Droplet Digital PCR Enhances Sensitivity of Canine Distemper Virus Detection
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples Collection
2.2. RNA Viral Isolation and Reverse Transcription
2.3. Plasmid Preparation
2.4. CDV Detection by Conventional Reverse-Transcription PCR
2.5. Real-Time Quantitative PCR
2.6. Droplet Digital PCR Assay
2.7. Diagnostic Performance Evaluation and Data Analysis
3. Results
3.1. Description of Clinical Signs in Canines Diagnosed with Canine Distemper
3.2. Analytical Sensitivity of RT-qPCR and ddPCR
3.3. Precision of RT-qPCR and ddPCR
3.4. Comparing the Performance of Conventional RT-PCR, RT-qPCR, and ddPCR Against the Clinical Diagnosis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Maes, P.; Amarasinghe, G.K.; Ayllón, M.A.; Basler, C.F.; Bavari, S.; Blasdell, K.R.; Briese, T.; Brown, P.A.; Bukreyev, A.; Balkema-Buschmann, A.; et al. Taxonomy of the Order Mononegavirales: Second Update 2018. Arch. Virol. 2019, 164, 1233–1244. [Google Scholar] [CrossRef]
- Roelke-Parker, M.E.; Munson, L.; Packer, C.; Kock, R.; Cleaveland, S.; Carpenter, M.; O’Brien, S.J.; Pospischil, A.; Hofmann-Lehmann, R.; Lutz, H.; et al. A Canine Distemper Virus Epidemic in Serengeti Lions (Panthera leo). Nature 1996, 379, 441–445. [Google Scholar] [CrossRef]
- Amundson, T.E.; Yuill, T.M. Prevalence of selected pathogenic microbial agents in the red fox (Vulpes fulva) and gray fox (Urocyon cinereoargenteus) of southwestern Wisconsin. J. Wildl. Dis. 1981, 17, 17–22. [Google Scholar] [CrossRef]
- Uhl, E.W.; Kelderhouse, C.; Buikstra, J.; Blick, J.P.; Bolon, B.; Hogan, R.J. New World Origin of Canine Distemper: Interdisciplinary Insights. Int. J. Paleopathol. 2019, 24, 266–278. [Google Scholar] [CrossRef]
- Harder, T.; Osterhaus, A. Canine Distemper Virus-a Morbillivirus in Search of New Hosts? Trends Microbiol. 1997, 5, 120–124. [Google Scholar] [CrossRef]
- Greene, C.E. Infectious Canine Hepatitis and Canine Acidophil Cell Hepatitis. Infect. Dis. Dog Cat 2006, 3, 41–53. [Google Scholar]
- Beineke, A.; Puff, C.; Seehusen, F.; Baumgärtner, W. Pathogenesis and Immunopathology of Systemic and Nervous Canine Distemper. Vet. Immunol. Immunopathol. 2009, 127, 1–18. [Google Scholar] [CrossRef]
- Avila, M.; Khosravi, M.; Alves, L.; Ader-Ebert, N.; Bringolf, F.; Zurbriggen, A.; Plemper, R.K.; Plattet, P. Canine Distemper Virus Envelope Protein Interactions Modulated by Hydrophobic Residues in the Fusion Protein Globular Head. J. Virol. 2015, 89, 1445–1451. [Google Scholar] [CrossRef]
- Tipold, A.; Vandevelde, M.; Jaggy, A. Neurological Manifestations of Canine Distemper Virus Infection. J. Small Anim. Pract. 1992, 33, 466–470. [Google Scholar] [CrossRef]
- Martella, V.; Elia, G.; Buonavoglia, C. Canine Distemper Virus. Vet. Clin. N. Am. Small Anim. Pract. 2008, 38, 787–797. [Google Scholar]
- Lempp, C.; Spitzbarth, I.; Puff, C.; Cana, A.; Kegler, K.; Techangamsuwan, S.; Baumgärtner, W.; Seehusen, F. New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis. Viruses 2014, 6, 2571–2601. [Google Scholar] [CrossRef]
- Fischer, C.D.B.; Ikuta, N.; Canal, C.W.; Makiejczuk, A.; da Costa Allgayer, M.; Cardoso, C.H.; Lehmann, F.K.; Fonseca, A.S.K.; Lunge, V.R. Detection and Differentiation of Field and Vaccine Strains of Canine Distemper Virus Using Reverse Transcription Followed by Nested Real Time PCR (RT-NqPCR) and RFLP Analysis. J. Virol. Methods 2013, 194, 39–45. [Google Scholar] [CrossRef]
- Saito, T.B.; Alfieri, A.A.; Wosiacki, S.R.; Negrao, F.J.; Morais, H.S.A.; Alfieri, A.F. Detection of Canine Distemper Virus by Reverse Transcriptase-Polymerase Chain Reaction in the Urine of Dogs with Clinical Signs of Distemper Encephalitis. Res. Vet. Sci. 2006, 80, 116–119. [Google Scholar] [CrossRef]
- Athanasiou, L.V.; Kantere, M.C.; Kyriakis, C.S.; Pardali, D.; Adamama Moraitou, K.; Polizopoulou, Z.S. Evaluation of a Direct Immunofluorescent Assay and/or Conjunctival Cytology for Detection of Canine Distemper Virus Antigen. Viral Immunol. 2018, 31, 272–275. [Google Scholar] [CrossRef]
- Temilade, B.E.; Solomon, O.O.O.; Omotayo, O.E.; Omezuruike, O.I. Seropositivity of Canine Distemper Virus (CDV) in Dogs Presenting at Abeokuta, Nigeria. Public Health Res. 2015, 5, 109–119. [Google Scholar]
- Di Francesco, C.E.; Di Francesco, D.; Di Martino, B.; Speranza, R.; Santori, D.; Boari, A.; Marsilio, F. Detection by Hemi-Nested Reverse Transcription Polymerase Chain Reaction and Genetic Characterization of Wild Type Strains of Canine Distemper Virus in Suspected Infected Dogs. J. Vet. Diagn. Investig. 2012, 24, 107–115. [Google Scholar] [CrossRef][Green Version]
- Elia, G.; Decaro, N.; Martella, V.; Cirone, F.; Lucente, M.S.; Lorusso, E.; Di Trani, L.; Buonavoglia, C. Detection of Canine Distemper Virus in Dogs by Real-Time RT-PCR. J. Virol. Methods 2006, 136, 171–176. [Google Scholar] [CrossRef]
- Hindson, B.J.; Ness, K.D.; Masquelier, D.A.; Belgrader, P.; Heredia, N.J.; Makarewicz, A.J.; Bright, I.J.; Lucero, M.Y.; Hiddessen, A.L.; Legler, T.C. High-Throughput Droplet Digital PCR System for Absolute Quantitation of DNA Copy Number. Anal. Chem. 2011, 83, 8604–8610. [Google Scholar] [CrossRef]
- Hindson, C.M.; Chevillet, J.R.; Briggs, H.A.; Gallichotte, E.N.; Ruf, I.K.; Hindson, B.J.; Vessella, R.L.; Tewari, M. Absolute Quantification by Droplet Digital PCR versus Analog Real-Time PCR. Nat. Methods 2013, 10, 1003–1005. [Google Scholar] [CrossRef]
- Quan, P.-L.; Sauzade, M.; Brouzes, E. DPCR: A Technology Review. Sensors 2018, 18, 1271. [Google Scholar] [CrossRef]
- Strain, M.C.; Lada, S.M.; Luong, T.; Rought, S.E.; Gianella, S.; Terry, V.H.; Spina, C.A.; Woelk, C.H.; Richman, D.D. Highly Precise Measurement of HIV DNA by Droplet Digital PCR. PLoS ONE 2013, 8, e55943. [Google Scholar] [CrossRef]
- Mahendran, P.; Liew, J.W.K.; Amir, A.; Ching, X.-T.; Lau, Y.-L. Droplet Digital Polymerase Chain Reaction (DdPCR) for the Detection of Plasmodium Knowlesi and Plasmodium Vivax. Malar. J. 2020, 19, 241. [Google Scholar] [CrossRef]
- Shin, W.; Lee, C.-J.; Lee, Y.-M.; Choi, Y.-B.; Mun, S.; Han, K. Rapid Identification of SARS-CoV-2 in the Point-of-Care Using Digital PCR-Based Dr. PCRTM Di20K COVID-19 Detection Kit without Viral RNA Extraction. Genes Genom. 2022, 44, 617–628. [Google Scholar] [CrossRef]
- Summers, B.A.; Greisen, H.A.; Appel, M.J.G. Canine Distemper Encephalomyelitis: Variation with Virus Strain. J. Comp. Pathol. 1984, 94, 65–75. [Google Scholar] [CrossRef]
- Verdes, J.M.; Larrañaga, C.; Varela, B.; Iribarnegaray, V.; Yozzi, V.; Feijóo, G.; Yamasaki, K. Histopathological Analysis of Brains from Dogs Infected with Canine Distemper Virus. In Measles and Related Morbilliviruses: Methods and Protocols; Springer: Berlin/Heidelberg, Germany, 2024; pp. 177–195. [Google Scholar]
- Feijóo, G.; Yamasaki, K.; Delucchi, L.; Verdes, J.M. Central Nervous System Lesions Caused by Canine Distemper Virus in 4 Vaccinated Dogs. J. Vet. Diagn. Investig. 2021, 33, 640–647. [Google Scholar] [CrossRef]
- Seki, F.; Ono, N.; Yamaguchi, R.; Yanagi, Y. Efficient Isolation of Wild Strains of Canine Distemper Virus in Vero Cells Expressing Canine SLAM (CD150) and Their Adaptability to Marmoset B95a Cells. J. Virol. 2003, 77, 9943–9950. [Google Scholar] [CrossRef]
- Frisk, A.L.; Konig, M.; Moritz, A.; Baumgartner, W. Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper. J. Clin. Microbiol. 1999, 37, 3634–3643. [Google Scholar] [CrossRef]
- Panzera, Y. Evolutionary Genetics Section, Faculty of Sciences, Institute of Biology, University of the Republic, Montevideo, Uruguay. 2024; Unpublish. [Google Scholar]
- Akobeng, A.K. Understanding Diagnostic Tests 1: Sensitivity, Specificity and Predictive Values. Acta Paediatr. 2007, 96, 338–341. [Google Scholar] [CrossRef]
- Parikh, R.; Mathai, A.; Parikh, S.; Sekhar, G.C.; Thomas, R. Understanding and Using Sensitivity, Specificity and Predictive Values. Indian J. Ophthalmol. 2008, 56, 45–50. [Google Scholar] [CrossRef]
- Sehata, G.; Sato, H.; Ito, T.; Imaizumi, Y.; Noro, T.; Oishi, E. Use of Quantitative Real-Time RT-PCR to Investigate the Correlation between Viremia and Viral Shedding of Canine Distemper Virus, and Infection Outcomes in Experimentally Infected Dogs. J. Vet. Med. Sci. 2015, 77, 851–855. [Google Scholar] [CrossRef]
- Tomaszewicz Brown, A.; McAloose, D.; Calle, P.P.; Auer, A.; Posautz, A.; Slavinski, S.; Brennan, R.; Walzer, C.; Seimon, T.A. Development and Validation of a Portable, Point-of-Care Canine Distemper Virus QPCR Test. PLoS ONE 2020, 15, e0232044. [Google Scholar] [CrossRef]
- Halecker, S.; Bock, S.; Beer, M.; Hoffmann, B. A New Molecular Detection System for Canine Distemper Virus Based on a Double-Check Strategy. Viruses 2021, 13, 1632. [Google Scholar] [CrossRef]
- Geiselhardt, F.; Peters, M.; Jo, W.K.; Schadenhofer, A.; Puff, C.; Baumgärtner, W.; Kydyrmanov, A.; Kuiken, T.; Piewbang, C.; Techangamsuwan, S. Development and Validation of a Pan-Genotypic Real-Time Quantitative Reverse Transcription-PCR Assay to Detect Canine Distemper Virus and Phocine Distemper Virus in Domestic Animals and Wildlife. J. Clin. Microbiol. 2022, 60, e02505-21. [Google Scholar] [CrossRef]
- Hayden, R.T.; Yan, X.; Wick, M.T.; Rodriguez, A.B.; Xiong, X.; Ginocchio, C.C.; Mitchell, M.J.; Caliendo, A.M. Factors Contributing to Variability of Quantitative Viral PCR Results in Proficiency Testing Samples: A Multivariate Analysis. J. Clin. Microbiol. 2012, 50, 337–345. [Google Scholar] [CrossRef]
- Baker, M. Digital PCR Hits Its Stride. Nat. Methods 2012, 9, 541–544. [Google Scholar] [CrossRef]
- Souto, S.; Olveira, J.G.; López-Vázquez, C.; Bandín, I.; Dopazo, C.P. Designing and Validation of a Droplet Digital PCR Procedure for Diagnosis and Accurate Quantification of Nervous Necrosis Virus in the Mediterranean Area. Pathogens 2023, 12, 1155. [Google Scholar] [CrossRef]
- Hui, Y.; Wu, Z.; Qin, Z.; Zhu, L.; Liang, J.; Li, X.; Fu, H.; Feng, S.; Yu, J.; He, X. Micro-Droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus. Virol. Sin. 2018, 33, 270–277. [Google Scholar] [CrossRef]
- Ciesielski, M.; Blackwood, D.; Clerkin, T.; Gonzalez, R.; Thompson, H.; Larson, A.; Noble, R. Assessing Sensitivity and Reproducibility of RT-DdPCR and RT-QPCR for the Quantification of SARS-CoV-2 in Wastewater. J. Virol. Methods 2021, 297, 114230. [Google Scholar] [CrossRef]
- Lei, S.; Chen, S.; Zhong, Q. Digital PCR for Accurate Quantification of Pathogens: Principles, Applications, Challenges and Future Prospects. Int. J. Biol. Macromol. 2021, 184, 750–759. [Google Scholar] [CrossRef]
- Schwartz, S.L.; Lowen, A.C. Droplet Digital PCR: A Novel Method for Detection of Influenza Virus Defective Interfering Particles. J. Virol. Methods 2016, 237, 159–165. [Google Scholar] [CrossRef]
- Huang, J.-T.; Liu, Y.-J.; Wang, J.; Xu, Z.-G.; Yang, Y.; Shen, F.; Liu, X.; Zhou, X.; Liu, S.-M. Next Generation Digital PCR Measurement of Hepatitis B Virus Copy Number in Formalin-Fixed Paraffin-Embedded Hepatocellular Carcinoma Tissue. Clin. Chem. 2015, 61, 290–296. [Google Scholar] [CrossRef]
- Liu, X.; Feng, J.; Zhang, Q.; Guo, D.; Zhang, L.; Suo, T.; Hu, W.; Guo, M.; Wang, X.; Huang, Z. Analytical Comparisons of SARS-CoV-2 Detection by QRT-PCR and DdPCR with Multiple Primer/Probe Sets. Emerg. Microbes Infect. 2020, 9, 1175–1179. [Google Scholar] [CrossRef]
- Kinloch, N.N.; Ritchie, G.; Dong, W.; Cobarrubias, K.D.; Sudderuddin, H.; Lawson, T.; Matic, N.; Montaner, J.S.G.; Leung, V.; Romney, M.G.; et al. SARS-CoV-2 RNA Quantification Using Droplet Digital RT-PCR. J. Mol. Diagn. 2021, 23, 907–919. [Google Scholar] [CrossRef]
- Pinheiro-de-Oliveira, T.F.; Fonseca, A.A.; Camargos, M.F.; Laguardia-Nascimento, M.; de Oliveira, A.M.; Cottorello, A.C.P.; Goes-Neto, A.; Barbosa-Stancioli, E.F. Development of a Droplet Digital RT-PCR for the Quantification of Foot-and-Mouth Virus RNA. J. Virol. Methods 2018, 259, 129–134. [Google Scholar] [CrossRef]
- Aizawa, Y.; Koyama, A.; Ishihara, T.; Onodera, O.; Saitoh, A. Performance of a Real-Time PCR–Based Approach and Droplet Digital PCR in Detecting Human Parechovirus Type 3 RNA. J. Clin. Virol. 2016, 84, 27–31. [Google Scholar] [CrossRef]
- De Brun, M.L.; Cosme, B.; Petersen, M.; Alvarez, I.; Folgueras-Flatschart, A.; Flatschart, R.; Panei, C.J.; Puentes, R. Development of a Droplet Digital PCR Assay for Quantification of the Proviral Load of Bovine Leukemia Virus. J. Vet. Diagn. Investig. 2022, 34, 439–447. [Google Scholar] [CrossRef]
- Trypsteen, W.; Kiselinova, M.; Vandekerckhove, L.; De Spiegelaere, W. Diagnostic Utility of Droplet Digital PCR for HIV Reservoir Quantification. J. Virus Erad. 2016, 2, 162–169. [Google Scholar] [CrossRef]





| Application | Primer | Sequence (5′ to 3′) |
|---|---|---|
| RT-PCR [28] | CDV-NP_reverse | CAAGATAACCATGTACGGTGC |
| CDV-NP_forward | ACAGGATTGCTGAGGACCTAT | |
| RT-qPCR and ddPCR [29] | CDV-reverse | ATGAGTTTTCCGGAGAATTAACAA |
| CDV-forward | AGCTAGTTTCATCCTAACTATCAAGT | |
| CDV probe | FAM-TGGCATTGAAACTATGTATCCGGCTCT-BHQ1-3 |
| RT-qPCR Assay | ddPCR Assay | |||||
|---|---|---|---|---|---|---|
| Plasmid dilution 1 | 10−4 | 10−6 | 10−8 | 10−4 | 10−6 | 10−8 |
| Mean of plasmid copy number 2 | 6.9 × 106 | 1.1 × 107 | 1.6 × 102 | 2.8 × 103 | 5.7 × 102 | 2.0 × 101 |
| SD | 2990 | 864.3 | 28.9 | 84.8 | 50.8 | 59.9 |
| CV (%) | 150.3 | 148.8 | 99 | 8.9 | 6.9 | 77.9 |
| Blood * (n = 57) | Urine * (n = 9) | Nasal and Eye Swabs * (n = 4) | Brain * (n = 22) | Total Positive | Total Negative | |
|---|---|---|---|---|---|---|
| RT-PCR | 14 | 3 | 3 | 19 | 39 | 53 |
| RT-qPCR | 21 | 4 | 3 | 16 | 44 | 48 |
| ddPCR | 24 | 5 | 4 | 22 | 55 | 37 |
| True Result (TPV + TNV) | False Result (FPV + FNV) | FP (%) | FN (%) | Sensitivity (%) | Specificity (%) | Kappa (IC 99.5%) | |
|---|---|---|---|---|---|---|---|
| RT-PCR | 55 | 37 | 0 | 48.7 | 51.3 | 100 | 0.268 |
| RT-qPCR | 60 | 32 | 0 | 42.1 | 57.9 | 100 | 0.324 |
| ddPCR | 71 | 21 | 0 | 27.6 | 72.4 | 100 | 0.477 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iribarnegaray, V.; Godiño, G.; Larrañaga, C.; Yamasaki, K.; Verdes, J.M.; Puentes, R. Droplet Digital PCR Enhances Sensitivity of Canine Distemper Virus Detection. Viruses 2024, 16, 1720. https://doi.org/10.3390/v16111720
Iribarnegaray V, Godiño G, Larrañaga C, Yamasaki K, Verdes JM, Puentes R. Droplet Digital PCR Enhances Sensitivity of Canine Distemper Virus Detection. Viruses. 2024; 16(11):1720. https://doi.org/10.3390/v16111720
Chicago/Turabian StyleIribarnegaray, Victoria, Guillermo Godiño, Camila Larrañaga, Kanji Yamasaki, José Manuel Verdes, and Rodrigo Puentes. 2024. "Droplet Digital PCR Enhances Sensitivity of Canine Distemper Virus Detection" Viruses 16, no. 11: 1720. https://doi.org/10.3390/v16111720
APA StyleIribarnegaray, V., Godiño, G., Larrañaga, C., Yamasaki, K., Verdes, J. M., & Puentes, R. (2024). Droplet Digital PCR Enhances Sensitivity of Canine Distemper Virus Detection. Viruses, 16(11), 1720. https://doi.org/10.3390/v16111720

