | PBS | 13 | 200 µL | Yes |
4 | PBS | 5 | 200 µL | No |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moon, A.; Huang, J.; Song, X.; Wang, T.; Wang, Y.; Li, Y.; Sun, Y.; Wu, H.; Qiu, H. Immune Responses Induced by a Recombinant Lactiplantibacillus plantarum Surface-Displaying the gD Protein of Pseudorabies Virus. Viruses 2024, 16, 1189. https://doi.org/10.3390/v16081189
Moon A, Huang J, Song X, Wang T, Wang Y, Li Y, Sun Y, Wu H, Qiu H. Immune Responses Induced by a Recombinant Lactiplantibacillus plantarum Surface-Displaying the gD Protein of Pseudorabies Virus. Viruses. 2024; 16(8):1189. https://doi.org/10.3390/v16081189
Chicago/Turabian StyleMoon, Assad, Jingshan Huang, Xin Song, Tao Wang, Yanjin Wang, Yongfeng Li, Yuan Sun, Hongxia Wu, and Huaji Qiu. 2024. "Immune Responses Induced by a Recombinant Lactiplantibacillus plantarum Surface-Displaying the gD Protein of Pseudorabies Virus" Viruses 16, no. 8: 1189. https://doi.org/10.3390/v16081189
APA StyleMoon, A., Huang, J., Song, X., Wang, T., Wang, Y., Li, Y., Sun, Y., Wu, H., & Qiu, H. (2024). Immune Responses Induced by a Recombinant Lactiplantibacillus plantarum Surface-Displaying the gD Protein of Pseudorabies Virus. Viruses, 16(8), 1189. https://doi.org/10.3390/v16081189