Evaluation of Analytical and Clinical Performance and Usefulness in a Real-Life Hospital Setting of Two in-House Real-Time RT-PCR Assays to Track SARS-CoV-2 Variants of Concern
Abstract
:1. Introduction
2. Materials and Methods
2.1. Clinical Samples and International Standard
2.2. RNA Extraction
2.3. SARS-CoV-2 Variant-Screening RT-PCR Assays
2.4. Data Analysis
2.5. Analytical Performance of SARS-CoV-2 Variant-Screening RT-PCR Assays
2.6. Validation in a Real-Life Hospital Setting of SARS-CoV-2 Variant-Screening RT-PCR Assays
2.7. Clinical Performance of SARS-CoV-2 Variant-Screening RT-PCR Assays
3. Results
3.1. Analytical Performance of SARS-CoV-2 Variant-Screening RT-PCR Assays
3.2. Validation in a Real-Life Hospital Setting of SARS-CoV-2 Variant-Screening RT-PCR Assays
3.3. Clinical Performance of SARS-CoV-2 Variant-Screening RT-PCR Assays
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef] [PubMed]
- Ren, L.-L.; Wang, Y.-M.; Wu, Z.-Q.; Xiang, Z.-C.; Guo, L.; Xu, T.; Jiang, Y.-Z.; Xiong, Y.; Li, Y.-J.; Li, X.-W.; et al. Identification of a Novel Coronavirus Causing Severe Pneumonia in Human: A Descriptive Study. Chin. Med. J. Engl. 2020, 133, 1015–1024. [Google Scholar] [CrossRef]
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.-M.; Wang, W.; Song, Z.-G.; Hu, Y.; Tao, Z.-W.; Tian, J.-H.; Pei, Y.-Y.; et al. Author Correction: A New Coronavirus Associated with Human Respiratory Disease in China. Nature 2020, 580, E7. [Google Scholar] [CrossRef] [PubMed]
- Gordon, D.E.; Jang, G.M.; Bouhaddou, M.; Xu, J.; Obernier, K.; White, K.M.; O’Meara, M.J.; Rezelj, V.V.; Guo, J.Z.; Swaney, D.L.; et al. A SARS-CoV-2 Protein Interaction Map Reveals Targets for Drug Repurposing. Nature 2020, 583, 459–468. [Google Scholar] [CrossRef]
- Kim, D.; Lee, J.-Y.; Yang, J.-S.; Kim, J.W.; Kim, V.N.; Chang, H. The Architecture of SARS-CoV-2 Transcriptome. Cell 2020, 181, 914–921.e10. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Yang, X.-L.; Wang, X.-G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.-R.; Zhu, Y.; Li, B.; Huang, C.-L.; et al. A Pneumonia Outbreak Associated with a New Coronavirus of Probable Bat Origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [PubMed]
- Celik, I.; Yadav, R.; Duzgun, Z.; Albogami, S.; El-Shehawi, A.M.; Fatimawali; Idroes, R.; Tallei, T.E.; Emran, T.B. Interactions of the Receptor Binding Domain of SARS-CoV-2 Variants with HACE2: Insights from Molecular Docking Analysis and Molecular Dynamic Simulation. Biology 2021, 10, 880. [Google Scholar] [CrossRef] [PubMed]
- Wrapp, D.; Wang, N.; Corbett, K.S.; Goldsmith, J.A.; Hsieh, C.-L.; Abiona, O.; Graham, B.S.; McLellan, J.S. Cryo-EM Structure of the 2019-NCoV Spike in the Prefusion Conformation. Science 2020, 367, 1260–1263. [Google Scholar] [CrossRef]
- WHO Tracking SARS-CoV-2 Variants. Available online: https://www.who.int/activities/tracking-SARS-CoV-2-variants (accessed on 14 December 2022).
- Zahradník, J.; Marciano, S.; Shemesh, M.; Zoler, E.; Harari, D.; Chiaravalli, J.; Meyer, B.; Rudich, Y.; Li, C.; Marton, I.; et al. SARS-CoV-2 Variant Prediction and Antiviral Drug Design Are Enabled by RBD in Vitro Evolution. Nat. Microbiol. 2021, 6, 1188–1198. [Google Scholar] [CrossRef]
- Wang, Z.; Schmidt, F.; Weisblum, Y.; Muecksch, F.; Barnes, C.O.; Finkin, S.; Schaefer-Babajew, D.; Cipolla, M.; Gaebler, C.; Lieberman, J.A.; et al. MRNA Vaccine-Elicited Antibodies to SARS-CoV-2 and Circulating Variants. Nature 2021, 592, 616–622. [Google Scholar] [CrossRef]
- Starr, T.N.; Greaney, A.J.; Hannon, W.W.; Loes, A.N.; Hauser, K.; Dillen, J.R.; Ferri, E.; Farrell, A.G.; Dadonaite, B.; McCallum, M.; et al. Shifting Mutational Constraints in the SARS-CoV-2 Receptor-Binding Domain during Viral Evolution. Science 2022, 377, 420–424. [Google Scholar] [CrossRef] [PubMed]
- Nelson, G.; Buzko, O.; Spilman, P.; Niazi, K.; Rabizadeh, S.; Soon-Shiong, P. Molecular Dynamic Simulation Reveals E484K Mutation Enhances Spike RBD-ACE2 Affinity and the Combination of E484K, K417N and N501Y Mutations (501Y.V2 Variant) Induces Conformational Change Greater than N501Y Mutant Alone, Potentially Resulting in an Escape Mutant. 2021; preprint. [Google Scholar] [CrossRef]
- Meng, B.; Kemp, S.A.; Papa, G.; Datir, R.; Ferreira, I.A.T.M.; Marelli, S.; Harvey, W.T.; Lytras, S.; Mohamed, A.; Gallo, G.; et al. Recurrent Emergence of SARS-CoV-2 Spike Deletion H69/V70 and Its Role in the Alpha Variant B.1.1.7. Cell Rep. 2021, 35, 109292. [Google Scholar] [CrossRef] [PubMed]
- McCarthy, K.R.; Rennick, L.J.; Nambulli, S.; Robinson-McCarthy, L.R.; Bain, W.G.; Haidar, G.; Duprex, W.P. Recurrent Deletions in the SARS-CoV-2 Spike Glycoprotein Drive Antibody Escape. Science 2021, 371, 1139–1142. [Google Scholar] [CrossRef]
- McCallum, M.; Bassi, J.; De Marco, A.; Chen, A.; Walls, A.C.; Di Iulio, J.; Tortorici, M.A.; Navarro, M.-J.; Silacci-Fregni, C.; Saliba, C.; et al. SARS-CoV-2 Immune Evasion by the B.1.427/B.1.429 Variant of Concern. Science 2021, 373, 648–654. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; VanBlargan, L.A.; Bloyet, L.-M.; Rothlauf, P.W.; Chen, R.E.; Stumpf, S.; Zhao, H.; Errico, J.M.; Theel, E.S.; Liebeskind, M.J.; et al. Identification of SARS-CoV-2 Spike Mutations That Attenuate Monoclonal and Serum Antibody Neutralization. Cell Host Microbe 2021, 29, 477–488.e4. [Google Scholar] [CrossRef] [PubMed]
- Kemp, S.A.; Collier, D.A.; Datir, R.P.; Ferreira, I.A.T.M.; Gayed, S.; Jahun, A.; Hosmillo, M.; Rees-Spear, C.; Mlcochova, P.; Lumb, I.U.; et al. SARS-CoV-2 Evolution during Treatment of Chronic Infection. Nature 2021, 592, 277–282. [Google Scholar] [CrossRef]
- Greaney, A.J.; Starr, T.N.; Gilchuk, P.; Zost, S.J.; Binshtein, E.; Loes, A.N.; Hilton, S.K.; Huddleston, J.; Eguia, R.; Crawford, K.H.D.; et al. Complete Mapping of Mutations to the SARS-CoV-2 Spike Receptor-Binding Domain That Escape Antibody Recognition. Cell Host Microbe 2021, 29, 44–57.e9. [Google Scholar] [CrossRef]
- Greaney, A.J.; Loes, A.N.; Crawford, K.H.D.; Starr, T.N.; Malone, K.D.; Chu, H.Y.; Bloom, J.D. Comprehensive Mapping of Mutations in the SARS-CoV-2 Receptor-Binding Domain That Affect Recognition by Polyclonal Human Plasma Antibodies. Cell Host Microbe 2021, 29, 463–476.e6. [Google Scholar] [CrossRef]
- Choi, B.; Choudhary, M.C.; Regan, J.; Sparks, J.A.; Padera, R.F.; Qiu, X.; Solomon, I.H.; Kuo, H.-H.; Boucau, J.; Bowman, K.; et al. Persistence and Evolution of SARS-CoV-2 in an Immunocompromised Host. N. Engl. J. Med. 2020, 383, 2291–2293. [Google Scholar] [CrossRef]
- Chen, J.; Wang, R.; Wang, M.; Wei, G.-W. Mutations Strengthened SARS-CoV-2 Infectivity. J. Mol. Biol. 2020, 432, 5212–5226. [Google Scholar] [CrossRef]
- Bazykin, G.; Stanevich, O.; Danilenko, D.; Fadeev, A.; Komissarova, K.; Ivanova, A.; Sergeeva, M.; Safina, K.; Nabieva, E.; Klink, G.; et al. Emergence of Y453F and Δ69-70HV Mutations in a Lymphoma Patient with Long-Term COVID-19. Available online: https://virological.org/t/emergence-of-y453f-and-69-70hv-mutations-in-a-lymphoma-patient-with-long-term-covid-19/580 (accessed on 10 March 2023).
- Andreano, E.; Piccini, G.; Licastro, D.; Casalino, L.; Johnson, N.V.; Paciello, I.; Dal Monego, S.; Pantano, E.; Manganaro, N.; Manenti, A.; et al. SARS-CoV-2 Escape from a Highly Neutralizing COVID-19 Convalescent Plasma. Proc. Natl. Acad. Sci. USA 2021, 118, e2103154118. [Google Scholar] [CrossRef] [PubMed]
- Rambaut, A.; Loman, N.; Pybus, O.G.; Barclay, W.; Barrett, J.; Carabelli, A.; Connor, T.; Peacock, T.; Robertson, D.L.; Volz, E.; et al. Preliminary Genomic Characterisation of an Emergent SARS-CoV-2 Lineage in the UK Defined by a Novel Set of Spike Mutations-SARS-CoV-2 Coronavirus/NCoV-2019 Genomic Epidemiology. Available online: https://virological.org/t/preliminary-genomic-characterisation-of-an-emergent-sars-cov-2-lineage-in-the-uk-defined-by-a-novel-set-of-spike-mutations/563 (accessed on 14 December 2022).
- Tegally, H.; Wilkinson, E.; Giovanetti, M.; Iranzadeh, A.; Fonseca, V.; Giandhari, J.; Doolabh, D.; Pillay, S.; San, E.J.; Msomi, N.; et al. Detection of a SARS-CoV-2 Variant of Concern in South Africa. Nature 2021, 592, 438–443. [Google Scholar] [CrossRef] [PubMed]
- Faria, N.R.; Morales Claro, I.; Candido, D.; Moyses Franco, L.A.; Andrade, P.S.; Coletti, T.M.; Silva, C.A.M.; Sales, F.C.; Manuli, E.R.; Aguiar, R.S.; et al. Genomic Characterisation of an Emergent SARS-CoV-2 Lineage in Manaus: Preliminary Findings-SARS-CoV-2 Coronavirus/NCoV-2019 Genomic Epidemiology. Available online: https://virological.org/t/genomic-characterisation-of-an-emergent-sars-cov-2-lineage-in-manaus-preliminary-findings/586 (accessed on 14 December 2022).
- Dhar, M.S.; Marwal, R.; Vs, R.; Ponnusamy, K.; Jolly, B.; Bhoyar, R.C.; Sardana, V.; Naushin, S.; Rophina, M.; Mellan, T.A.; et al. Genomic Characterization and Epidemiology of an Emerging SARS-CoV-2 Variant in Delhi, India. Science 2021, 374, 995–999. [Google Scholar] [CrossRef] [PubMed]
- Viana, R.; Moyo, S.; Amoako, D.G.; Tegally, H.; Scheepers, C.; Althaus, C.L.; Anyaneji, U.J.; Bester, P.A.; Boni, M.F.; Chand, M.; et al. Rapid Epidemic Expansion of the SARS-CoV-2 Omicron Variant in Southern Africa. Nature 2022, 603, 679–686. [Google Scholar] [CrossRef] [PubMed]
- DGS-URGENT N°2021_08; A, D. Stratégie de Freinage de la Propagation des Variantes du SARS-CoV-2: Précisions pour la Détection des Variantes et le Renforcement du Contact-Tracing. Available online: https://solidarites-sante.gouv.fr/professionnels/article/archives-dgs-urgent (accessed on 14 December 2022).
- DGS-URGENT N°2021_12; A, D. Stratégie de Freinage de la Propagation des Variantes du SARS-CoV-2: Renforcement Sépcifique sur les Variantes d’intérêt 20H/501Y.V2 et 20J/501Y.V3. Available online: https://solidarites-sante.gouv.fr/professionnels/article/archives-dgs-urgent (accessed on 14 December 2022).
- Maisa, A.; Spaccaferri, G.; Fournier, L.; Schaeffer, J.; Deniau, J.; Rolland, P.; Coignard, B. regional COVID-19 investigation team; EMERGEN consortium First Cases of Omicron in France Are Exhibiting Mild Symptoms, November 2021–January 2022. Infect. Dis. Now. 2022, 52, 160–164. [Google Scholar] [CrossRef]
- Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; de Vet, H.C.W.; et al. STARD 2015: An Updated List of Essential Items for Reporting Diagnostic Accuracy Studies. Clin. Chem. 2015, 61, 1446–1452. [Google Scholar] [CrossRef] [PubMed]
- Di Carlo, D.; Mazzuti, L.; Sciandra, I.; Guerrizio, G.; Oliveto, G.; Riveros Cabral, R.J.; Zingaropoli, M.A.; Turriziani, O. Comparison of FTD SARS-CoV-2 Assay and RealStar RT-PCR Kit 1.0 for the Detection of SARS-CoV-2. J. Virol. Methods 2021, 298, 114276. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Quick, J. NCoV-2019 Sequencing Protocol v3 (LoCost). Available online: https://www.protocols.io/view/ncov-2019-sequencing-protocol-v3-locost-bh42j8ye (accessed on 14 December 2022).
- Ncov2019-Artic-Nf. Available online: https://github.com/connor-lab/ncov2019-artic-nf (accessed on 14 December 2022).
- Hadfield, J.; Megill, C.; Bell, S.M.; Huddleston, J.; Potter, B.; Callender, C.; Sagulenko, P.; Bedford, T.; Neher, R.A. Nextstrain: Real-Time Tracking of Pathogen Evolution. Bioinformatics 2018, 34, 4121–4123. [Google Scholar] [CrossRef]
- Rambaut, A.; Holmes, E.C.; O’Toole, Á.; Hill, V.; McCrone, J.T.; Ruis, C.; du Plessis, L.; Pybus, O.G. A Dynamic Nomenclature Proposal for SARS-CoV-2 Lineages to Assist Genomic Epidemiology. Nat. Microbiol. 2020, 5, 1403–1407. [Google Scholar] [CrossRef]
- Nextclade. Available online: https://clades.nextstrain.org (accessed on 14 December 2022).
- O’Toole, Á.; Scher, E.; Underwood, A.; Jackson, B.; Hill, V.; McCrone, J.T.; Colquhoun, R.; Ruis, C.; Abu-Dahab, K.; Taylor, B.; et al. Assignment of Epidemiological Lineages in an Emerging Pandemic Using the Pangolin Tool. Virus Evol. 2021, 7, veab064. [Google Scholar] [CrossRef] [PubMed]
- COG-UK. Available online: https://pangolin.cog-uk.io/ (accessed on 14 December 2022).
- EMERGEN-DB-Home. Available online: https://emergen-db.france-bioinformatique.fr/fr/ (accessed on 14 December 2022).
- Re3data.Org GISAID. Available online: https://www.re3data.org/repository/r3d100010126 (accessed on 14 December 2022).
- Moisan, A.; Mastrovito, B.; De Oliveira, F.; Martel, M.; Hedin, H.; Leoz, M.; Nesi, N.; Schaeffer, J.; Ar Gouilh, M.; Plantier, J.-C. Evidence of Transmission and Circulation of Deltacron XD Recombinant Severe Acute Respiratory Syndrome Coronavirus 2 in Northwest France. Clin. Infect. Dis. 2022, 75, 1841–1844. [Google Scholar] [CrossRef] [PubMed]
- Mastrovito, B.; Naimi, C.; Kouam, L.; Naudot, X.; Fournier, L.; Spaccaferri, G.; Plantier, J.-C.; Soares, A.; De Oliveira, F.; Gueudin, M.; et al. Investigation of Outbreak Cases Infected with the SARS-CoV-2 B.1.640 Variant in a Fully Vaccinated Elderly Population, Normandy, France, November to December 2021. Euro Surveill. 2022, 27, 2200078. [Google Scholar] [CrossRef] [PubMed]
- DGS-URGENT N°2021_48; A, D. Variant Indien B.1.617: Renforcement du Dépistage et des Mesures aux Frontières. Available online: https://solidarites-sante.gouv.fr/professionnels/article/archives-dgs-urgent (accessed on 14 December 2022).
- Banada, P.; Green, R.; Banik, S.; Chopoorian, A.; Streck, D.; Jones, R.; Chakravorty, S.; Alland, D. A Simple RT-PCR Melting Temperature Assay to Rapidly Screen for Widely Circulating SARS-CoV-2 Variants. medRxiv 2021. Preprint. [Google Scholar] [CrossRef]
- Camp, J.V.; Buchta, C.; Jovanovic, J.; Puchhammer-Stöckl, E.; Benka, B.; Griesmacher, A.; Aberle, S.W.; Goerzer, I. RT-PCR Based SARS-CoV-2 Variant Screening Assays Require Careful Quality Control. J. Clin. Virol. 2021, 141, 104905. [Google Scholar] [CrossRef]
- Chan, C.T.-M.; Leung, J.S.-L.; Lee, L.-K.; Lo, H.W.-H.; Wong, E.Y.-K.; Wong, D.S.-H.; Ng, T.T.-L.; Lao, H.-Y.; Lu, K.K.; Jim, S.H.-C.; et al. A Low-Cost TaqMan Minor Groove Binder Probe-Based One-Step RT-QPCR Assay for Rapid Identification of N501Y Variants of SARS-CoV-2. J. Virol. Methods 2022, 299, 114333. [Google Scholar] [CrossRef]
- Zelyas, N.; Pabbaraju, K.; Croxen, M.A.; Lynch, T.; Buss, E.; Murphy, S.A.; Shokoples, S.; Wong, A.; Kanji, J.N.; Tipples, G. Precision Response to the Rise of the SARS-CoV-2 B.1.1.7 Variant of Concern by Combining Novel PCR Assays and Genome Sequencing for Rapid Variant Detection and Surveillance. Microbiol. Spectr. 2021, 9, e0031521. [Google Scholar] [CrossRef]
- Berno, G.; Fabeni, L.; Matusali, G.; Gruber, C.E.M.; Rueca, M.; Giombini, E.; Garbuglia, A.R. SARS-CoV-2 Variants Identification: Overview of Molecular Existing Methods. Pathogens 2022, 11, 1058. [Google Scholar] [CrossRef]
RT-PCR#1 | ||||
Targeted mutations | Oligonucleotide | Fluorophore-Sequence (5′ > 3′)-Quencher | Volume for one tube of dilution at 10 µM | |
69–70 deletion | 69–70.F | Primer Forward 152U21 | CTCAGGACTTGTTCTTACCTT | 0.5 µL |
69–70.R | Primer Reverse 262L20 | GAAGCAAAATAAACACCATC | 0.5 µL | |
IC1.P | Probe IC SARS-CoV-2 | FAM–TCTCTGGGACCAATGGTACT–BHQ1 | 0.25 µL | |
69–70.P | Probe 69–70 deletion | JOE–TGGTCCCAGAGACATGTATAGC–BHQ1 | 0.25 µL | |
N501Y substitution | 501Y.F | Primer Forward N501Y | GGTGTTRAAGGTTTTAATTGTTAC | 0.5 µL |
501Y.R | Primer Reverse N501Y | TTTTAGGTCCACAAACAGTTGC | 0.5 µL | |
501Y.P | Probe SARS-CoV-2 N501Y | Cy5-CCAACCCACTAATGGTGT–MGB | 0.25 µL | |
RT-PCR#2 | ||||
Targeted mutations | Oligonucleotide | Fluorophore-Sequence (5′ > 3′)-Quencher | Volume for one tube of dilution at 10 µM | |
L452R, E484K and E484Q substitutions | PCR2.F | Primer Forward 1283U21 | ATTTTACAGGCTGCGTTATAG | 0.5 µL |
PCR2.R | Primer Reverse 1548L19 | TGCTGGTGCATGTAGAAGT | 0.5 µL | |
IC2.P | Probe IC2 SARS-CoV-2 | JOE–TACCRGCCTGATAGATTTCAGTTG–BHQ1 | 0.25 µL | |
452R.P | Probe SARS-CoV-2 L452R | FAM–CCGGTATAGATTGTTTAGGA–MGB | 0.25 µL | |
484K.P | Probe SARS-CoV-2 E484K | Cy5–CCTTGTAATGGTGTTAAAGGT–MGB | 0.25 µL | |
484Q.P | Probe SARS-CoV-2 E484Q | ROX–CTTGTAATGGTGTTCAAGGT–MGB | 0.25 µL |
Prevalence | Analytical Performance | Clinical Performance | ||||||
Sensitivity | Specificity | Sensitivity | Specificity | Positive Predictive Value | Negative Predictive Value | |||
RT-PCR#1 | 69-70del | 53.9% | 500 IU/mL | 100.0% | 99.4% | 100.0% | 100.0% | 99.3% |
N501Y | 75.1% | 500 IU/mL | 100.0% | 100.0% | 100.0% | 100.0% | ||
RT-PCR#2 | E484K | 85.7% | 1000 IU/mL | 100.0% | 92.9% | 99.9% | 92.9% | 99.9% |
E484Q | 1.5% | 2000 IU/mL | 100.0% | 100.0% | 100.0% | 100.0% | ||
L452R | 1.5% | 2000 IU/mL | 99.9% | 96.2% | 99.4% | 99.2% |
Amplification | Interpretation | Suspected Variants | |||
FAM | JOE | Cy5 | First period of use [February–May 2021] | Second period of use [December 2021–February 2022] | |
(IC) | (69–70del) | (N501Y) | |||
+ * | + | + | No mutation detected | No Alpha, Beta or Gamma variant | Delta |
+ | − | − | 69–70 deletion and N501Y substitution detected | Alpha | Omicron BA.1 |
+ | + | − | N501Y substitution detected | Beta or Gamma | Omicron BA.2 or Deltacron XD or B.1.640 variant |
+ | − | + | 69–70 deletion detected | No Alpha, Beta or Gamma variant | No Delta or Omicron variant |
− ** | − | − | Insufficient amount of virus or PCR inhibition | Noncontributive result requiring NGS *** | Noncontributive result requiring NGS |
RT-PCR#1 Amplification | NGS Results | RT-PCR#2 Amplification | NGS Results | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Sample ID | Ct FAM | Ct JOE | Ct Cy5 | Clade/Lineage | Deletion/Substitution Detected | Sample ID | Ct JOE | Ct FAM | Ct ROX | Ct Cy5 | Clade/Lineage | Substitution Detected |
(IC) | (69–70 del) | (N501Y) | (IC) | (L452R) | (E484Q) | (E484K) | ||||||
1 | Pos (Ct < 37) | Neg | Neg | 20I (Alpha, V1) | 69–70del + N501Y | 31 | Pos (Ct < 37) | Pos | Neg | Neg | 19B/501Y * | L452R |
2 | Pos (Ct < 37) | Neg | Neg | 20I (Alpha, V1) | 69–70del + N501Y | 32 | Pos (Ct < 37) | Neg | Neg | Neg | 20A_B.1.640 * | None |
3 | Pos (Ct < 37) | Neg | Neg | 20I (Alpha, V1) | 69–70del + N501Y | 33 | Pos (Ct < 37) | Neg | Neg | Pos | 20B/681H * | E484K |
4 | Pos (Ct < 37) | Neg | Neg | 20I (Alpha, V1) | 69–70del + N501Y | 34 | Pos (Ct < 37) | Pos | Neg | Neg | 20D * | L452R |
5 | Pos (Ct < 37) | Neg | Neg | 20I (Alpha, V1) | 69–70del + N501Y | 35 | Pos (Ct < 37) | Neg | Neg | Pos | 20H (Beta, V2) | E484K |
6 | Pos (Ct < 37) | Neg | Neg | 20I (Alpha, V1) | 69–70del + N501Y | 36 | Pos (Ct < 37) | Neg | Neg | Pos | 20H (Beta, V2) | E484K |
7 | Pos (Ct < 37) | Neg | Neg | 20I (Alpha, V1) | 69–70del + N501Y | 37 | Pos (Ct < 37) | Neg | Neg | Pos | 20H (Beta, V2) | E484K |
8 | Pos (Ct < 37) | Pos | Neg | 20H (Beta, V2) | N501Y | 38 | Pos (Ct < 37) | Neg | Neg | Pos | 20H (Beta, V2) | E484K |
9 | Pos (Ct < 37) | Pos | Neg | 20H (Beta, V2) | N501Y | 39 | Pos (Ct < 37) | Neg | Neg | Pos | 20H (Beta, V2) | E484K |
10 | Pos (Ct < 37) | Pos | Neg | 20H (Beta, V2) | N501Y | 40 | Pos (Ct < 37) | Neg | Neg | Pos | 20I (Alpha, V1) | E484K |
11 | Pos (Ct < 37) | Pos | Neg | 20H (Beta, V2) | N501Y | 41 | Pos (Ct < 37) | Neg | Neg | Pos | 20I (Alpha, V1) | E484K |
12 | Pos (Ct < 37) | Pos | Neg | 20H (Beta, V2) | N501Y | 42 | Pos (Ct < 37) | Neg | Neg | Pos | 20J (Gamma, V3) | E484K |
13 | Pos (Ct < 37) | Pos | Neg | 20H (Beta, V2) | N501Y | 43 | Pos (Ct < 37) | Pos | Neg | Neg | 21A (Delta) | L452R |
14 | Pos (Ct < 37) | Pos | Neg | 20H (Beta, V2) | N501Y | 44 | Pos (Ct < 37) | Pos | Neg | Neg | 21A (Delta) | L452R |
15 | Pos (Ct < 37) | Pos | Neg | 20J (Gamma, V3) | N501Y | 45 | Pos (Ct < 37) | Pos | Neg | Neg | 21A (Delta) | L452R |
16 | Pos (Ct < 37) | Pos | Neg | 20J (Gamma, V3) | N501Y | 46 | Pos (Ct < 37) | Pos | Neg | Neg | 21A (Delta) | L452R |
17 | Pos (Ct < 37) | Pos | Neg | 20J (Gamma, V3) | N501Y | 47 | Pos (Ct < 37) | Pos | Neg | Neg | 21A (Delta) | L452R |
18 | Pos (Ct < 37) | Neg | Neg | 21K (Omicron, BA.1) | 69–70del + N501Y | 48 | Pos (Ct < 37) | Neg | Neg | Pos | 21H (Mu) * | E484K |
19 | Pos (Ct < 37) | Neg | Neg | 21K (Omicron, BA.1) | 69–70del + N501Y | 49 | Pos (Ct < 37) | Pos | Neg | Neg | 21I (Delta) | L452R |
20 | Pos (Ct < 37) | Neg | Neg | 21K (Omicron, BA.1) | 69–70del + N501Y | 50 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
21 | Pos (Ct < 37) | Neg | Neg | 21K (Omicron, BA.1) | 69–70del + N501Y | 51 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
22 | Pos (Ct < 37) | Neg | Neg | 21K (Omicron, BA.1) | 69–70del + N501Y | 52 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
23 | Pos (Ct < 37) | Neg | Neg | 21K (Omicron, BA.1) | 69–70del + N501Y | 53 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
24 | Pos (Ct < 37) | Pos | Neg | 21L (Omicron, BA.2) | N501Y | 54 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
25 | Pos (Ct < 37) | Pos | Neg | 21L (Omicron, BA.2) | N501Y | 55 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
26 | Pos (Ct < 37) | Pos | Neg | 21L (Omicron, BA.2) | N501Y | 56 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
27 | Pos (Ct < 37) | Pos | Neg | 21L (Omicron, BA.2) | N501Y | 57 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
28 | Pos (Ct < 37) | Pos | Neg | 21L (Omicron, BA.2) | N501Y | 58 | Pos (Ct < 37) | Pos | Pos | Neg | 21J (Delta) | L452R +E484Q |
29 | Pos (Ct < 37) | Pos | Pos | 21J (Delta) | None | 59 | Pos (Ct < 37) | Neg | Neg | Neg | 21K (Omicron, BA.1) | None |
30 | Pos (Ct < 37) | Pos | Pos | 21J (Delta) | None | 60 | Pos (Ct < 37) | Neg | Neg | Neg | 21K (Omicron, BA.1) | None |
RT-PCR#1 | RT-PCR#2 | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
WHO–IS SCV-2 RNA Concentration | Ct FAM (IC) | Ct Cy5 (N501Y) | Ct JOE (69–70 del) | Ct JOE (IC) | |||||||||
IU/mL | Log10 IU/mL | Replicate 1 | Replicate 2 | Mean value | Replicate 1 | Replicate 2 | Mean value | Replicate 1 | Replicate 2 | Mean value | Replicate 1 | Replicate 2 | Mean value |
5,011,872 | 6.7 | 24.29 | 23.92 | 24.11 | 25.99 | 26.26 | 26.13 | 23.92 | 23.89 | 23.91 | 25.44 | 26.06 | 25.75 |
501,187 | 5.7 | 27.07 | 27.42 | 27.25 | 28.8 | 29.07 | 28.94 | 26.52 | 27.07 | 26.80 | 28.45 | 29.38 | 28.92 |
50,119 | 4.7 | 31.19 | 31.08 | 31.14 | 32.85 | 32.59 | 32.72 | 30.58 | 30.51 | 30.55 | 32.96 | 32.73 | 32.85 |
5012 | 3.7 | 35.5 | 35.91 | 35.71 | 36.09 | 37.55 | 36.82 | 34.95 | 34.47 | 34.71 | 37.3 | 36.96 | 37.13 |
501 | 2.7 | 38.66 | 37.5 | 38.08 | 39.36 | 40.17 | 39.77 | 38.18 | 37.04 | 37.61 | 41.35 | 41.39 | 41.37 |
250 | 2.4 | Neg | Neg | 40.35 | 41.16 | 40.76 | Neg | Neg | Neg | Neg | |||
125 | 2.1 | Neg | Neg | Neg | 43.14 | Neg | Neg | Neg | Neg | ||||
62.5 | 1.8 | Neg | Neg | Neg | Neg | Neg | Neg | Neg | Neg |
Amplification | Interpretation | Suspected Variants | |||
---|---|---|---|---|---|
JOE | FAM | Cy5 | ROX | ||
(IC) | (L452R) | (E484K) | (E484Q) | ||
+ * | − | − | − | No mutation detected | Circulating VOIs |
+ | + | − | − | L452R substitution detected | Delta |
+ | − | + | − | E484K substitution detected | Beta or Gamma |
+ | − | − | + | E484Q substitution detected | Noncontributive result requiring NGS *** |
+ | + | + | − | L452R and E484K substitutions detected | Noncontributive result requiring NGS |
− ** | − | − | − | Insufficient amount of virus or PCR inhibition | Noncontributive result requiring NGS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moisan, A.; Soares, A.; De Oliveira, F.; Alessandri-Gradt, E.; Lecoquierre, F.; Fourneaux, S.; Plantier, J.-C.; Gueudin, M. Evaluation of Analytical and Clinical Performance and Usefulness in a Real-Life Hospital Setting of Two in-House Real-Time RT-PCR Assays to Track SARS-CoV-2 Variants of Concern. Viruses 2023, 15, 1115. https://doi.org/10.3390/v15051115
Moisan A, Soares A, De Oliveira F, Alessandri-Gradt E, Lecoquierre F, Fourneaux S, Plantier J-C, Gueudin M. Evaluation of Analytical and Clinical Performance and Usefulness in a Real-Life Hospital Setting of Two in-House Real-Time RT-PCR Assays to Track SARS-CoV-2 Variants of Concern. Viruses. 2023; 15(5):1115. https://doi.org/10.3390/v15051115
Chicago/Turabian StyleMoisan, Alice, Anaïs Soares, Fabienne De Oliveira, Elodie Alessandri-Gradt, François Lecoquierre, Steeve Fourneaux, Jean-Christophe Plantier, and Marie Gueudin. 2023. "Evaluation of Analytical and Clinical Performance and Usefulness in a Real-Life Hospital Setting of Two in-House Real-Time RT-PCR Assays to Track SARS-CoV-2 Variants of Concern" Viruses 15, no. 5: 1115. https://doi.org/10.3390/v15051115