Next Article in Journal
Distribution of Wheat-Infecting Viruses and Genetic Variability of Wheat Streak Mosaic Virus and Barley Stripe Mosaic Virus in Kazakhstan
Next Article in Special Issue
Genotype Sequencing and Phylogenetic Analysis Revealed the Origins of Citrus Yellow Vein Clearing Virus California Isolates
Previous Article in Journal
Necroptosis in Pneumonia: Therapeutic Strategies and Future Perspectives
Previous Article in Special Issue
Accelerated Long-Fragment Circular PCR for Genetic Manipulation of Plant Viruses in Unveiling Functional Genomics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted

1
Plant Pathology and Plant-Microbe Biology Section, School of Integrative Plant Science, Cornell University, Geneva, NY 14456, USA
2
Biology Department, Gustavus Adolphus College, St. Peter, MN 56082, USA
3
Cornell Cooperative Extension Lake Ontario Fruit Program, Albion, NY 14411, USA
4
Department of Entomology and Plant Pathology, University of Tennessee, Knoxville, TN 37996, USA
5
USDA-APHIS Plant Germplasm Quarantine Program, Beltsville, MD 20705, USA
*
Author to whom correspondence should be addressed.
Viruses 2024, 16(1), 95; https://doi.org/10.3390/v16010095
Submission received: 7 December 2023 / Accepted: 5 January 2024 / Published: 7 January 2024
(This article belongs to the Special Issue Emerging Fruit and Vegetable Viruses 2023)

Abstract

Many viruses occur in apple (Malus domestica (Borkh.)), but no information is available on their seed transmissibility. Here, we report that six viruses infecting apple trees, namely, apple chlorotic leaf spot virus (ACLSV), apple green crinkle-associated virus (AGCaV), apple rubbery wood virus 2 (ARWV2), apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), and citrus concave gum-associated virus (CCGaV) occur in seeds extracted from apple fruits produced by infected maternal trees. Reverse transcription polymerase chain reaction (RT-PCR) and quantitative RT-PCR (RT-qPCR) assays revealed the presence of these six viruses in untreated apple seeds with incidence rates ranging from 20% to 96%. Furthermore, ASPV was detected by RT-PCR in the flesh and peel of fruits produced by infected maternal trees, as well as from seeds extracted from apple fruits sold for fresh consumption. Finally, a large-scale seedling grow-out experiment failed to detect ACLSV, ASGV, or ASPV in over 1000 progeny derived from sodium hypochlorite surface sterilized seeds extracted from fruits produced by infected maternal trees, suggesting no detectable transmission via embryonic tissue. This is the first report on the seedborne nature of apple-infecting viruses.

1. Introduction

The domestic apple, Malus domestica (Borkh.), is one of the most widely grown tree fruit crops in the world [1]. Of the more than 30 viruses and viroids that have been reported to infect apple trees, several are distributed worldwide and occur wherever apples are cultivated [2,3]. The most common apple viruses include apple chlorotic leaf spot virus (ACLSV), apple stem grooving virus (ASGV), and apple stem pitting virus (ASPV), all of which are members of the family Betaflexiviridae [2,3]. Other viruses and viroids of apple trees include the foveavirus apple green crinkle-associated virus (AGCaV), the ilarvirus apple mosaic virus (ApMV), the nepoviruses tobacco ringspot virus (TRSV) and tomato ringspot virus (ToRSV), and the apscaviroids apple dimple fruit viroid (ADFVd), apple fruit crinkle viroid (AFCVd), apple scar skin viroid (ASSVd), and pear blister canker viroid (PBCVd). In recent years, advancements in sequencing-based diagnostic techniques have enabled the identification of many novel or putative systemic pathogens, including viruses and viroids. These include the ilarvirus apple ilarvirus 2 [4], the luteovirus apple luteovirus 1 (ALV1) [5], the rubodviruses apple rubbery wood virus 1 (ARWV1) and apple rubbery wood virus 2 (ARWV2) [6], the coguviruses citrus concave gum-associated virus (CCGaV) [7] and citrus virus A (CiVA) [8], the tepovirus Prunus virus T (PrVT) [9], the pelamoviroid apple hammerhead viroid (AHVd) [10,11], and others [12]. Many of the novel viruses and viroids recently identified via high-throughput sequencing have yet to be biologically characterized, and therefore little is known about their transmission.
Surprisingly, given the wide distribution of many apple viruses and viroids, only two apple-infecting viruses (TRSV and ToRSV) have been reported to be transmitted by vectors [2,13,14], and no virus and only one viroid, ASSVd, has ever been reported to be seedborne or seed transmitted in apple [2,15]. Instead, most apple viruses and viroids have historically been believed to be transmitted only through vegetative propagation of their hosts, including via grafting and budding, but it remains unclear how their plant-to-plant transmission occurred prior to apple cultivation. Mechanical inoculation of herbaceous hosts has been achieved experimentally for ACLSV, ApMV, ASGV, ASPV, ToRSV, and PBCVd, but is not believed to contribute to natural transmission in orchard settings [2]. Additionally, transmission of viruses via root grafting has been suggested as a possible route of natural transmission, but definitive evidence has yet to be produced.
Though pome fruit crops are primarily vegetatively propagated, seed propagation plays a critical role in the development of new scion cultivars and rootstock genotypes in apple breeding programs [16]. Seeds are also used to facilitate the global distribution of germplasm, the establishment of germplasm repositories, and the production of seedling rootstocks [17,18,19,20]. Although extensive phytosanitary regulations have been established in many countries to limit the spread of systemic pathogens of apple via the import of apple clonal propagating material, seeds have often been exempted from these regulations because no major viruses of pome fruit crops have ever been reported to be seedborne or seed transmitted. Pome fruit seeds are therefore typically considered at a low risk for facilitating virus dissemination [17,18]. However, a recent report documented that ACLSV, ASGV, and ASPV are both seedborne and seed transmitted in two pear rootstock species, Pyrus betulifolia and P. calleryana, wherein the three viruses were detected in both seeds and progeny seedlings of infected maternal trees [21]. These findings demonstrated that ACLSV, ASGV, and ASPV are seedborne in these host species, i.e., they contaminate or infect the seedcoats of the seeds extracted from fruits produced by infected maternal trees; however, it remains unclear whether any of these viruses are present in embryonic tissue in these species. Regardless, the detection of these three viruses in progeny seedlings suggests that they are indeed capable of being transmitted to progeny of infected P. betulifolia and P. calleryana, whether this occurs via direct virus invasion of the embryo or via infection of the seedlings during germination.
In light of the importance of apple seed propagation and the potential phytosanitary risks posed by apple-infecting viruses and viroids, the current study was conducted to evaluate whether some viruses of pome fruit crops (i.e., ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV) are seedborne or seed transmitted in commercial cultivars of M. domestica. We hypothesized that these six viruses could be both seedborne and seed transmitted. Here, we report that all six of these viruses are indeed seedborne, though no evidence of seedling infection via seed transmission was observed.

2. Materials and Methods

2.1. Experimental Apple Orchard Establishment and Fruit Collection

An experimental high-density apple orchard block was established in 2019 on a well-drained loam soil (Lima series) at Cornell AgriTech in Ontario County, NY, USA [22]. This orchard was originally designed to study the potential role of viruses in the apple decline phenomenon. Trees representing six scion–rootstock combinations (‘Brookfield Gala’, ‘Honeycrisp’, and ‘Royal Red Honeycrisp’ on ‘Malling 26′ or ‘Geneva 935′ rootstocks) were established at 0.9 m × 3.4 m high-density spacing with trellis support and drip irrigation. Trees were maintained according to standard horticultural and pest management practices for conventional apple production in the region. Ten mature fruits resulting from open pollination were collected from each of the 175 trees in August–September 2022 and stored at 4 °C for up to 14 days prior to seed extraction (Figure 1).

2.2. Apple Seed Collection and Germination

Seeds were manually extracted from apple fruits collected from each tree in the experimental orchard. Approximately ten seeds from each tree, comprising one seed from each of ten representative fruits, were stored at −80 °C prior to RNA extraction. The remaining seeds were air dried at room temperature for 24 h, treated with 0.75% sodium hypochlorite for 30 min, thoroughly rinsed with distilled water, and soaked in distilled water for 12 h. Treated seeds were then stratified for 12 weeks in the dark at 4 °C. During seed stratification, seeds were kept moist with distilled water, and any seeds showing signs of microbial contamination were discarded. Stratified seeds were sown in coarse seed-starting potting media (LM-GPS Germination Mix, Lambert, Rivière-Ouelle, QC, Canada) and grown under greenhouse conditions (photoperiod: 14 h light/10 h dark; temperature: 22 °C day/20 °C night). After 21 days, the germination rate was evaluated, and seedlings were transplanted to potting soil and fertilized with a 14-14-14 slow-release fertilizer. Transplant viability was evaluated after an additional seven days.

2.3. Virus Detection in Apple Trees

To determine the virus infection status of each of the 175 maternal trees in the experimental orchard, a composite leaf tissue sample consisting of 5–6 leaves from throughout the scaffold per tree and a composite root tissue sample consisting of fine roots excavated from the top six inches of soil surrounding the trunk per tree were collected in summer 2022. Then, approximately 100 mg of each tissue sample was homogenized in a guanidine thiocyanate and β-mercaptoethanol lysis buffer with two steel beads (4.5 mm diameter) using a Retsch MM400 mixer mill (Retsch, Haan, Germany) at 30 Hz for 70 s (leaf tissue) or 180 s (root tissue). Next, total RNA was isolated using the GenCatch Plant Total RNA Miniprep Kit (Epoch Life Science, Missouri City, TX, USA) following the manufacturer’s guidelines, quantified using a Qubit 2.0 Fluorometer (ThermoFisher Scientific, Waltham, MA, USA), and stored at −80 °C for up to three weeks prior to virus screening. Each sample was tested for the presence of 19 viruses and viroids of pome fruit trees (Table 1) via multiplex PCR-based amplicon sequencing, as previously described by Costa et al. [23].

2.4. Virus Detection in Apple Seeds

Two untreated seeds from each tree in the experimental orchard were homogenized in guanidine thiocyanate lysis buffer with two steel beads (4.5 mm diameter) using a Retsch MM400 mixer mill at 30 Hz for 180 s, disrupting the seedcoat surface without fragmenting the seeds. Total RNA was then isolated from the resulting lysate using the MagMAX™ Viral RNA Isolation Kit (ThermoFisher Scientific, Waltham, MA, USA) with the KingFisher™ Flex automated extraction instrument (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturers’ guidelines and stored at −80 °C for up to four weeks prior to virus screening. Each sample was screened for ACLSV, ASGV, and ASPV by three multiplex reverse transcription (RT) polymerase chain reaction (PCR) assays using specific primer pairs (Table 2) targeting a 677, 273, or 370 bp coat protein gene fragment, respectively, as previously described [24]. Specific primers targeting a 181 bp plant mRNA (NADH dehydrogenase subunit 5) fragment were included in each RT-PCR assay as an internal control to assess the quality of the total RNA preparations and allow the lack of virus target amplification in an uninfected sample to be distinguished from an assay failure, as previously described [24]. Reactions were carried out with the OneStep Ahead RT-PCR Kit (Qiagen, Carlsbad, CA, USA) in a C1000 Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA) following the manufacturers’ guidelines. Each reaction (12.5 µL final volume) included 1 µL of RNA and final primer concentrations of 800 nM. Thermocycling conditions were as follows: a reverse transcription step at 50 °C for 10 min; an initial denaturation step at 95 °C for 5 min; 35 cycles of 94 °C for 30 s, 62 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 7 min. DNA amplification products were resolved by electrophoresis on 1.5% agarose gels, stained with GelRed™ (Biotium, Fremont, CA, USA), and visualized under ultraviolet light. Additionally, each sample was tested in duplicate for AGCaV, ARWV2, and CCGaV by quantitative RT-PCR (RT-qPCR) assays using specific primers and probes (Table 2). Reactions were carried out with the TaqMan™ Fast Virus 1-Step Master Mix for qPCR (ThermoFisher Scientific, Waltham, MA, USA) in a QuantStudio™ 7 Pro Real-Time PCR System (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturers’ guidelines. Each reaction (10 µL final volume) included 2 µL of RNA and final primer and probe concentrations of 900 and 250 nM, respectively. Thermocycling conditions were as follows: a reverse transcription step at 50 °C for 5 min; an initial denaturation step at 95 °C for 20 s; and 40 cycles of 95 °C for 3 s and 60 °C for 30 s. A negative control (total RNA from leaves of an uninfected apple tree), a positive control (total RNA from leaves of an infected apple tree), and a non-template control (nuclease-free water) were included in each assay. Seedborne incidence was evaluated as the percentage of seed samples in which each virus was detected.
To determine whether ASPV could be detected in the seeds of apple fruits produced in New York State and sold for fresh consumption, ‘Gala’ apple fruits were purchased in June 2023 from a local grocery store. Seeds were manually extracted from four fruits. Half the seeds from each fruit were air dried at room temperature for 24 h, treated with 0.75% sodium hypochlorite for 30 min, thoroughly rinsed with distilled water, and soaked in distilled water for 12 h. The other half of the seeds from each fruit were untreated. Whole untreated and treated seeds from each fruit were disrupted, as described above, and total RNA was then isolated from the resulting lysate and tested for ASPV by a multiplex RT-PCR assay. Reactions were carried out and analyzed as aforementioned.

2.5. ASPV Detection in Apple Fruits

To determine whether ASPV could be detected in apple fruit tissue collected from infected maternal trees in the experimental orchard, fruits were collected in June 2022 from four trees in the experimental orchard known to be infected with ASPV. The peel, flesh, and immature seeds of each fruit were manually separated. Approximately 100 mg of each tissue type was homogenized, and total RNA was then isolated as described above for seeds. Each sample was tested in duplicate for ASPV by RT-qPCR using primers and a probe (Table 2) targeting a coat protein gene fragment as previously described [26]. Reactions were carried out with the SuperScript™ III Platinum One-Step qRT-PCR Kit (ThermoFisher Scientific, Waltham, MA, USA) in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) following the manufacturers’ guidelines. Each reaction (20 µL final volume) included 2 µL of RNA and final primer and probe concentrations of 600 and 200 nM, respectively. Thermocycling conditions were as follows: a reverse transcription step at 50 °C for 15 min; an initial denaturation step at 94 °C for 2 min; and 40 cycles of 94 °C for 10 s and 58 °C for 1 min. Negative controls (total RNA from leaves of an uninfected apple tree), positive controls (total RNA from leaves of an infected apple tree), and non-template controls (nuclease-free water) were included in duplicate in the assay.

2.6. Virus Detection in Apple Seedlings

Once seedlings grown from apple seeds reached the 6–8 true leaf stage, a leaf tissue sample consisting of the first and sixth true leaves was collected from each seedling and stored at −20 °C prior to RNA extraction. Approximately 100 mg of each leaf tissue sample was homogenized in guanidine thiocyanate lysis buffer for approximately five seconds using a HOMEX 7 homogenizing system (BIOREBA, Reinach, Switzerland) set to 70% power. Total RNA was then isolated from the resulting lysate using the MagMAX™ Viral RNA Isolation Kit with the KingFisher™ Flex automated extraction instrument following the manufacturers’ guidelines and stored at −80 °C for up to eight weeks prior to virus screening. Total RNA extracts from individual seedlings representing progeny of unique maternal trees were pooled to create composite samples comprised of the total RNA of 16 seedlings each. These composite samples were screened for ACLSV, ASGV, and ASPV by three multiplex RT-PCR assays and analyzed as described above. A negative control (composite total RNA from leaves of 16 uninfected apple trees), a positive control (composite total RNA from leaves of 15 uninfected apple trees and one infected apple tree), and a non-template control (nuclease-free water) were included in each assay. The seed transmission rate was evaluated as the percent of seedlings in which each virus was detected.

3. Results

3.1. Detection of Viruses and Viroids in Maternal Apple Trees by Multiplex PCR-Based Amplicon Sequencing

Diagnostic testing of 175 apple trees for 19 viruses and viroids of apple trees via multiplex PCR-based amplicon sequencing revealed the presence of a total of eight viruses and one viroid in the samples tested. At least one virus or viroid was found in every tree tested (Table 3). The three most prevalent viruses were ASGV, ACLSV, and ASPV, which were detected at rates of 100% (175 of 175), 78% (136 of 175), and 71% (125 of 175), respectively. These three latent viruses are widely prevalent in cultivated apple across North America and are known to be the most prevalent viruses infecting apple trees in commercial orchards in New York [3,27]. Five additional viruses, i.e., CCGaV, AGCaV, ARWV2, TRSV, and ToRSV, as well as one viroid, AHVd, were detected in one or more of the trees tested (Table 3). The four trees in which TRSV or ToRSV was detected were located in a single row on the westernmost edge of the study orchard, suggesting infection may have occurred via dagger nematodes of the species complex Xiphinema americanum present in the soil prior to study orchard establishment. The other ten viruses and viroids detectable by this methodology (i.e., ALV1, ApMV, ARWV1, CiVA, PpPV2, PrVT, AFCVd, ADFVd, ASSVd, and PBCVd) were not identified in the samples tested in this study.

3.2. Evaluation of Seed Transmission of ACLSV, ASGV, and ASPV in Malus domestica

A total of 3283 seeds resulting from the open pollination of 175 maternal apple trees were treated with sodium hypochlorite, stratified, and germinated under greenhouse conditions for virus testing. The germination rate (87%, 2863 of 3283) and viability rate of seedlings after transplanting (94%, 2701 of 2863) were high at three weeks post germination. Seedlings were tested for ACLSV, ASGV, and ASPV by multiplex RT-PCR at the 6–8 true leaf stage to assess the occurrence of seed transmission. Of 1121 progeny of 56 unique ACLSV-infected maternal apple trees, none was found to be positive for ACLSV (Table 4). Similarly, of the 1412 and 1035 progeny seedlings of 68 unique ASGV- and 51 unique ASPV-infected maternal apple trees, none was found to be positive for either ASGV or ASPV, respectively (Table 4). These results indicated that seed transmission did not occur in this study.

3.3. Evaluation of Seedborne Nature of ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV in Malus domestica

Fruits from four trees known to be infected with ASPV in the experimental orchard were collected for the testing of peel, flesh, and immature seeds for ASPV by multiplex RT-PCR. Specific DNA amplicons were obtained for each of the three tissue types, demonstrating that ASPV is present at detectable levels throughout apple fruits (100%, 12 of 12). Moreover, ASPV was detected in total RNA extracted from the seeds of four storebought ‘Gala’ apple fruits by multiplex RT-PCR (100%, 4 of 4). However, ASPV was not detectable in seeds of these fruits after a sodium hypochlorite treatment (0%, 0 of 4). This result suggested that the virus was present in or on the seedcoat. To test this hypothesis with fruits produced by trees in the experimental orchard, RNA was isolated from untreated seeds representing the progeny of 49 virus-infected trees. ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV were detected by RT-PCR or RT-qPCR at rates of 93% (38 of 41), 40% (8 of 20), 20% (1 of 5), 96% (47 of 49), 92% (35 of 38), and 84% (27 of 32), respectively (Table 4). These results demonstrated the potential for all six of these viruses to be seedborne in M. domestica.

4. Discussion

Seed transmission represents an important route of virus transmission with at least one quarter of plant viruses known to be transmitted through the seed of at least one of their hosts. This proportion is expected to grow with the use of increasingly sensitive detection methods enabling the identification of novel seedborne viruses, as well as with the detection of seedborne viruses in asymptomatic hosts [27,28,29,30]. Two routes of seed transmission have been identified. Some viruses are seedborne, wherein the virus is present as a contaminant on the seedcoat or is carried within the seedcoat or endosperm but is not found in the embryo itself [28,29,31]. These include tobacco mosaic virus in tomato [32], rice yellow mottle virus in rice [33], and pepino mosaic virus (PepMV) in tomato [34,35]. Other viruses are carried within the tissues of the embryo itself, which is achieved either through direct infection from the maternal plant or via infected pollen [28,31].
Embryo transmission is more common and has been reported for many plant viruses, including members of at least 20 genera [28]. Proportions of infected seeds vary widely based on many factors, including virus strain, host species, host resistance, host developmental stage at the time of infection, seed age, virus stability, and environmental factors [28]. Host seedlings may be infected as a direct result of embryo infection, but seedlings arising from uninfected embryos may also be infected during germination by virus present in infected seedcoat or endosperm or by virus present as a seedcoat contaminant, as in cucumber green mottle mosaic virus in cucumber and watermelon [36], PepMV in tomato [34,35], and tobacco mosaic virus and tomato brown rugose fruit virus in tomato and pepper [37,38].
Seed transmission is an important facet of plant virus epidemiology and, therefore, is important to consider when shaping phytosanitary measures [28]. The aim of this study was to evaluate whether the major viruses of pome fruit trees could be seedborne or seed transmitted in commercial apple cultivars such as ‘Brookfield Gala’, ‘Honeycrisp’, and ‘Royal Red Honeycrisp’. Our findings demonstrated that six apple viruses (i.e., ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV) can indeed be seedborne, some at high rates. They also suggested that ACLSV, ASGV, and ASPV are likely not seed transmitted or are seed transmitted at very low rates via sterilized seeds of M. domestica.
Similarly to the work of Li et al. [21] on the transmission of ACLSV, ASGV, and ASPV in two pear rootstock species, we found that these three viruses can be detected from the seedcoats of seeds extracted from fruits of infected maternal trees. The rates at which these three viruses were detected in untreated seeds were higher in our experiments (92.7%, 95.9%, and 92.1%, respectively) vs. the rates reported by Li et al. [21] (40.4%, 73.9%, and 21.2%, respectively). These differences may reflect biological differences between the host species studied (P. betulifolia and P. calleryana vs. M. domestica), genetic divergence among virus isolates, or differences in the virus detection methodologies employed. Regardless, it is clear that these three viruses of the family Betaflexiviridae can be seedborne in pome fruit trees at high rates.
In contrast to the findings of Li et al. [21], we were unable to detect ACLSV, ASGV, or ASPV in the seedling progeny of infected maternal trees at the 6–8 true leaf stage (0%, 0%, and 0% vs. 15.6%, 9.3%, and 2.7% reported by Li et al. [21], respectively). It is possible that these differences are attributable to biological differences between the two host species under consideration, such as differences in the abilities of the evaluated viruses to successfully invade Pyrus and Malus embryos. An example of this phenomenon was reported for raspberry bushy dwarf virus, which is capable of seed transmission in red raspberry, but is incapable of seed transmission in Nicotiana benthamiana due to an inability to invade the embryo, though the mechanism preventing embryo invasion is not known [39]. Although the evolutionary distance between the Malus and Pyrus genera is certainly much smaller than between red raspberry (Rubus) and Nicotiana, the possibility of differential virus-host interactions within Malus and Pyrus cannot be ruled out. Additionally, a major difference between the experimental designs of the two studies was the sodium hypochlorite seed surface sterilization treatment utilized in our study. The high rates of virus detection in untreated seed and the absence of virus detection in both treated seed and in the progeny derived from treated seed reported here indicated that seed transmission via infected embryonic tissue is unlikely in M. domestica or may occur at rates below the limit of detection of our RT-PCR assays. For example, PepMV, initially believed not to be seed transmitted in tomato, was later determined to be seed transmitted at a rate of 0.005–0.057% following a large-scale screen of over 87,000 plants [34,35].
The successful detection of ACLSV, ASGV, and ASPV in the seedling progeny of infected maternal trees at the 6–8 true leaf stage reported by Li et al. [21] may reflect infection by seedborne virus during germination or may indeed represent embryo infection in P. betulifolia and P. calleryana. Despite the lack of virus detection in M. domestica progeny derived from treated seed reported in the current study, transmission of one or multiple of these viruses may still be possible in M. domestica via infection during germination of untreated seeds, which was not evaluated in this study. This important question should be addressed in a future study.
The infection mechanism(s) operating in this system are unclear and were not evaluated in our study. Our detection of ASPV in the peel and flesh of apple fruits produced by infected maternal trees demonstrates that this virus is clearly present in maternal tissues surrounding the seeds, and therefore could also be present in the maternally derived seedcoat or nucellus as well. However, it is also possible that the biparental tissues (i.e., the embryo and endosperm) could be infected via infected pollen, which was not evaluated here.
The objective of this study was to determine whether the major viruses known to infect pome fruit trees are seedborne or seed transmitted in one of the world’s most widely grown fruit crops, M. domestica. Our findings support our hypothesis that AGCaV, ACLSV, ARWV2, ASGV, ASPV, and CCGaV are seedborne in commercial apple cultivars, but refute our hypothesis that ACLSV, ASGV, and ASPV are seed transmitted in this system, at least via treated seeds. Further studies should be undertaken to determine whether seed transmission of major apple-infecting viruses can occur in untreated seeds of M. domestica. If this is found to occur, seed treatments should be further evaluated and considered by breeders, policymakers, and regulators to facilitate the development of virus-free apple trees and the safe exchange of apple germplasm.

Author Contributions

Conceptualization, A.W. and M.F.; methodology, A.W., K.H.L., O.P.H.-G. and M.F.; formal analysis, A.W.; investigation, A.W., B.H., M.M.S., J.v.Z., K.H.L. and O.P.H.-G.; resources, A.W., M.M.S., J.v.Z., K.H.L., O.P.H.-G. and M.F.; data curation, A.W.; writing—original draft preparation, A.W.; writing—review and editing, A.W. and M.F.; visualization, A.W.; supervision, M.F.; project administration, M.F.; funding acquisition, M.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially supported by the USDA Agriculture and Food Research Initiative Critical Agriculture Research and Extension program award number 2021-68008-34117, the New York Apple Research and Development Program, and Cornell AgriTech Venture Funds.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article.

Acknowledgments

The authors are grateful to Yu Yang for preparing sequencing libraries and performing sequencing reactions, Xiaojun Hu for performing the initial sequence data analysis, Larissa Carvalho Costa for her assistance and advice regarding the RT-qPCR virus detection assays, and Joseph A. Foster for his critical review of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Food and Agriculture Organization of the United Nations. FAOSTAT: Crops and Livestock Products. Available online: http://www.fao.org/faostat/en (accessed on 7 August 2023).
  2. Hadidi, A.; Barba, M. Economic impact of pome and stone fruit viruses and viroids. In Virus and Virus-Like Diseases of Pome and Stone Fruits; Hadidi, A., Barba, M., Candresse, T., Jelkmann, W., Eds.; APS Press: St. Paul, MN, USA, 2011; pp. 1–7. [Google Scholar]
  3. CABI. CABI Compendium. Available online: https://www.cabidigitallibrary.org/journal/cabicompendium (accessed on 9 August 2023).
  4. Xiao, H.; Hao, W.; Storoschuk, G.; MacDonald, J.L.; Sanfaçon, H. Characterizing the virome of apple orchards affected by rapid decline in the Okanagan and Similkameen Valleys of British Columbia (Canada). Pathogens 2022, 11, 1231. [Google Scholar] [CrossRef]
  5. Liu, H.; Wu, L.; Nikolaeva, E.; Peter, K.; Liu, Z.; Mollov, D.; Cao, M.; Li, R. Characterization of a new apple luteovirus identified by high-throughput sequencing. Virol. J. 2018, 15, 85. [Google Scholar] [CrossRef]
  6. Rott, M.E.; Kesanakurti, P.; Berwarth, C.; Rast, H.; Boyes, I.; Phelan, J.; Jelkmann, W. Discovery of negative-sense RNA viruses in trees infected with apple rubbery wood disease by next-generation sequencing. Plant Dis. 2018, 102, 1254–1263. [Google Scholar] [CrossRef]
  7. Navarro, B.; Minutolo, M.; De Stradis, A.; Palmisano, F.; Alioto, D.; Di Serio, F. The first phlebo-like virus infecting plants: A case study on the adaptation of negative-stranded RNA viruses to new hosts. Mol. Plant Pathol. 2018, 19, 1075–1089. [Google Scholar] [CrossRef]
  8. Navarro, B.; Zicca, S.; Minutolo, M.; Saponari, M.; Alioto, D.; Di Serio, F. A negative-stranded RNA virus infecting citrus trees: The second member of a new genus within the order Bunyavirales. Front. Microbiol. 2018, 9, 2340. [Google Scholar] [CrossRef]
  9. Costa, L.C.; Hu, X.; Malapi-Wight, M.; Foster, J.A.; McFarland, C.; Hurtado-Gonzales, O.P. Identification of a novel robigovirus and a Prunus-infecting tepovirus in Pyrus communis and their transmissibility on Malus spp. Eur. J. Plant Pathol. 2022, 162, 275–288. [Google Scholar] [CrossRef]
  10. Messmer, A.; Sanderson, D.; Braun, G.; Serra, P.; Flores, R.; James, D. Molecular and phylogenetic identification of unique isolates of hammerhead viroid-like RNA from ‘Pacific Gala’ apple (Malus domestica) in Canada. Can. J. Plant Pathol. 2017, 39, 342–353. [Google Scholar] [CrossRef]
  11. Serra, P.; Messmer, A.; Sanderson, D.; James, D.; Flores, R. Apple hammerhead viroid-like RNA is a bona fide viroid: Autonomous replication and structural features support its inclusion as a new member in the genus Pelamoviroid. Virus Res. 2018, 249, 8–15. [Google Scholar] [CrossRef]
  12. Wright, A.A.; Cross, A.R.; Harper, S.J. A bushel of viruses: Identification of seventeen novel putative viruses by RNA-seq in six apple trees. PLoS ONE 2020, 15, e0227669. [Google Scholar] [CrossRef]
  13. Fulton, J.P. Dual transmission of tobacco ringspot virus and tomato ringspot virus by Xiphinema americanum. Phytopathology 1967, 57, 535–537. [Google Scholar]
  14. McGuire, J.M. Retention of tobacco ringspot virus by Xiphinema americanum. Phytopathology 1973, 63, 324–326. [Google Scholar] [CrossRef]
  15. Hadidi, A.; Hansen, A.J.; Parish, C.L.; Yang, X. Scar skin and dapple apple viroids are seed-borne and persistent in infected apple trees. Res. Virol. 1991, 142, 289–296. [Google Scholar] [CrossRef]
  16. Khan, A.; Korban, S.S. Breeding and genetics of disease resistance in temperate fruit trees: Challenges and new opportunities. Theor. Appl. Genet. 2022, 135, 3961–3985. [Google Scholar] [CrossRef]
  17. Animal and Plant Health Inspection Service, United States Department of Agriculture. What Plant Material Requires a Permit? Available online: https://www.aphis.usda.gov/aphis/ourfocus/planthealth/import-information/permits/plants-and-plant-products-permits/plants-for-planting/ct_permit_plantmaterials (accessed on 12 September 2023).
  18. European and Mediterranean Plant Protection Organization. Pathogen-Tested Material of Malus, Pyrus and Cydonia. EPPO Bull. 1999, 29, 239–252. [Google Scholar] [CrossRef]
  19. Fazio, G. Genetics, breeding, and genomics of apple rootstocks. In The Apple Genome; Korban, S.S., Ed.; Compendium of Plant Genomes; Springer International Publishing: Cham, Switzerland, 2021; pp. 105–130. [Google Scholar] [CrossRef]
  20. Volk, G.M.; Richards, C.M.; Reilley, A.A.; Henk, A.D.; Forsline, P.L.; Aldwinckle, H.S. Ex situ conservation of vegetatively propagated species: Development of a seed-based core collection for Malus sieversii. J. Am. Soc. Hortic. Sci. 2005, 130, 203–210. [Google Scholar] [CrossRef]
  21. Li, L.; Wen, L.; Wang, G.; Lyu, Y.; Yang, Z.; Yang, X.; Li, Q.; Hong, N. Seed transmission of three viruses in two pear rootstock species Pyrus betulifolia and P. calleryana. Viruses 2022, 14, 599. [Google Scholar] [CrossRef]
  22. Soil Survey Staff, Natural Resources Conservation Service, United States Department of Agriculture. Official Soil Series Descriptions. Available online: https://soilseries.sc.egov.usda.gov (accessed on 22 August 2023).
  23. Costa, L.C.; Atha, B.; Hu, X.; Lamour, K.; Yang, Y.; O’Connell, M.; McFarland, C.; Foster, J.A.; Hurtado-Gonzales, O.P. High-throughput detection of a large set of viruses and viroids of pome and stone fruit trees by multiplex PCR-based amplicon sequencing. Front. Plant Sci. 2022, 13, 1072768. [Google Scholar] [CrossRef]
  24. Menzel, W.; Jelkmann, W.; Maiss, E. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. J. Virol. Methods 2002, 99, 81–92. [Google Scholar] [CrossRef]
  25. Diaz-Lara, A.; Wunderlich, L.; Nouri, M.T.; Golino, D.; Al Rwahnih, M. Incidence and detection of negative-stranded RNA viruses infecting apple and pear trees in California. J. Phytopathol. 2022, 170, 15–20. [Google Scholar] [CrossRef]
  26. Beaver-Kanuya, E.; Harper, S.J. Development of RT-qPCR assays for the detection of three latent viruses of pome. J. Virol. Methods 2020, 278, 113836. [Google Scholar] [CrossRef]
  27. Fuchs, M.; Kahlke, C.; Donahue, D.; Wallis, A.; Basedow, M. Distribution of viruses in New York apple orchards. N. Y. Fruit Q. 2018, 26, 5–9. [Google Scholar]
  28. Hull, R. Plant to plant movement. In Plant Virology, 5th ed.; Hull, R., Ed.; Academic Press: Cambridge, MA, USA, 2014; pp. 669–751. [Google Scholar] [CrossRef]
  29. Johansen, E.; Edwards, M.C.; Hampton, R.O. Seed transmission of viruses: Current perspectives. Annu. Rev. Phytopathol. 1994, 32, 363–386. [Google Scholar] [CrossRef]
  30. Mathur, S.B.; Haware, M.P.; Hampton, R.O. Identification, significance and transmission of seed borne pathogens. In World Crops: Cool Season Food Legumes; Summerfield, R.J., Ed.; Current Plant Science and Biotechnology in Agriculture; Springer: Dordrecht, The Netherlands, 1988; Volume 5, pp. 351–365. [Google Scholar] [CrossRef]
  31. Agarwal, J.B.; Sinclair, V.K. Principles of Seed Pathology, 2nd ed.; Agarwal, J.B., Sinclair, V.K., Eds.; CRC Press: Boca Raton, FL, USA, 2014. [Google Scholar] [CrossRef]
  32. Broadbent, L. The epidemiology of tomato mosaic. Ann. Appl. Biol. 1965, 56, 177–205. [Google Scholar] [CrossRef]
  33. Allarangaye, M.D.; Traoré, O.; Traoré, E.V.S.; Millogo, R.J.; Konaté, G. Evidence of non-transmission of rice yellow mottle virus through seeds of wild host species. J. Plant Pathol. 2006, 88, 309–315. Available online: http://www.jstor.org/stable/41998336 (accessed on 30 August 2023).
  34. Hanssen, I.M.; Mumford, R.; Blystad, D.-R.; Cortez, I.; Hasiów-Jaroszewska, B.; Hristova, D.; Pagán, I.; Pereira, A.-M.; Peters, J.; Pospieszny, H.; et al. Seed transmission of pepino mosaic virus in tomato. Eur. J. Plant Pathol. 2010, 126, 145–152. [Google Scholar] [CrossRef]
  35. Ling, K.-S. Pepino mosaic virus on tomato seed: Virus location and mechanical transmission. Plant Dis. 2008, 92, 1701–1705. [Google Scholar] [CrossRef] [PubMed]
  36. Wu, H.-J.; Qin, B.-X.; Chen, H.-Y.; Peng, B.; Cai, J.-H.; Gu, Q.-S. The rate of seed contamination and transmission of cucumber green mottle mosaic virus in watermelon and melon. Sci. Agric. Sin. 2011, 44, 1527–1532. [Google Scholar] [CrossRef]
  37. Demski, J.W. Tobacco mosaic virus is seedborne in pimento peppers. Plant Dis. 1981, 63, 723–724. [Google Scholar] [CrossRef]
  38. Dombrovsky, A.; Smith, E. Seed transmission of tobamoviruses: Aspects of global disease distribution. In Advances in Seed Biology; Jimenez-Lopez, J.C., Ed.; Intech: London, UK, 2017; pp. 233–260. [Google Scholar] [CrossRef]
  39. Isogai, M.; Yoshikoshi, M.; Seki, K.; Masuko-Suzuki, H.; Watanabe, M.; Matsuo, K.; Yaegashi, H. Seed transmission of raspberry bushy dwarf virus is blocked in Nicotiana benthamiana plants by preventing virus entry into the embryo from the infected embryo sac and endosperm. Arch. Virol. 2023, 168, 138. [Google Scholar] [CrossRef]
Figure 1. Experimental workflow for evaluating the seedborne incidence and seed transmission of apple chlorotic leaf spot virus (ACLSV), apple green crinkle-associated virus (AGCaV), apple rubbery wood virus 2 (ARWV2), apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), and citrus concave gum-associated virus (CCGaV) in Malus domestica. (1) Representative fruits resulting from the open pollination of virus-infected maternal trees were collected from an experimental orchard and seeds were extracted from each fruit to evaluate ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV detectability in seedcoats. (2a) Two untreated, intact seeds from each virus-infected maternal tree were disrupted in lysis buffer with steel beads (gray circles) to disrupt the seedcoats without fragmenting the seeds. (3a) Total RNA was isolated from the resulting lysate and was then (4a) screened for ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV by reverse transcription (RT) polymerase chain reaction (PCR) assays. To evaluate seed transmission of ACLSV, ASGV, and ASPV from virus-infected maternal trees to their progeny, (2b) seeds were surface sterilized with sodium hypochlorite and cold stratified. (3b) Seeds were then germinated and grown under greenhouse conditions until they reached the 6–8 true leaf stage, at which point (4b) leaf tissue was collected from each seedling for nucleic acid isolation. (5b) Total RNA was isolated from each leaf tissue sample and (6b) screened for ACLSV, ASGV, and ASPV by RT-PCR assays. Created with BioRender.com.
Figure 1. Experimental workflow for evaluating the seedborne incidence and seed transmission of apple chlorotic leaf spot virus (ACLSV), apple green crinkle-associated virus (AGCaV), apple rubbery wood virus 2 (ARWV2), apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), and citrus concave gum-associated virus (CCGaV) in Malus domestica. (1) Representative fruits resulting from the open pollination of virus-infected maternal trees were collected from an experimental orchard and seeds were extracted from each fruit to evaluate ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV detectability in seedcoats. (2a) Two untreated, intact seeds from each virus-infected maternal tree were disrupted in lysis buffer with steel beads (gray circles) to disrupt the seedcoats without fragmenting the seeds. (3a) Total RNA was isolated from the resulting lysate and was then (4a) screened for ACLSV, AGCaV, ARWV2, ASGV, ASPV, and CCGaV by reverse transcription (RT) polymerase chain reaction (PCR) assays. To evaluate seed transmission of ACLSV, ASGV, and ASPV from virus-infected maternal trees to their progeny, (2b) seeds were surface sterilized with sodium hypochlorite and cold stratified. (3b) Seeds were then germinated and grown under greenhouse conditions until they reached the 6–8 true leaf stage, at which point (4b) leaf tissue was collected from each seedling for nucleic acid isolation. (5b) Total RNA was isolated from each leaf tissue sample and (6b) screened for ACLSV, ASGV, and ASPV by RT-PCR assays. Created with BioRender.com.
Viruses 16 00095 g001
Table 1. Viruses and viroids included in testing of apple maternal trees via multiplex PCR-based amplicon sequencing.
Table 1. Viruses and viroids included in testing of apple maternal trees via multiplex PCR-based amplicon sequencing.
FamilyGenusVirus or ViroidAbbreviation
AvsunviroidaePelamoviroidApple hammerhead viroidAHVd
BetaflexiviridaeCapillovirusApple stem grooving virusASGV
FoveavirusApple green crinkle-associated virusAGCaV
Apple stem pitting virusASPV
TepovirusPrunus virus TPrVT
TrichovirusApple chlorotic leaf spot virusACLSV
BromoviridaeIlarvirusApple mosaic virusApMV
TombusviridaeLuteovirusApple luteovirus 1ALV1
PartitiviridaeAlphapartitivirusPyrus pyrifolia partitivirus 2PpPV2
PhenuiviridaeCoguvirusCitrus concave gum-associated virusCCGaV
Citrus virus ACiVA
RubodvirusApple rubbery wood virus 1ARWV1
Apple rubbery wood virus 2ARWV2
PospiviroidaeApscaviroidApple dimple fruit viroidADFVd
Apple fruit crinkle viroidAFCVd
Apple scar skin viroidASSVd
Pear blister canker viroidPBCVd
SecoviridaeNepovirusTobacco ringspot virusTRSV
Tomato ringspot virusToRSV
Table 2. Primers and probes used in RT-PCR and RT-qPCR assays in this study.
Table 2. Primers and probes used in RT-PCR and RT-qPCR assays in this study.
TargetTypeOligo NameSequence (5′–3′)Target RegionReference
RT-PCR
ACLSVPrimerACLSV-FTTCATGGAAAGACAGGGGCAACoat protein[24]
PrimerACLSV-RAAGTCTACAGGCTATTTATTATAAGTCTAA
ASGVPrimerASGV-FGCCACTTCTAGGCAGAACTCTTTGAACoat protein[24]
PrimerASGV-RAACCCCTTTTTGTCCTTCAGTACGAA
ASPVPrimerASPV-FATGTCTGGAACCTCATGCTGCAACoat protein[24]
PrimerASPV-RTTGGGATCAACTTTACTAAAAAGCATAA
nad5Primernad5-FGATGCTTCTTGGGGCTTCTTGTTnad5 mRNA[24]
Primernad5-RCTCCAGTCACCAACATTGGCATAA
RT-qPCR
AGCaVPrimerAGCaV-RT-FGCVAAYGCCACAAGCAAACoat protein[23]
PrimerAGCaV-RT-RGYCCAAYYTTTCCCCCAGTGA
ProbeAGCaV-RT-PCAAGCTGTYAACTTTGGY
ARWV2PrimerARWV2-RT-FGAGATTCCAAGCTATTTCATAAGCATAARdRP (Segment L)[25]
PrimerARWV2-RT-RTGATAAAAGGCACACAAGTTGCA
ProbeARWV2-RT-PATCCCCAGTGCTGAAA
ASPVPrimerASPV-RT-FGAGGAGGTTGGCACGATGATCCoat protein[26]
PrimerASPV-RT-RGCAGCATGAGGTTCCAGACAT
ProbeASPV-RT-PAACTGAAGGGTGCACTTTGAGGCA
CCGaVPrimerCCGaV-RT-FGCCTTTCTTCGTACATGTGATGAGRdRP (RNA1)[25]
PrimerCCGaV-RT-RGGCAAACTGTATGGGAAAGCTAA
ProbeCCGaV-RT-PTGTGGAAATGCAAGAGA
Abbreviations: ACLSV, apple chlorotic leaf spot virus; AGCaV, apple green crinkle-associated virus; ARWV2, apple rubbery wood virus 2; ASGV, apple stem grooving virus; ASPV, apple stem pitting virus; CCGaV, citrus concave gum-associated virus; F, forward; mRNA, messenger RNA; nad5, NADH dehydrogenase subunit 5; P, probe; R, reverse; RdRP, RNA-dependent RNA polymerase; RT-PCR, reverse transcription polymerase chain reaction; RT-qPCR, quantitative RT-PCR; Segment L, large segment.
Table 3. Viruses and viroids detected in 175 maternal apple trees via multiplex PCR-based amplicon sequencing.
Table 3. Viruses and viroids detected in 175 maternal apple trees via multiplex PCR-based amplicon sequencing.
Virus or ViroidTrees Infected% Trees Infected
Apple stem grooving virus175100
Apple chlorotic leaf spot virus13677.7
Apple stem pitting virus12571.4
Citrus concave gum-associated virus10660.6
Apple hammerhead viroid10459.4
Apple green crinkle-associated virus5632.0
Apple rubbery wood virus 22514.3
Tobacco ringspot virus31.7
Tomato ringspot virus10.6
Table 4. Viruses detected in seeds and progeny seedlings of infected maternal apple trees.
Table 4. Viruses detected in seeds and progeny seedlings of infected maternal apple trees.
Seeds Seedlings
VirusN aPositive bIncidence (%)N aPositive bIncidence (%)
ACLSV4138 92.7112100
ASGV494795.9141200
ASPV383592.1103500
AGCaV20840.0ntnana
ARWV25120.0ntnana
CCGaV322784.4ntnana
a Number of seeds or seedlings tested in RT-PCR. b Number of positive seeds or seedlings in RT-PCR. Abbreviations: ACLSV, apple chlorotic leaf spot virus; ASGV, apple stem grooving virus; ASPV, apple stem pitting virus; AGCaV, apple green crinkle-associated virus; ARWV2, apple rubbery wood virus 2; CCGaV, citrus concave gum-associated virus; na, not applicable; nt, not tested.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wunsch, A.; Hoff, B.; Sazo, M.M.; van Zoeren, J.; Lamour, K.H.; Hurtado-Gonzales, O.P.; Fuchs, M. Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted. Viruses 2024, 16, 95. https://doi.org/10.3390/v16010095

AMA Style

Wunsch A, Hoff B, Sazo MM, van Zoeren J, Lamour KH, Hurtado-Gonzales OP, Fuchs M. Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted. Viruses. 2024; 16(1):95. https://doi.org/10.3390/v16010095

Chicago/Turabian Style

Wunsch, Anna, Bailey Hoff, Mario Miranda Sazo, Janet van Zoeren, Kurt H. Lamour, Oscar P. Hurtado-Gonzales, and Marc Fuchs. 2024. "Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted" Viruses 16, no. 1: 95. https://doi.org/10.3390/v16010095

APA Style

Wunsch, A., Hoff, B., Sazo, M. M., van Zoeren, J., Lamour, K. H., Hurtado-Gonzales, O. P., & Fuchs, M. (2024). Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted. Viruses, 16(1), 95. https://doi.org/10.3390/v16010095

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop