Establishment and Application of CRISPR–Cas12a-Based Recombinase Polymerase Amplification and a Lateral Flow Dipstick and Fluorescence for the Detection and Distinction of Deformed Wing Virus Types A and B
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses and Clinical Samples
2.2. Construction of Standard Recombinant Plasmids
2.3. Design and Preparation of RPA Primers, crRNAs, and ssDNA Reporters
2.4. Establishment of the RPA Assay
2.5. RPA–CRISPR–Cas12a Fluorescence-Based Detection Assay (FBDA)
2.6. RPA–CRISPR–Cas12a Assay Combined with an LFD Assay
2.7. Validation with Clinical Samples
2.8. Statistical Analysis
3. Results
3.1. Screening of RPA Primers and crRNA
3.2. Specificity and Sensitivity of the RPA–CRISPR–Cas12a-FBDA
3.3. RPA–CRISPR–Cas12a–LFD Assay
3.4. Comparison of the Performance of the Assay and RT–qPCR in Clinical Samples
4. Discussion
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bradford, E.L.; Christie, C.R.; Campbell, E.M.; Bowman, A.S. A real-time PCR method for quantification of the total and major variant strains of the deformed wing virus. PLoS ONE 2017, 12, e0190017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parekh, F.; Daughenbaugh, K.F.; Flenniken, M.L. Chemical Stimulants and Stressors Impact the Outcome of Virus Infection and Immune Gene Expression in Honey Bees (Apis mellifera). Front. Immunol. 2021, 12, 747848. [Google Scholar] [CrossRef] [Scilit]
- de Miranda, J.R.; Genersch, E. Deformed Wing Virus. J. Invertebr. Pathol. 2010, 103, S48–S61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamp, B.; Url, A.; Seitz, K.; Eichhorn, J.; Riedel, C.; Sinn, L.J.; Indik, S.; Köglberger, H.; Rümenapf, T. Construction and Rescue of a Molecular Clone of Deformed Wing Virus (DWV). PLoS ONE 2016, 11, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Genersch, E.; Ohe, W.V.D.; Kaatz, H.; Schroeder, A.; Otten, C.; Büchler, R.; Berg, S.; Ritter, W.; Mühlen, W.; Gisder, S.; et al. The German Bee Monitoring Project: A Long Term Study to Understand Periodically High Winter Losses of Honey Bee Colonies. Apidologie 2010, 41, 332–352. [Google Scholar] [CrossRef] [Scilit]
- Annoscia, D.; Piccolo, D.F.; Covre, F.; Nazzi, F. Mite Infestation During Development Alters the in-Hive Behaviour of Adult Honeybees. Apidologie 2015, 46, 306–314. [Google Scholar] [CrossRef] [Scilit]
- Kristof, B.; Anneleen, G.V.; Dries, C.; De Smet, L.; de Graaf, D.C.; Schoofs, L.; Larmuseau, M.H.D.; Brettell, L.E.; Martin, S.J.; Wenseleers, T. Covert Deformed Wing Virus Infections Have Long-Term Deleterious Effects on Honeybee Foraging and Survival. Proc. Biol. Sci. 2017, 284, 2149. [Google Scholar]
- Ryabov, E.V.; Wood, G.R.; Fannon, J.M.; Moore, J.D.; Bull, J.C.; Chandler, D.; Mead, A.; Burroughs, N.; Evans, D.J. A virulent strain of deformed wing virus (DWV) of honeybees (Apis mellifera) prevails after Varroa destructor-mediated, or in vitro, transmission. PLoS Pathog. 2014, 10, e1004230. [Google Scholar] [CrossRef] [Scilit]
- Ongus, J.R.; Peters, D.; Bonmatin, J.M.; Bengsch, E.; Vlak, J.M.; van Oers, M.M. Complete sequence of a picorna-like virus of the genus lflavirus replicating in the mite Varroa destructor. J. Gen. Virol. 2004, 85, 3747–3755. [Google Scholar] [CrossRef] [Scilit]
- Mordecai, G.J.; Wilfert, L.; Martin, S.J.; Jones, I.M.; Schroeder, D.C. Diversity in a honey bee pathogen: First report of a third master variant of the Deformed Wing Virus quasispecies. ISME J. 2016, 10, 1264–1273. [Google Scholar] [CrossRef] [Scilit]
- Lanzi, G.; de Miranda, J.R.; Boniotti, M.B.; Cameron, C.E.; Lavazza, A.; Capucci, L.; Camazine, S.M.; Rossi, C. Molecular and biological characterization of Deformed Wing Virus of honeybees (Apis mellifera L.). J. Virol. 2006, 80, 4998–5009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujiyuki, T.; Takeuchi, H.; Ono, M.; Ohka, S.; Sasaki, T.; Nomoto, A.; Kubo, T. Novel insect picorna-like virus identified in the brains of aggressive worker honeybees. J. Virol. 2004, 78, 1093–1100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McMahon, D.P.; Natsopoulou, M.E.; Doublet, V.; Fürst, M.; Weging, S.; Brown, M.J.F.; Gogol-Döring, A.; Paxton, R.J. Elevated virulence of an emerging viral genotype as a driver of honeybee loss. Proc. Biol. Sci. 2016, 283, 20160811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brasesco, C.; Quintana, S.; Di Gerónimo, V.; García, M.L.G.; Sguazza, G.; Bravi, M.E.; Fargnoli, L.; Reynaldi, F.J.; Eguaras, M.; Maggi, M. Deformed wing virus type a and b in managed honeybee colonies of Argentina. Bull. Entomol. Res. 2021, 111, 100–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salazar, A.; Ochoa-Corona, F.M.; Talley, J.L.; Noden, B.H. Recombinase polymerase amplification (RPA) with lateral flow detection for three Anaplasma species of importance to livestock health. Sci. Rep. 2021, 11, 15962. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Sui, X.; Ma, Y.; Li, M.; Zhang, X.; Fei, D.; Ma, M. Real-time reverse transcription recombinase polymerase amplification for rapid detection of murine hepatitis virus. Front. Microbiol. 2022, 13, 1067694. [Google Scholar] [CrossRef] [Scilit]
- Davi, S.D.; Kissenkötter, J.; Faye, M.; Böhlken-Fascher, S.; Stahl-Hennig, C.; Faye, O.; Faye, O.; Sall, A.A.; Weidmann, M.; Ademowo, O.G. Recombinase polymerase amplification assay for rapid detection of Monkeypox virus. Diagn. Microbiol. Infect. Dis. 2019, 95, 41–45. [Google Scholar] [CrossRef] [Scilit]
- Pang, Y.; Cong, F.; Zhang, X.; Li, H.; Chang, Y.F.; Xie, Q.; Lin, W. A recombinase polymerase amplification-based assay for rapid detection of Chlamydia psittaci. Poult. Sci. 2021, 100, 585–591. [Google Scholar] [CrossRef] [Scilit]
- Pickar-Oliver, A.; Gersbach, C.A. The next generation of CRISPR–Cas technologies and applications. Nat. Rev. Mol. Cell Biol. 2019, 20, 490–507. [Google Scholar] [CrossRef] [Scilit]
- Nidhi, S.; Anand, U.; Oleksak, P.; Tripathi, P.; Lal, J.A.; Thomas, G.; Kuca, K.; Tripathi, V. Novel CRISPR-Cas Systems: An Updated Review of the Current Achievements, Applications, and Future Research Perspectives. Int. J. Mol. Sci. 2021, 22, 3327. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Li, H.; Kou, Z.; Ren, F.; Jin, Y.; Yang, L.; Dong, X.; Yang, M.; Zhao, J.; Liu, H.; et al. Highly sensitive and specific detection of hepatitis B virus DNA and drug resistance mutations utilizing the PCR-based CRISPR-Cas13a system. Clin. Microbiol. Infect. 2021, 27, 443–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Wang, X.; Yu, Y.; Cao, S.; Liu, J.; Zhao, P.; Li, J.; Zhang, X.; Li, X.; Zhang, N.; et al. Establishment and application of a CRISPR-Cas12a-based RPA-LFS and fluorescence for the detection of Trichomonas vaginalis. Parasit. Vectors 2022, 15, 350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aman, R.; Mahas, A.; Marsic, T.; Hassan, N.; Mahfouz, M.M. Efcient, rapid, and sensitive detection of plant RNA viruses with one-pot RT-RPA–CRISPR/Cas12a assay. Front. Microbiol. 2020, 11, 610872. [Google Scholar] [CrossRef] [Scilit]
- Paenkaew, S.; Jaito, N.; Pradit, W.; Chomdej, S.; Nganvongpanit, K.; Siengdee, P.; Buddhachat, K. RPA/CRISPR-cas12a as a specific, sensitive and rapid method for diagnosing Ehrlichia canis and Anaplasma platys in dogs in Thailand. Vet. Res. Commun. 2023, 30, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase polymerase amplifification for diagnostic applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef] [Scilit]
- Qi, Y.; Yin, Q.; Shao, Y.; Li, S.; Chen, H.; Shen, W.; Rao, J.; Li, J.; Li, X.; Sun, Y.; et al. Rapid and visual detection of Coxiella burnetii using recombinase polymerase amplifification combined with lateral flow strips. BioMed. Res. Int. 2018, 2018, 6417354. [Google Scholar] [CrossRef] [Scilit]
- Runckel, C.; Flenniken, M.L.; Engel, J.C.; Ruby, J.G.; Ganem, D.; Andino, R.; DeRisi, J.L. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE 2011, 6, e20656. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Li, Y.; Xue, Q.; Zhu, Z.; Zou, M.; Fang, F. A novel rapid visual detection assay for Toxoplasma gondii combining recombinase-aided amplification and lateral flow dipstick coupled with CRISPR-Cas13a fluorescence (RAA-Cas13a-LFD). Parasite 2022, 29, 21. [Google Scholar] [CrossRef] [Scilit]
- Martin, S.J.; Brettell, L.E. Deformed Wing Virus in Honeybees and Other Insects. Annu. Rev. Virol. 2019, 6, 49–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tehel, A.; Vu, Q.; Bigot, D.; Gogol-Döring, A.; Koch, P.; Jenkins, C.; Doublet, V.; Theodorou, P.; Paxton, R. The Two Prevalent Genotypes of an Emerging Infectious Disease, Deformed Wing Virus, Cause Equally Low Pupal Mortality and Equally High Wing Deformities in Host Honey Bees. Viruses 2019, 11, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gisder, S.; Genersch, E. Direct Evidence for Infection of Varroa destructor Mites with the Bee-Pathogenic Deformed Wing Virus Variant B—but Not Variant A—via Fluorescence-in situ-Hybridization Analysis. J. Virol. 2021, 95, e01786-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fürst, M.A.; McMahon, D.P.; Osborne, J.L.; Paxton, R.J.; Brown, M.J. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature 2014, 506, 364–366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Domingo, E.; García-Crespo, C.; Lobo-Vega, R.; Perales, C. Mutation Rates, Mutation Frequencies, and Proofreading-Repair Activities in RNA Virus Genetics. Viruses 2021, 13, 1882. [Google Scholar] [CrossRef] [Scilit]
- Domingo, E.; Sheldon, J.; Perales, C. Viral quasispecies evolution. Microbiol. Mol. Biol. Rev. 2012, 76, 159–216. [Google Scholar] [CrossRef] [Scilit]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef] [Scilit]
- Jirawannaporn, S.; Limothai, U.; Tachaboon, S.; Dinhuzen, J.; Kiatamornrak, P.; Chaisuriyong, W.; Bhumitrakul, J.; Mayuramart, O.; Payungporn, S.; Srisawat, N. Rapid and sensitive point-of-care detection of Leptospira by RPA-CRISPR/Cas12a targeting lipL32. PLoS Negl. Trop. Dis. 2022, 16, e0010112. [Google Scholar] [CrossRef] [Scilit]
- Highfield, A.C.; El Nagar, A.; Mackinder, L.C.; Noël, L.M.; Hall, M.J.; Martin, S.J.; Schroeder, D.C. Deformed wing virus implicated in overwintering honeybee colony losses. Appl. Environ. Microbiol. 2009, 75, 7212–7220. [Google Scholar] [CrossRef] [Scilit]
- Nazzi, F.; Brown, S.P.; Annoscia, D.; Del Piccolo, F.; Di Prisco, G.; Varricchio, P.; Della Vedova, G.; Cattonaro, F.; Caprio, E.; Pennacchio, F. Synergistic parasite-pathogen interactions mediated by host immunity can drive the collapse of honeybee colonies. PLoS Pathog. 2012, 8, e1002735. [Google Scholar] [CrossRef] [Scilit]
- Di Prisco, G.; Annoscia, D.; Margiotta, M.; Ferrara, R.; Varricchio, P.; Zanni, V.; Caprio, E.; Nazzi, F.; Pennacchio, F. A mutualistic symbiosis between a parasitic mite and a pathogenic virus undermines honey bee immunity and health. Proc. Natl. Acad. Sci. USA 2016, 113, 3203–3208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, N.; Li, C.; Hu, T.; Li, J.; Zhou, H.; Ji, J.; Wu, J.; Kang, W.; Holmes, E.C.; Shi, W.; et al. Nationwide genomic surveillance reveals the prevalence and evolution of honeybee viruses in China. Microbiome 2023, 11, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Name | Sequence (5′–3′) | Amplicon Size (bp) |
|---|---|---|
| DWV-RPA-R | GATTTRTCCTGATCCGTGAATTCCATCTTATAT | |
| DWV-RPA-F1 | TAAAGACGAAATGAAGCGAGTAATGTGGAC | 353 |
| DWV-RPA-F2 | AAATGAAGCGAGTAATGTGGACCATGGC | 342 |
| DWV-RPA-F3 | ACCGAGTACCTTGTGGAATTCCATCAG | 307 |
| crRNA A1 | ATCTCATGTTATCGCTAACATTCATGAATCTACAAGAGTAGAAATTcCCTATAGTGAGTCGTATTAatttc | |
| crRNA A2 | ATCCAAAGGCAAATCAGTAATACCATCTACAAGAGTAGAAATTcCCTATAGTGAGTCGTATTAatttc | |
| crRNA B1 | ATCCAAAGGCAAATCAGTAATACCATCTACAAGAGTAGAAATTcCCTATAGTGAGTCGTATTAatttc | |
| crRNA B2 | ATCACCGTAACAAACTAGCACGACATGTCTAATCTACAAGAGTAGAAATTcCCTATAGTGAGTCGTATTAatttc | |
| DWV-FBD-ssDNA reporter | FAM-TTATT- BHQ | |
| DWV-LFD-ssDNA reporter | FAM-TTTTTTATTTTTT-Biotin | |
| DWV-A-RT-qPCR-F | GCGTGTTGCAACTCGCTTC | 211 |
| DWV-A-RT-qPCR-R | TGCCTGCACCGGATTCGATAAT | |
| DWV-B-RT-qPCR-F | GCAAGTTGGAGATAATTGTA | 116 |
| DWV-B-RT-qPCR-F | CGATACTTACATTCTTCAAGAT |
| Sample ID | Sample Type | Assay Results | |||
|---|---|---|---|---|---|
| RT–qPCR | RPA–CRISPR–Cas12a–LFD | ||||
| Type A or B | Ct | crRNA A1 | crRNA B1 | ||
| 1 | Bee larvae (3-day-old) | negative | negative | − | − |
| 2 | Bee larvae (3-day-old) | A | 28.963 | +(2/3) | − |
| 3 | Bee larvae (3-day-old) | A | 31.631 | + | − |
| 4 | Bee larvae (3-day-old) | B | 34.123 | − | + (1/3) |
| 5 | Bee larvae (5-day-old) | negative | negative | − | − |
| 6 | Bee larvae (5-day-old) | negative | negative | − | − |
| 7 | Bee larvae (5-day-old) | A | 26.347 | + | − |
| 8 | Bee larvae (5-day-old) | negative | negative | − | − |
| 9 | Bee larvae (7-day-old) | A | 27.933 | +(1/3) | − |
| 10 | Bee larvae (7-day-old) | negative | negative | − | − |
| 11 | Bee larvae (7-day-old) | A | 22.283 | + | − |
| 12 | Bee larvae (7-day-old) | A | 31.711 | +(1/3) | − |
| 13 | Bee larvae (9-day-old) | A | 20.028 | + | − |
| 14 | Bee larvae (9-day-old) | A | 23.672 | + | − |
| 15 | Bee larvae (9-day-old) | B | 29.431 | − | + |
| 16 | Bee larvae (9-day-old) | negative | negative | − | − |
| 17 | Pupae (Varroa-exposed) | A | 25.707 | + | − |
| 18 | Pupae (Varroa-exposed) | A | 17.373 | + | − |
| 19 | Pupae (Varroa-exposed) | A | 21.670 | + | − |
| 20 | Pupae (Varroa-exposed) | B | 23.824 | − | + |
| 21 | Pupae (Varroa-nonexposed) | A | 31.507 | + | − |
| 22 | Pupae (Varroa-nonexposed) | negative | negative | − | − |
| 23 | Pupae (Varroa-nonexposed) | A | 33.868 | + | − |
| 24 | Pupae (Varroa-nonexposed) | negative | negative | − | − |
| 25 | Bee (newly emerged) | A | 34.523 | + | − |
| 26 | Bee (newly emerged) | A | 21.639 | + | − |
| 27 | Bee (newly emerged) | negative | negative | − | − |
| 28 | Bee (newly emerged) | B | 30.706 | − | + |
| 29 | Worker bee (asymptomatic) | negative | negative | − | − |
| 30 | Worker bee (asymptomatic) | A | 28.416 | + | − |
| 31 | Worker bee (asymptomatic) | A | 30.933 | + | − |
| 32 | Worker bee (asymptomatic) | A | 28.215 | + | − |
| 33 | Worker bee (symptomatic) | A | 16.338 | + | − |
| 34 | Worker bee (symptomatic) | B | 24.949 | − | + |
| 35 | Worker bee (symptomatic) | A | 23.794 | + | − |
| 36 | Worker bee (symptomatic) | A | 20.347 | + | − |
| RT–qPCR | CR | ||||
|---|---|---|---|---|---|
| Positive | Negative | Total | |||
| RPA–CRISPR– Cas12a–LFD | Positive | 22 | 0 | 22 | 88.88% |
| Negative | 4 | 10 | 14 | ||
| Total | 26 | 10 | 36 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, Y.; Fei, D.; Li, M.; Ma, Y.; Ma, M. Establishment and Application of CRISPR–Cas12a-Based Recombinase Polymerase Amplification and a Lateral Flow Dipstick and Fluorescence for the Detection and Distinction of Deformed Wing Virus Types A and B. Viruses 2023, 15, 2041. https://doi.org/10.3390/v15102041
Xiao Y, Fei D, Li M, Ma Y, Ma M. Establishment and Application of CRISPR–Cas12a-Based Recombinase Polymerase Amplification and a Lateral Flow Dipstick and Fluorescence for the Detection and Distinction of Deformed Wing Virus Types A and B. Viruses. 2023; 15(10):2041. https://doi.org/10.3390/v15102041
Chicago/Turabian StyleXiao, Yuting, Dongliang Fei, Ming Li, Yueyu Ma, and Mingxiao Ma. 2023. "Establishment and Application of CRISPR–Cas12a-Based Recombinase Polymerase Amplification and a Lateral Flow Dipstick and Fluorescence for the Detection and Distinction of Deformed Wing Virus Types A and B" Viruses 15, no. 10: 2041. https://doi.org/10.3390/v15102041
APA StyleXiao, Y., Fei, D., Li, M., Ma, Y., & Ma, M. (2023). Establishment and Application of CRISPR–Cas12a-Based Recombinase Polymerase Amplification and a Lateral Flow Dipstick and Fluorescence for the Detection and Distinction of Deformed Wing Virus Types A and B. Viruses, 15(10), 2041. https://doi.org/10.3390/v15102041

