SARS-CoV-2 Structural Proteins Modulated Blood-Testis Barrier-Related Proteins through Autophagy in the Primary Sertoli Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Plasmids
2.2. Reagents and Antibodies
2.3. Cell Transfection
2.4. Biochemical Intervention
2.5. Transmission Electron Microscopy
2.6. Reverse Transcription PCR (RT-PCR)
2.7. Quantitative Real-Time PCR (qPCR)
2.8. Immunoblotting Analysis
2.9. Enzyme-Linked Immunosorbent Assay (ELISA)
2.10. Statistical Analysis
3. Results
3.1. Transfection of SARS-CoV-2 Structural Proteins (SPs) in Primary Human Sertoli Cells
3.2. SARS-CoV-2 SPs Disrupt the Expression of BTB-Related Proteins
3.3. SARS-CoV-2 SPs Induce Expression of Immune Factors in Sertoli Cells
3.4. SARS-CoV-2 SPs Influence on Sertoli Cells Autophagy
3.5. Autophagy Inhibition Suppressed the Effects of SPs on BTB-Related Proteins
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cabrera, M.A.; Pacheco, R.L.; Bagattini, A.M.; Riera, R. Frequency, signs and symptoms, and criteria adopted for long COVID-19: A systematic review. Int. J. Clin. Pract. 2021, 75, e14357. [Google Scholar]
- Patel, K.P.; Patel, P.A.; Vunnam, R.R.; Hewlett, A.T.; Jain, R.; Jing, R.; Vunnam, S.R. Gastrointestinal, hepatobiliary, and pancreatic manifestations of COVID-19. J. Clin. Virol. 2020, 128, 104386. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Deswal, A.; Khalid, U. COVID-19 myocarditis and long-term heart failure sequelae. Curr. Opin. Cardiol. 2021, 36, 234–240. [Google Scholar] [CrossRef] [PubMed]
- Collantes, M.; Espiritu, A.I.; Sy, M.; Anlacan, V.; Jamora, R. Neurological Manifestations in COVID-19 Infection: A Systematic Review and Meta-Analysis. Can. J. Neurol. Sci. 2021, 48, 66–76. [Google Scholar] [CrossRef]
- Li, M.Y.; Li, L.; Zhang, Y.; Wang, X.S. Expression of the SARS-CoV-2 cell receptor gene ACE2 in a wide variety of human tissues. Infect. Dis. Poverty 2020, 9, 45. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Chen, Y.; Tang, W.; Zhang, L.; Chen, W.; Yan, Z.; Yuan, P.; Yang, M.; Kong, S.; Yan, L.; et al. Single-cell transcriptome analysis of the novel coronavirus (SARS-CoV-2) associated gene ACE2 expression in normal and non-obstructive azoospermia (NOA) human male testes. Sci. China Life Sci. 2020, 63, 1006–1015. [Google Scholar] [CrossRef]
- Ruan, Y.; Hu, B.; Liu, Z.; Liu, K.; Jiang, H.; Li, H.; Li, R.; Luan, Y.; Liu, X.; Yu, G.; et al. No detection of SARS-CoV-2 from urine, expressed prostatic secretions, and semen in 74 recovered COVID-19 male patients: A perspective and urogenital evaluation. Andrology 2021, 9, 99–106. [Google Scholar] [CrossRef]
- Guo, L.; Zhao, S.; Li, W.; Wang, Y.; Li, L.; Jiang, S.; Ren, W.; Yuan, Q.; Zhang, F.; Kong, F.; et al. Absence of SARS-CoV-2 in semen of a COVID-19 patient cohort. Andrology 2021, 9, 42–47. [Google Scholar] [CrossRef]
- Machado, B.; Barcelos, B.G.; Scherzer, N.; Massey, J.; Dos, S.L.H.; Henrique, J.R.; Herinques, S.R.T.; Davis, R. Presence of SARS-CoV-2 RNA in Semen-Cohort Study in the United States COVID-19 Positive Patients. Infect. Dis. Rep. 2021, 13, 96–101. [Google Scholar] [CrossRef]
- Gharagozloo, P.; Cartagena, S.; Moazamian, A.; Drevet, J.R.; Somkuti, S.; Aitken, R.J. Rapid impact of COVID-19 infection on semen quality: A case report. Transl. Androl. Urol. 2022, 11, 110–115. [Google Scholar] [CrossRef]
- Peirouvi, T.; Aliaghaei, A.; Eslami, F.B.; Ziaeipour, S.; Ebrahimi, V.; Forozesh, M.; Ghadipasha, M.; Mahmoudiasl, G.R.; Aryan, A.; Moghimi, N.; et al. COVID-19 disrupts the blood-testis barrier through the induction of inflammatory cytokines and disruption of junctional proteins. Inflamm. Res. 2021, 70, 1165–1175. [Google Scholar] [CrossRef]
- Bai, C.; Zhong, Q.; Gao, G.F. Overview of SARS-CoV-2 genome-encoded proteins. Sci. China Life Sci. 2022, 65, 280–294. [Google Scholar] [CrossRef] [PubMed]
- Lucio, C.C.; Noda, P.; Barbosa, A.P.; Vieira, B.D.S.E.; Gasque, B.C.; Ventura, F.B.; Teixeira, T.A.; Nunes, D.N.A.; Nascimento, S.P.; Achoa, F.K.; et al. SARS-CoV-2 Nucleocapsid Protein is Associated with Lower Testosterone Levels: An Experimental Study. Front. Physiol. 2022, 13, 867444. [Google Scholar] [CrossRef] [PubMed]
- Yao, X.H.; Luo, T.; Shi, Y.; He, Z.C.; Tang, R.; Zhang, P.P.; Cai, J.; Zhou, X.D.; Jiang, D.P.; Fei, X.C.; et al. A cohort autopsy study defines COVID-19 systemic pathogenesis. Cell Res. 2021, 31, 836–846. [Google Scholar] [CrossRef] [PubMed]
- Johnson, L.; Thompson, D.J.; Varner, D.D. Role of Sertoli cell number and function on the regulation of spermatogenesis. Anim. Reprod. Sci. 2008, 105, 23–51. [Google Scholar] [CrossRef]
- Mruk, D.D.; Cheng, C.Y. The Mammalian Blood-Testis Barrier: Its Biology and Regulation. Endocr. Rev. 2015, 36, 564–591. [Google Scholar] [CrossRef]
- Li, M.W.; Mruk, D.D.; Lee, W.M.; Cheng, C.Y. Connexin 43 is critical to maintain the homeostasis of the blood-testis barrier via its effects on tight junction reassembly. Proc. Natl. Acad. Sci. USA 2010, 107, 17998–18003. [Google Scholar] [CrossRef]
- Cao, Z.; Huang, W.; Sun, Y.; Li, Y. Deoxynivalenol induced spermatogenesis disorder by blood-testis barrier disruption associated with testosterone deficiency and inflammation in mice. Environ. Pollut. 2020, 264, 114748. [Google Scholar] [CrossRef]
- Liu, H.; Zeng, X.; Ma, Y.; Chen, X.; Losiewicz, M.D.; Du, X.; Tian, Z.; Zhang, S.; Shi, L.; Zhang, H.; et al. Long-term exposure to low concentrations of MC-LR induces blood-testis barrier damage through the RhoA/ROCK pathway. Ecotoxicol. Environ. Saf. 2022, 236, 113454. [Google Scholar] [CrossRef]
- Luca, G.; Baroni, T.; Arato, I.; Hansen, B.C.; Cameron, D.F.; Calafiore, R. Role of Sertoli Cell Proteins in Immunomodulation. Protein Pept. Lett. 2018, 25, 440–445. [Google Scholar] [CrossRef]
- She, J.; Feng, N.; Zheng, W.; Zheng, H.; Cai, P.; Zou, H.; Yuan, Y.; Gu, J.; Liu, Z.; Bian, J. Zearalenone Exposure Disrupts Blood-Testis Barrier Integrity through Excessive Ca2+-Mediated Autophagy. Toxins 2021, 13, 875. [Google Scholar] [CrossRef] [PubMed]
- Waisner, H.; Grieshaber, B.; Saud, R.; Henke, W.; Stephens, E.B.; Kalamvoki, M. SARS-CoV-2 Harnesses Host Translational Shutoff and Autophagy to Optimize Virus Yields: The Role of the Envelope (E) Protein. Microbiol. Spectr. 2023, 11, e370722. [Google Scholar] [CrossRef] [PubMed]
- Hou, P.; Wang, X.; Wang, H.; Wang, T.; Yu, Z.; Xu, C.; Zhao, Y.; Wang, W.; Zhao, Y.; Chu, F.; et al. The ORF7a protein of SARS-CoV-2 initiates autophagy and limits autophagosome-lysosome fusion via degradation of SNAP29 to promote virus replication. Autophagy 2022, 19, 551–569. [Google Scholar] [CrossRef]
- Shang, C.; Zhuang, X.; Zhang, H.; Li, Y.; Zhu, Y.; Lu, J.; Ge, C.; Cong, J.; Li, T.; Li, N.; et al. Inhibition of Autophagy Suppresses SARS-CoV-2 Replication and Ameliorates Pneumonia in hACE2 Transgenic Mice and Xenografted Human Lung Tissues. J. Virol. 2021, 95, e153721. [Google Scholar] [CrossRef] [PubMed]
- Sun, J. The hypothesis that SARS-CoV-2 affects male reproductive ability by regulating autophagy. Med. Hypotheses 2020, 143, 110083. [Google Scholar] [CrossRef]
- Li, R.; Xi, Y.; Liu, X.; Chen, G.; Wang, B.; Jiang, L.; Li, W. Expression of IL-1α, IL-6, TGF-β, FasL and ZNF265 during sertoli cell infection by ureaplasma urealyticum. Cell. Mol. Immunol. 2009, 6, 215–221. [Google Scholar] [CrossRef]
- Tanida, I.; Ueno, T.; Kominami, E. LC3 and Autophagy. Methods Mol. Biol. 2008, 445, 77–88. [Google Scholar]
- Liu, W.J.; Ye, L.; Huang, W.F.; Guo, L.J.; Xu, Z.G.; Wu, H.L.; Yang, C.; Liu, H.F. p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cell. Mol. Biol. Lett. 2016, 21, 29. [Google Scholar] [CrossRef]
- Shen, Q.; Xiao, X.; Aierken, A.; Yue, W.; Wu, X.; Liao, M.; Hua, J. The ACE2 expression in Sertoli cells and germ cells may cause male reproductive disorder after SARS-CoV-2 infection. J. Cell. Mol. Med. 2020, 24, 9472–9477. [Google Scholar] [CrossRef]
- Wu, H.; Jiang, X.; Gao, Y.; Liu, W.; Wang, F.; Gong, M.; Chen, R.; Yu, X.; Zhang, W.; Gao, B.; et al. Mumps virus infection disrupts blood-testis barrier through the induction of TNF-alpha in Sertoli cells. Faseb. J. 2019, 33, 12528–12540. [Google Scholar] [CrossRef]
- Nie, Y.; Hui, L.; Guo, M.; Yang, W.; Huang, R.; Chen, J.; Wen, X.; Zhao, M.; Wu, Y. Rearrangement of Actin Cytoskeleton by Zika Virus Infection Facilitates Blood-Testis Barrier Hyperpermeability. Virol. Sin. 2021, 36, 692–705. [Google Scholar] [CrossRef] [PubMed]
- Shirvaliloo, M. The blood-gas barrier in COVID-19: An overview of the effects of SARS-CoV-2 infection on the alveolar epithelial and endothelial cells of the lung. Tissue Barriers 2021, 9, 1937013. [Google Scholar] [CrossRef] [PubMed]
- Adil, M.S.; Khulood, D.; Narayanan, S.P.; Somanath, P.R. Bioinformatics analyses reveal cell-barrier junction modulations in lung epithelial cells on SARS-CoV-2 infection. Tissue Barriers 2022, 10, 2000300. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.C.; Huang, K.; Zhang, H.P.; Li, L.; Zhang, Y.F.; Tan, C.; Chen, H.C.; Jin, M.L.; Wang, X.R. SARS-CoV-2 productively infects human brain microvascular endothelial cells. J. Neuroinflammation 2022, 19, 149. [Google Scholar] [CrossRef]
- Suprewicz, L.; Tran, K.A.; Piktel, E.; Fiedoruk, K.; Janmey, P.A.; Galie, P.A.; Bucki, R. Recombinant human plasma gelsolin reverses increased permeability of the blood-brain barrier induced by the spike protein of the SARS-CoV-2 virus. J. Neuroinflammation 2022, 19, 282. [Google Scholar] [CrossRef]
- Chai, J.; Cai, Y.; Pang, C.; Wang, L.; McSweeney, S.; Shanklin, J.; Liu, Q. Structural basis for SARS-CoV-2 envelope protein recognition of human cell junction protein PALS1. Nat. Commun. 2021, 12, 3433. [Google Scholar] [CrossRef]
- Kotini, M.; Barriga, E.H.; Leslie, J.; Gentzel, M.; Rauschenberger, V.; Schambony, A.; Mayor, R. Gap junction protein Connexin-43 is a direct transcriptional regulator of N-cadherin in vivo. Nat. Commun. 2018, 9, 3846. [Google Scholar] [CrossRef]
- Della, M.E.; Niada, S.; Giannasi, C.; Zagra, L.; Brini, A.T. Dynamics of Connexin 43 Down Modulation in Human Articular Chondrocytes Stimulated by Tumor Necrosis Factor Alpha. Int. J. Mol. Sci. 2022, 23, 5575. [Google Scholar] [CrossRef]
- Yi, W.; Xiang-Liang, T.; Yu, Z.; Bin, L.; Lian-Ju, S.; Chun-Lan, L.; Tao, L.; Da-Wei, H.E.; Sheng-de, W.U.; Guang-Hui, W. DEHP exposure destroys blood-testis barrier (BTB) integrity of immature testes through excessive ROS-mediated autophagy. Genes Dis. 2018, 5, 263–274. [Google Scholar] [CrossRef]
- Koepke, L.; Hirschenberger, M.; Hayn, M.; Kirchhoff, F.; Sparrer, K.M. Manipulation of autophagy by SARS-CoV-2 proteins. Autophagy 2021, 17, 2659–2661. [Google Scholar] [CrossRef]
- Gassen, N.C.; Papies, J.; Bajaj, T.; Emanuel, J.; Dethloff, F.; Chua, R.L.; Trimpert, J.; Heinemann, N.; Niemeyer, C.; Weege, F.; et al. SARS-CoV-2-mediated dysregulation of metabolism and autophagy uncovers host-targeting antivirals. Nat. Commun. 2021, 12, 3818. [Google Scholar] [CrossRef] [PubMed]
- Hui, X.; Zhang, L.; Cao, L.; Huang, K.; Zhao, Y.; Zhang, Y.; Chen, X.; Lin, X.; Chen, M.; Jin, M. SARS-CoV-2 promote autophagy to suppress type I interferon response. Signal Transduct. Target. Ther. 2021, 6, 180. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Wang, H.; Jia, L.; Ma, Y.; Wang, X.; Zhu, L.; Wang, K.; Zhang, P.; Yang, H. Mechanism of 2,4-Dichlorophenoxyacetic acid-induced damage to rat testis via Fas/FasL pathway and the protective effect of Lycium barbarum polysaccharides. Environ. Toxicol. 2022, 37, 2764–2779. [Google Scholar] [CrossRef] [PubMed]
- Perez, C.V.; Theas, M.S.; Jacobo, P.V.; Jarazo-Dietrich, S.; Guazzone, V.A.; Lustig, L. Dual role of immune cells in the testis: Protective or pathogenic for germ cells? Spermatogenesis 2013, 3, e23870. [Google Scholar] [CrossRef]
- Feng, R.; Adeniran, S.O.; Huang, F.; Li, Y.; Ma, M.; Zheng, P.; Zhang, G. The ameliorative effect of melatonin on LPS-induced Sertoli cells inflammatory and tight junctions damage via suppression of the TLR4/MyD88/NF-κB signaling pathway in newborn calf. Theriogenology 2012, 179, 103–116. [Google Scholar] [CrossRef]
- Luca, G.; Cameron, D.F.; Arato, I.; Mancuso, F.; Linden, E.H.; Calvitti, M.; Falabella, G.; Szekeres, K.; Bodo, M.; Ricci, G.; et al. Xenograft of microencapsulated Sertoli cells for the cell therapy of type 2 diabetes mellitus in spontaneously diabetic nonhuman primates: Preliminary data. Transplant. Proc. 2014, 46, 1999–2001. [Google Scholar] [CrossRef]
- Zheng, J.; Miao, J.; Guo, R.; Guo, J.; Fan, Z.; Kong, X.; Gao, R.; Yang, L. Mechanism of COVID-19 Causing ARDS: Exploring the Possibility of Preventing and Treating SARS-CoV-2. Front. Cell. Infect. Microbiol. 2022, 12, 931061. [Google Scholar] [CrossRef]
- Stefan, N. SARS-CoV-2 fires up inflammation in adipose tissue. Nat. Rev. Endocrinol. 2023, 19, 8–9. [Google Scholar] [CrossRef]
- Ravindra, N.G.; Alfajaro, M.M.; Gasque, V.; Huston, N.C.; Wan, H.; Szigeti-Buck, K.; Yasumoto, Y.; Greaney, A.M.; Habet, V.; Chow, R.D.; et al. Single-cell longitudinal analysis of SARS-CoV-2 infection in human airway epithelium identifies target cells, alterations in gene expression, and cell state changes. PLoS Biol. 2021, 19, e3001143. [Google Scholar] [CrossRef]
Genes | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
ZO-1 | CGGTGGTAACTTTGAGA | TCTGAGATGGAGGTGGGT |
Occludin | GTGCCATCATTGCGGGATTC | AGGTGGATATTCCCTGA |
Claudin11 | TGTTGGGCTTCATTCTCG | GGCGGTCACGATGTTGT |
β-catenin | GGTCCGAGTGCTGCTCATG | GCTGTCAGGTTTGATCCCATC |
N-cadherin | CTGAAGCCAACCTTAACTGA | TGTCCCATTCCAAACCTG |
CX43 | TCGCCTATGTCTCCTCCTG | AGGTCGCTGGTCCACAAT |
FasL | GTTCTGGTTGCCTTGGTA | GTGGCCTATTTGCTTCTC |
TGF-β1 | TCCACGGAGAAGAACTGC | CAGGCTCCAAATGTAGGG |
IL-1 | AGTGCTGCTGAAGGAGAT | TGGATGGGCAACTGATGT |
IL-6 | GGAGACTTGCCTGGTGAA | AGCTCTGGCTTGTTCCTC |
β-actin | GAAATCGTGCGTGACATCAAAG | TGTAGTTTCATGGATGCCACAG |
GFP | CTCAGATCTCGAGCTCAAGC | TGGCGACCGGTGGATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kang, K.; Ma, Y.-D.; Liu, S.-Q.; Huang, R.-W.; Chen, J.-J.; An, L.-L.; Wu, J. SARS-CoV-2 Structural Proteins Modulated Blood-Testis Barrier-Related Proteins through Autophagy in the Primary Sertoli Cells. Viruses 2023, 15, 1272. https://doi.org/10.3390/v15061272
Kang K, Ma Y-D, Liu S-Q, Huang R-W, Chen J-J, An L-L, Wu J. SARS-CoV-2 Structural Proteins Modulated Blood-Testis Barrier-Related Proteins through Autophagy in the Primary Sertoli Cells. Viruses. 2023; 15(6):1272. https://doi.org/10.3390/v15061272
Chicago/Turabian StyleKang, Kai, Yao-Dan Ma, Si-Qi Liu, Ri-Wei Huang, Jin-Jun Chen, Li-Long An, and Jiang Wu. 2023. "SARS-CoV-2 Structural Proteins Modulated Blood-Testis Barrier-Related Proteins through Autophagy in the Primary Sertoli Cells" Viruses 15, no. 6: 1272. https://doi.org/10.3390/v15061272