ML241 Antagonizes ERK 1/2 Activation and Inhibits Rotavirus Proliferation
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Rotavirus Amplification and Titer Determination
2.3. Enzyme-Linked Immunosorbent Assay
2.4. Cell Viability Determination
2.5. Immunofluorescence
2.6. Real-Time Fluorescence Quantitative PCR
2.7. Western Blotting
2.8. Animal Experiments
2.9. HE Staining Experiment for Small Intestinal Tissue
2.10. Transmission Electron Microscopy Experiment of Small Intestinal Tissue
2.11. Statistical Analyses
3. Results
3.1. Screening of Anti-RV Small-Molecule Compounds
3.2. In Vitro Effects of ML241 on Rotavirus
3.3. In Vivo Effects of ML241 on Rotavirus
3.4. ML241 Antagonizes ERK 1/2 Activation of the MAPK Signaling Pathway by RV and Inhibits Rotavirus Replication
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Troeger, C.; Khalil, I.A.; Rao, P.C.; Cao, S.; Blacker, B.F.; Ahmed, T.; Armah, G.; Bines, J.E.; Brewer, T.G.; Colombara, D.V.; et al. Rotavirus Vaccination and the Global Burden of Rotavirus Diarrhea Among Children Younger Than 5 Years. JAMA Pediatr. 2018, 172, 958–965. [Google Scholar] [CrossRef]
- Crawford, S.E.; Ramani, S.; Tate, J.E.; Parashar, U.D.; Svensson, L.; Hagbom, M.; Franco, M.A.; Greenberg, H.B.; O’Ryan, M.; Kang, G.; et al. Rotavirus infection. Nat. Rev. Dis. Primers 2017, 3, 17083. [Google Scholar] [CrossRef] [PubMed]
- Gandhi, G.R.; Barreto, P.G.; Lima, B.d.S.; Quintans, J.d.S.S.; Araújo, A.A.d.S.; Narain, N.; Quintans-Júnior, L.J.; Gurgel, R.Q. Medicinal plants and natural molecules with in vitro and in vivo activity against rotavirus: A systematic review. Phytomedicine 2016, 23, 1830–1842. [Google Scholar] [CrossRef]
- Michałek, D.; Kołodziej, M.; Konarska, Z.; Szajewska, H. Efficacy and safety of gelatine tannate for the treatment of acute gastroenteritis in children: Protocol of a randomised controlled trial: Table 1. BMJ Open 2016, 6, e010530. [Google Scholar] [CrossRef]
- Van Dycke, J.; Arnoldi, F.; Papa, G.; Vandepoele, J.; Burrone, O.R.; Mastrangelo, E.; Tarantino, D.; Heylen, E.; Neyts, J.; Rocha-Pereira, J. A Single Nucleoside Viral Polymerase Inhibitor Against Norovirus, Rotavirus, and Sapovirus-Induced Diarrhea. J. Infect. Dis. 2018, 218, 1753–1758. [Google Scholar] [CrossRef]
- Kim, J.-H.; Kim, K.; Kim, W. Genipin inhibits rotavirus-induced diarrhea by suppressing viral replication and regulating inflammatory responses. Sci. Rep. 2020, 10, 15836. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Liao, D.; He, B.; Pu, R.; Cui, Y.; Zhou, G. Deoxyshikonin inhibited rotavirus replication by regulating autophagy and oxidative stress through SIRT1/FoxO1/Rab7 axis. Microb. Pathog. 2023, 178, 106065. [Google Scholar] [CrossRef]
- Zhou, X.; Li, Y.; Li, T.; Cao, J.; Guan, Z.; Xu, T.; Jia, G.; Ma, G.; Zhao, R. Portulaca oleracea L. Polysaccharide Inhibits Porcine Rotavirus In Vitro. Animals 2023, 13, 2306. [Google Scholar] [CrossRef]
- Chen, S.; Ding, S.; Yin, Y.; Xu, L.; Li, P.; Peppelenbosch, M.P.; Pan, Q.; Wang, W. Suppression of pyrimidine biosynthesis by targeting DHODH enzyme robustly inhibits rotavirus replication. Antivir. Res. 2019, 167, 35–44. [Google Scholar] [CrossRef]
- Eichwald, C.; De Lorenzo, G.; Schraner, E.M.; Papa, G.; Bollati, M.; Swuec, P.; de Rosa, M.; Milani, M.; Mastrangelo, E.; Ackermann, M. Identification of a Small Molecule That Compromises the Structural Integrity of Viroplasms and Rotavirus Double-Layered Particles. J. Virol. 2018, 92, e01943-17. [Google Scholar] [CrossRef]
- La Frazia, S.; Ciucci, A.; Arnoldi, F.; Coira, M.; Gianferretti, P.; Angelini, M.; Belardo, G.; Burrone, O.R.; Rossignol, J.-F.; Santoro, M.G. Thiazolides, a New Class of Antiviral Agents Effective against Rotavirus Infection, Target Viral Morphogenesis, Inhibiting Viroplasm Formation. J. Virol. 2013, 87, 11096–11106. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Feng, C.; Luo, D.; Zhao, R.; Kannan, P.R.; Yin, Y.; Iqbal, M.Z.; Hu, Y.; Kong, X. Metformin Hydrochloride Significantly Inhibits Rotavirus Infection in Caco2 Cell Line, Intestinal Organoids, and Mice. Pharmaceuticals 2023, 16, 1279. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Zhang, Q.; Xu, Z.; Tang, Q.; Liu, X.; Niu, D.; Gao, X.; Lan, K.; Wu, S. Dyngo-4a protects mice from rotavirus infection by affecting the formation of dynamin 2 oligomers. Sci. Bull. 2020, 65, 1796–1799. [Google Scholar] [CrossRef]
- Araud, E.; Fuzawa, M.; Shisler, J.L.; Li, J.; Nguyen, T.H. UV Inactivation of Rotavirus and Tulane Virus Targets Different Components of the Virions. Appl. Environ. Microbiol. 2020, 86, e02436-19. [Google Scholar] [CrossRef]
- RWard, R.L.; Kapikian, A.Z.; Goldberg, K.M.; Knowlton, D.R.; Watson, M.W.; Rappaport, R. Serum Rotavirus Neutralizing-Antibody Titers Compared by Plaque Reduction and Enzyme-Linked Immunosorbent Assay-Based Neutralization Assays. J. Clin. Microbiol. 1996, 34, 983–985. [Google Scholar] [CrossRef]
- Fix, A.D.; Harro, C.; McNeal, M.; Dally, L.; Flores, J.; Robertson, G.; Boslego, J.W.; Cryz, S. Safety and immunogenicity of a parenterally administered rotavirus VP8 subunit vaccine in healthy adults. Vaccine 2015, 33, 3766–3772. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, S.; Hickey, J.M.; Sahni, N.; Toth, R.T.; Robertson, G.A.; Sitrin, R.; Cryz, S.; Joshi, S.B.; Volkin, D.B. Recombinant Subunit Rotavirus Trivalent Vaccine Candidate: Physicochemical Comparisons and Stability Evaluations of Three Protein Antigens. J. Pharm. Sci. 2020, 109, 380–393. [Google Scholar] [CrossRef] [PubMed]
- Groome, M.J.; Fairlie, L.; Morrison, J.; Fix, A.; Koen, A.; Masenya, M.; Jose, L.; Madhi, S.A.; Page, N.; McNeal, M.; et al. Safety and immunogenicity of a parenteral trivalent P2-VP8 subunit rotavirus vaccine: A multisite, randomised, double-blind, placebo-controlled trial. Lancet Infect. Dis. 2020, 20, 851–863. [Google Scholar] [CrossRef] [PubMed]
- Eric, M.K.; Mathew, D.E.; Rashi, G.; Michael, D.B. Development of a Real-Time Reverse Transcription-PCR Assay To Detect and Quantify Group A Rotavirus Equine-Like G3 Strains. J. Clin. Microbiol. 2021, 59, e02602-20. [Google Scholar]
- Boshuizen, J.A.; Reimerink, J.H.J.; Korteland-van Male, A.M.; van Ham, V.J.J.; Koopmans, M.P.G.; Büller, H.A.; Dekker, J.; Einerhand, A.W.C. Changes in Small Intestinal Homeostasis, Morphology, and Gene Expression during Rotavirus Infection of InfantMice. J. Virol. 2003, 77, 13005–13016. [Google Scholar] [CrossRef]
- Hayashi, M.A.F.; Ducancel, F.; Konno, K. Natural Peptides with Potential Applications in Drug Development, Diagnosis, and/or Biotechnology. Int. J. Pept. 2012, 2012, 757838. [Google Scholar] [CrossRef] [PubMed]
- Islam, K.U.; Anwar, S.; Patel, A.A.; Mirdad, M.T.; Mirdad, M.T.; Azmi, M.I.; Ahmad, T.; Fatima, Z.; Iqbal, J. Global Lipidome Profiling Revealed Multifaceted Role of Lipid Species in Hepatitis C Virus Replication, Assembly, and Host Antiviral Response. Viruses 2023, 15, 464. [Google Scholar] [CrossRef] [PubMed]
- Al Adem, K.; Shanti, A.; Stefanini, C.; Lee, S. Inhibition of SARS-CoV-2 Entry into Host Cells Using Small Molecules. Pharmaceuticals 2020, 13, 447. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Li, S.; Zhong, W. Mechanism of Action of Small-Molecule Agents in Ongoing Clinical Trials for SARS-CoV-2: A Review. Front. Pharmacol. 2022, 13, 840639. [Google Scholar] [CrossRef] [PubMed]
- Pandey, A.; Nikam, A.N.; Shreya, A.B.; Mutalik, S.P.; Gopalan, D.; Kulkarni, S.; Padya, B.S.; Fernandes, G.; Mutalik, S.; Prassl, R. Potential therapeutic targets for combating SARS-CoV-2: Drug repurposing, clinical trials and recent advancements. Life Sci. 2020, 256, 117883. [Google Scholar] [CrossRef] [PubMed]
- Chou, T.F.; Li, K.; Frankowski, K.J.; Schoenen, F.J.; Deshaies, R.J. Structure–Activity Relationship Study Reveals ML240 and ML241 as Potent and Selective Inhibitors of p97 ATPase. ChemMedChem 2013, 8, 297–312. [Google Scholar] [CrossRef] [PubMed]
- Tillotson, J.; Zerio, C.J.; Harder, B.; Ambrose, A.J.; Jung, K.S.; Kang, M.; Zhang, D.D.; Chapman, E. Arsenic Compromises Both p97 and Proteasome Functions. Chem. Res. Toxicol. 2017, 30, 1508–1514. [Google Scholar] [CrossRef]
- Wortzel, I.; Seger, R. The ERK Cascade: Distinct Functions within Various Subcellular Organelles. Genes Cancer 2011, 2, 195–209. [Google Scholar] [CrossRef] [PubMed]
- Rossen, J.W.A.; Bouma, J.; Raatgeep, R.H.C.; Büller, H.A.; Einerhand, A.W.C. Inhibition of Cyclooxygenase Activity Reduces Rotavirus Infection at a Postbinding Step. J. Virol. 2004, 78, 9721–9730. [Google Scholar] [CrossRef]
- Bagchi, P.; Dutta, D.; Chattopadhyay, S.; Mukherjee, A.; Halder, U.C.; Sarkar, S.; Kobayashi, N.; Komoto, S.; Taniguchi, K.; Chawla-Sarkar, M. Rotavirus Nonstructural Protein 1 Suppresses Virus-Induced Cellular Apoptosis To Facilitate Viral Growth by Activating the Cell Survival Pathways during Early Stages of Infection. J. Virol. 2010, 84, 6834–6845. [Google Scholar] [CrossRef]
- Bagchi, P.; Nandi, S.; Nayak, M.K.; Chawla-Sarkar, M. Molecular Mechanism behind Rotavirus NSP1-Mediated PI3 Kinase Activation: Interaction between NSP1 and the p85 Subunit of PI3 Kinase. J. Virol. 2013, 87, 2358–2362. [Google Scholar] [CrossRef]
- Halasz, P.; Holloway, G.; Coulson, B.S. Death mechanisms in epithelial cells following rotavirus infection, exposure to inactivated rotavirus or genome transfection. J. Gen. Virol. 2010, 91, 2007–2018. [Google Scholar] [CrossRef]
- Esona, M.D.; Gautam, R. Rotavirus. Clin. Lab. Med. 2015, 35, 363–391. [Google Scholar] [CrossRef]
- Feng, N.; Sen, A.; Nguyen, H.; Vo, P.; Hoshino, Y.; Deal, E.M.; Greenberg, H.B. Variation in Antagonism of the Interferon Response to Rotavirus NSP1 Results in Differential Infectivity in Mouse Embryonic Fibroblasts. J. Virol. 2009, 83, 6987–6994. [Google Scholar] [CrossRef][Green Version]
- Barro, M.; Patton, J.T. Rotavirus NSP1 Inhibits Expression of Type I Interferon by Antagonizing the Function of Interferon Regulatory Factors IRF3, IRF5, and IRF7. J. Virol. 2007, 81, 4473–4481. [Google Scholar] [CrossRef]
- Bagchi, P.; Bhowmick, R.; Nandi, S.; Kant Nayak, M.; Chawla-Sarkar, M. Rotavirus NSP1 inhibits interferon induced non-canonical NFκB activation by interacting with TNF receptor associated factor 2. Virology 2013, 444, 41–44. [Google Scholar] [CrossRef]
- Chen, M.; Lin, X.; Zhang, L.; Hu, X. Effects of nuclear factor-κB signaling pathway on periodontal ligament stem cells under lipopolysaccharide-induced inflammation. Bioengineered 2022, 13, 7951–7961. [Google Scholar] [CrossRef]
- Ye, J.; Ye, C.; Huang, Y.; Zhang, N.; Zhang, X.; Xiao, M. Ginkgo biloba sarcotesta polysaccharide inhibits inflammatory responses through suppressing both NF-κB and MAPK signaling pathway. J. Sci. Food Agric. 2018, 99, 2329–2339. [Google Scholar] [CrossRef]









| Name | Sequence | |
|---|---|---|
| ZTR-68 | Forward primer | ACCATCTACACATGACCCTC | 
| Reverse primsr | GGTCACATAACGCCCC | |
| TaqMan probe | FAM-ATGAGCACAATAGTTAAAAGCTAACACTGTCAA-TAMRA | |
| SA11 | Forward primer | GTTGTCATCTATGCATAACCCTC | 
| Reverse primsr | ACATAACGCCCCTATAGCCA | |
| TaqMan probe | FAM-ATGAGCACAATAGTTAAAAGCTAACACTGTCAA-TAMRA | 
| Group | Quantity | Virus (SA11) Dose | The Medicine Dose (mg/kg) | Frequency of Administration | Route of Administration | 
|---|---|---|---|---|---|
| RV− | 11 | PBS (100 μL) | − | − | gavage | 
| RV+ | 11 | 105 pfu | − | − | gavage | 
| ML241 (1 h) + RV | 11 | 105 pfu | 20 | QD | gavage | 
| ML241 + RV | 11 | 105 pfu | 20 | QD | gavage | 
| RV (24 h) + ML241 | 11 | 105 pfu | 20 | QD | gavage | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Hu, X.; Wu, J.; Lin, X.; Chen, R.; Lu, C.; Song, X.; Leng, Q.; Li, Y.; Kuang, X.; et al. ML241 Antagonizes ERK 1/2 Activation and Inhibits Rotavirus Proliferation. Viruses 2024, 16, 623. https://doi.org/10.3390/v16040623
Wang J, Hu X, Wu J, Lin X, Chen R, Lu C, Song X, Leng Q, Li Y, Kuang X, et al. ML241 Antagonizes ERK 1/2 Activation and Inhibits Rotavirus Proliferation. Viruses. 2024; 16(4):623. https://doi.org/10.3390/v16040623
Chicago/Turabian StyleWang, Jinlan, Xiaoqing Hu, Jinyuan Wu, Xiaochen Lin, Rong Chen, Chenxing Lu, Xiaopeng Song, Qingmei Leng, Yan Li, Xiangjing Kuang, and et al. 2024. "ML241 Antagonizes ERK 1/2 Activation and Inhibits Rotavirus Proliferation" Viruses 16, no. 4: 623. https://doi.org/10.3390/v16040623
APA StyleWang, J., Hu, X., Wu, J., Lin, X., Chen, R., Lu, C., Song, X., Leng, Q., Li, Y., Kuang, X., Li, J., Yao, L., Tang, X., Ye, J., Zhang, G., Sun, M., Zhou, Y., & Li, H. (2024). ML241 Antagonizes ERK 1/2 Activation and Inhibits Rotavirus Proliferation. Viruses, 16(4), 623. https://doi.org/10.3390/v16040623
 
        


 
       