A Novel Quadruple Gene-Deleted BoHV-1-Vectored RVFV Subunit Vaccine Induces Humoral and Cell-Mediated Immune Response against Rift Valley Fever in Calves
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Medium
2.2. Viruses
2.2.1. Commercial Antibodies
2.2.2. Rabbit Anti-RVFV Gn and Gc Polyclonal Antibodies Production
2.3. Construction of BoHV-1qmv Vector Virus Expressing the Chimeric RVFV Gn-GMCSF and Gc Proteins
2.3.1. Construction of RVFV Gn-GMCSF-Gc Expression Cassette
2.3.2. Construction of BoHV-1qmv Expressing RVFV Gn-GMCSF-Gc Expression Cassette (BoHV-1qmv Sub-RVFV)
2.4. Growth Kinetics and Plaque Size Assay
2.5. Characterization of RVFV Gn and Gc Proteins
2.6. Immunoprecipitation, Endoglycosidase H (Endo H), and Peptide-N-Glycosidase F (PNGase-F) Sensitivity Analyses
2.7. Vaccine Virus Stability In Vitro
2.8. Calves and Experimental Design
2.9. Clinical Examination of Calves Following Immunization
2.10. Collection and Processing of Samples from Immunized Calves
2.11. Serum Virus Neutralization Assay for BoHV-1 and RVFV Vaccine Strain MP-12 by Plaque Reduction Assay for BoHV-1 and RVFV
2.12. DNA Isolation and Quantitative PCR (qPCR)
2.13. RVFV-Specific Cell-Mediated Immune Response Assay
2.14. Indirect Immunofluorescence Assay
2.15. Statistical Analysis
3. Results
3.1. Characterization of BoHV-1qmv Sub-RVFV Recombinant Virus
3.1.1. BoHV-1qmv Sub-RVFV Virus Expresses the Chimeric RVFV Gn-GMCSF-FLAG and Gc-V5 Proteins
3.1.2. Glycosylation of Chimeric Gn-GMSCF and Gc
3.1.3. The BoHV-1qmv Sub-RVFV Vaccine Virus-Expressed Gn-GMCSF and Gc Proteins Form the Gn-Gc Complex
3.1.4. Like the BoHV-1 wt, the BoHV-1qmv Sub-RVFV Vaccine Virus Replicated with a Similar Kinetics and Virus Yield in MDBK Cells but Produced Smaller Plaques
3.2. The BoHV-1qmv Sub-RVFV Is Stable in Expressing Gn-GMCSF and Gc Proteins after Ten Serial In Vitro Passages in Cell Culture
3.3. The BoHV-1qmv Sub-RVFV (Vaccine Virus) Is Highly Attenuated and Safe in Immunized Calves
3.4. Nasal Virus Shedding Following IN/Subcutaneous Immunization
3.5. A Single Vaccination Dose of BoHV-1qmv Sub-RVFV Induced a Robust (Vector-Specific) and Moderate (RVFV-Specific) Levels of Serum-Neutralizing (SN) Antibody Response in the Immunized Calves
3.6. RVFV-Specific CMI Response in the BoHV-1qmv Sub-RVFV Immunized Calves
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Smithburn, K.C.; Mahaffy, A.F.; Haddow, A.J.; Kitchen, S.F.; Smith, J.F. Rift Valley fever: Accidental infections among laboratory workers. J. Immunol. 1949, 62, 213–227. [Google Scholar] [CrossRef] [PubMed]
 - Van Velden, D.J.; Meyer, J.D.; Olivier, J.; Gear, J.H.; McIntosh, B. Rift Valley fever affecting humans in South Africa: A clinicopathological study. S. Afr. Med. J. 1977, 51, 867–871. [Google Scholar] [PubMed]
 - Hartman, A.L.; Powell, D.S.; Bethel, L.M.; Caroline, A.L.; Schmid, R.J.; Oury, T.; Reed, D.S. Aerosolized rift valley fever virus causes fatal encephalitis in african green monkeys and common marmosets. J. Virol. 2014, 88, 2235–2245. [Google Scholar] [CrossRef]
 - Gerrard, S.R.; Nichol, S.T. Synthesis, proteolytic processing and complex formation of N-terminally nested precursor proteins of the Rift Valley fever virus glycoproteins. Virology 2007, 357, 124–133. [Google Scholar] [CrossRef] [PubMed]
 - Faburay, B.; LaBeaud, A.D.; McVey, D.S.; Wilson, W.C.; Richt, J.A. Current Status of Rift Valley Fever Vaccine Development. Vaccines 2017, 5, 29. [Google Scholar] [CrossRef]
 - Harmon, J.R.; Barbeau, D.J.; Nichol, S.T.; Spiropoulou, C.F.; McElroy, A.K. Rift Valley fever virus vaccination induces long-lived, antigen-specific human T cell responses. NPJ Vaccines 2020, 5, 17. [Google Scholar] [CrossRef]
 - Tran, A.; Trevennec, C.; Lutwama, J.; Sserugga, J.; Gely, M.; Pittiglio, C.; Pinto, J.; Chevalier, V. Development and Assessment of a Geographic Knowledge-Based Model for Mapping Suitable Areas for Rift Valley Fever Transmission in Eastern Africa. PLoS Negl. Trop. Dis. 2016, 10, e0004999. [Google Scholar] [CrossRef]
 - Anyamba, A.; Chretien, J.P.; Formenty, P.B.; Small, J.; Tucker, C.J.; Malone, J.L.; El Bushra, H.; Martin, V.; Linthicum, K.J. Rift Valley Fever potential, Arabian Peninsula. Emerg. Infect. Dis. 2006, 12, 518–520. [Google Scholar] [CrossRef]
 - Caplen, H.; Peters, C.J.; Bishop, D.H. Mutagen-directed attenuation of Rift Valley fever virus as a method for vaccine development. J. Gen. Virol. 1985, 66 Pt 10, 2271–2277. [Google Scholar] [CrossRef]
 - Saluzzo, J.F.; Smith, J.F. Use of reassortant viruses to map attenuating and temperature-sensitive mutations of the Rift Valley fever virus MP-12 vaccine. Vaccine 1990, 8, 369–375. [Google Scholar] [CrossRef]
 - Vialat, P.; Muller, R.; Vu, T.H.; Prehaud, C.; Bouloy, M. Mapping of the mutations present in the genome of the Rift Valley fever virus attenuated MP12 strain and their putative role in attenuation. Virus Res. 1997, 52, 43–50. [Google Scholar] [CrossRef] [PubMed]
 - Hunter, P.; Erasmus, B.J.; Vorster, J.H. Teratogenicity of a mutagenised Rift Valley fever virus (MVP 12) in sheep. Onderstepoort J. Vet. Res. 2002, 69, 95–98. [Google Scholar] [PubMed]
 - Ikegami, T. Rift Valley fever vaccines: An overview of the safety and efficacy of the live-attenuated MP-12 vaccine candidate. Expert. Rev. Vaccines 2017, 16, 601–611. [Google Scholar] [CrossRef] [PubMed]
 - Ly, H.J.; Lokugamage, N.; Nishiyama, S.; Ikegami, T. Risk analysis of inter-species reassortment through a Rift Valley fever phlebovirus MP-12 vaccine strain. PLoS ONE 2017, 12, e0185194. [Google Scholar] [CrossRef]
 - Grobbelaar, A.A.; Weyer, J.; Leman, P.A.; Kemp, A.; Paweska, J.T.; Swanepoel, R. Molecular epidemiology of Rift Valley fever virus. Emerg. Infect. Dis. 2011, 17, 2270–2276. [Google Scholar] [CrossRef] [PubMed]
 - Kortekaas, J.; Dekker, A.; de Boer, S.M.; Weerdmeester, K.; Vloet, R.P.; de Wit, A.A.; Peeters, B.P.; Moormann, R.J. Intramuscular inoculation of calves with an experimental Newcastle disease virus-based vector vaccine elicits neutralizing antibodies against Rift Valley fever virus. Vaccine 2010, 28, 2271–2276. [Google Scholar] [CrossRef]
 - Ayari-Fakhfakh, E.; Ghram, A.; Albina, E.; Cetre-Sossah, C. Expression of cytokines following vaccination of goats with a recombinant capripoxvirus vaccine expressing Rift Valley fever virus proteins. Vet. Immunol. Immunopathol. 2018, 197, 15–20. [Google Scholar] [CrossRef]
 - Warimwe, G.M.; Lorenzo, G.; Lopez-Gil, E.; Reyes-Sandoval, A.; Cottingham, M.G.; Spencer, A.J.; Collins, K.A.; Dicks, M.D.; Milicic, A.; Lall, A.; et al. Immunogenicity and efficacy of a chimpanzee adenovirus-vectored Rift Valley fever vaccine in mice. Virol. J. 2013, 10, 349. [Google Scholar] [CrossRef]
 - Hao, M.; Bian, T.; Fu, G.; Chen, Y.; Fang, T.; Zhao, C.; Liu, S.; Yu, C.; Li, J.; Chen, W. An adenovirus-vectored RVF vaccine confers complete protection against lethal RVFV challenge in A129 mice. Front. Microbiol. 2023, 14, 1114226. [Google Scholar] [CrossRef]
 - Lopez-Gil, E.; Moreno, S.; Ortego, J.; Borrego, B.; Lorenzo, G.; Brun, A. MVA Vectored Vaccines Encoding Rift Valley Fever Virus Glycoproteins Protect Mice against Lethal Challenge in the Absence of Neutralizing Antibody Responses. Vaccines 2020, 8, 82. [Google Scholar] [CrossRef]
 - Faburay, B.; Lebedev, M.; McVey, D.S.; Wilson, W.; Morozov, I.; Young, A.; Richt, J.A. A glycoprotein subunit vaccine elicits a strong Rift Valley fever virus neutralizing antibody response in sheep. Vector Borne Zoonotic Dis. 2014, 14, 746–756. [Google Scholar] [CrossRef]
 - Li, Y.; Han, L.; Zhao, Y.; Zheng, X.; Wang, H.; Gai, W.; Jin, H.; Li, G.; Wang, Q.; Feng, N.; et al. Immunogenicity Assessment of Rift Valley Fever Virus Virus-Like Particles in BALB/c Mice. Front. Vet. Sci. 2020, 7, 62. [Google Scholar] [CrossRef] [PubMed]
 - Chowdhury, S.I.; Pannhorst, K.; Sangewar, N.; Pavulraj, S.; Wen, X.; Stout, R.W.; Mwangi, W.; Paulsen, D.B. BoHV-1-Vectored BVDV-2 Subunit Vaccine Induces BVDV Cross-Reactive Cellular Immune Responses and Protects against BVDV-2 Challenge. Vaccines 2021, 9, 46. [Google Scholar] [CrossRef] [PubMed]
 - Chowdhury, S.I.; Wei, H.; Weiss, M.; Pannhorst, K.; Paulsen, D.B. A triple gene mutant of BoHV-1 administered intranasally is significantly more efficacious than a BoHV-1 glycoprotein E-deleted virus against a virulent BoHV-1 challenge. Vaccine 2014, 32, 4909–4915. [Google Scholar] [CrossRef]
 - Liu, Z.F.; Brum, M.C.; Doster, A.; Jones, C.; Chowdhury, S.I. A bovine herpesvirus type 1 mutant virus specifying a carboxyl-terminal truncation of glycoprotein E is defective in anterograde neuronal transport in rabbits and calves. J. Virol. 2008, 82, 7432–7442. [Google Scholar] [CrossRef]
 - Daniels, R.W.; Rossano, A.J.; Macleod, G.T.; Ganetzky, B. Expression of multiple transgenes from a single construct using viral 2A peptides in Drosophila. PLoS ONE 2014, 9, e100637. [Google Scholar] [CrossRef] [PubMed]
 - Al-Mubarak, A.; Zhou, Y.; Chowdhury, S.I. A glycine-rich bovine herpesvirus 5 (BHV-5) gE-specific epitope within the ectodomain is important for BHV-5 neurovirulence. J. Virol. 2004, 78, 4806–4816. [Google Scholar] [CrossRef]
 - Pavulraj, S.; Pannhorst, K.; Stout, R.W.; Paulsen, D.B.; Carossino, M.; Meyer, D.; Becher, P.; Chowdhury, S.I. A Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Protects Pigs against PCV2b Challenge and Induces Serum Neutralizing Antibody Response against CSFV. Vaccines 2022, 10, 305. [Google Scholar] [CrossRef]
 - Phoenix, I.; Nishiyama, S.; Lokugamage, N.; Hill, T.E.; Huante, M.B.; Slack, O.A.; Carpio, V.H.; Freiberg, A.N.; Ikegami, T. N-Glycans on the Rift Valley Fever Virus Envelope Glycoproteins Gn and Gc Redundantly Support Viral Infection via DC-SIGN. Viruses 2016, 8, 149. [Google Scholar] [CrossRef]
 - Bird, B.H.; Nichol, S.T. Breaking the chain: Rift Valley fever virus control via livestock vaccination. Curr. Opin. Virol. 2012, 2, 315–323. [Google Scholar] [CrossRef]
 - Anyangu, A.S.; Gould, L.H.; Sharif, S.K.; Nguku, P.M.; Omolo, J.O.; Mutonga, D.; Rao, C.Y.; Lederman, E.R.; Schnabel, D.; Paweska, J.T.; et al. Risk factors for severe Rift Valley fever infection in Kenya, 2007. Am. J. Trop. Med. Hyg. 2010, 83, 14–21. [Google Scholar] [CrossRef] [PubMed]
 - Gerrard, S.R.; Nichol, S.T. Characterization of the Golgi retention motif of Rift Valley fever virus G(N) glycoprotein. J. Virol. 2002, 76, 12200–12210. [Google Scholar] [CrossRef] [PubMed]
 







) in immunized calves assessed by qPCR and virus isolation. (A) After the inoculation into the KOP-R cells, the virus was isolated from each animal’s nasal swab and titrated in confluent KOP-R cells by plaque assay. Shown are the virus titers in the plaque-forming unit/mL of the nasal swab. (B) DNA was isolated from nasal swabs following inoculation and BoHV-1-qPCR was performed. The mean copy numbers of the BoHV-1 genome are shown in 100 ng of total DNA. PFU/mL; dpv—days post-vaccination.
  
) in immunized calves assessed by qPCR and virus isolation. (A) After the inoculation into the KOP-R cells, the virus was isolated from each animal’s nasal swab and titrated in confluent KOP-R cells by plaque assay. Shown are the virus titers in the plaque-forming unit/mL of the nasal swab. (B) DNA was isolated from nasal swabs following inoculation and BoHV-1-qPCR was performed. The mean copy numbers of the BoHV-1 genome are shown in 100 ng of total DNA. PFU/mL; dpv—days post-vaccination.


| Gene | Peptides | Amino Acid Sequence | 
|---|---|---|
| RVFV Gn | Peptide 1 | RNRPGKGHNYIDGMTQEDAT-Cys | 
| Peptide 2 | SQCPKIGGHGSKK | |
| Peptide 3 | ECTAQYANAYCSHAN | |
| RVFV Gc | Peptide 1 | Cys-VSSELSCREGQSYWTG | 
| Peptide 2 | Cys-RNDKTFAASKGNRGVQAFSK | |
| Peptide 3 | VLPSENGTKDQCQI | 
| Primer/Probe/ds-Gblock | Sequence | |
|---|---|---|
| BoHV-1 major capsid protein | Forward | 5′-tttggaggccctagagaagc-3′ | 
| Reverse | 5′-aaacgtcaggtccatgttgc-3′ | |
| Probe | 5′Fam-cgggtgccctacccgctggt-3′Tamra | |
| ds-gblock | 5′-ccgttggggaccggctagtgtttttggaggccctagagaagcgcgtgtaccaggccacgcgggtg ccctacccgctggtaggcaacatggacctgacgtttgtcatgccgctggggctgtacaaa-3′  | |
| Bovine Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) | Forward | 5′-catgaccactttggcatcgt-3′ | 
| Reverse | 5′-ccatccacagtcttctgggt-3′ | |
| Probe | 5’fam-accactgtccacgccatcactgcc-3’tamra | |
| ds-gblock | 5′-ggcccccctggccaaggtcatccatgaccactttggcatcgtggagggacttatgaccac tgtccacgccatcactgccacccagaagactgtggatggcccctccgggaagctgtggcgt-3′  | |
| Bovine interferon gamma | Forward | 5′-ccaggtcattcaaaggagca-3′ | 
| Reverse | 5′-tgcagatcatccaccggaat-3′ | |
| Probe | 5′Fam-tgaagtcctccagtttctcagagctgcc-3′Tamra | |
| ds-gblock | 5′-cctcaaagataaccaggtcattcaaaggagcatggatatcatcaagcaagacatgtttcagaagttcttgaatgg Cagctctgagaaactggaggacttcaaaaagctgattcaaattccggtggatgatctgcagatccagcgcaa-3′  | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pavulraj, S.; Stout, R.W.; Barras, E.D.; Paulsen, D.B.; Chowdhury, S.I. A Novel Quadruple Gene-Deleted BoHV-1-Vectored RVFV Subunit Vaccine Induces Humoral and Cell-Mediated Immune Response against Rift Valley Fever in Calves. Viruses 2023, 15, 2183. https://doi.org/10.3390/v15112183
Pavulraj S, Stout RW, Barras ED, Paulsen DB, Chowdhury SI. A Novel Quadruple Gene-Deleted BoHV-1-Vectored RVFV Subunit Vaccine Induces Humoral and Cell-Mediated Immune Response against Rift Valley Fever in Calves. Viruses. 2023; 15(11):2183. https://doi.org/10.3390/v15112183
Chicago/Turabian StylePavulraj, Selvaraj, Rhett W. Stout, Elise D. Barras, Daniel B. Paulsen, and Shafiqul I. Chowdhury. 2023. "A Novel Quadruple Gene-Deleted BoHV-1-Vectored RVFV Subunit Vaccine Induces Humoral and Cell-Mediated Immune Response against Rift Valley Fever in Calves" Viruses 15, no. 11: 2183. https://doi.org/10.3390/v15112183
APA StylePavulraj, S., Stout, R. W., Barras, E. D., Paulsen, D. B., & Chowdhury, S. I. (2023). A Novel Quadruple Gene-Deleted BoHV-1-Vectored RVFV Subunit Vaccine Induces Humoral and Cell-Mediated Immune Response against Rift Valley Fever in Calves. Viruses, 15(11), 2183. https://doi.org/10.3390/v15112183
        
