Non-Nucleoside Inhibitors Decrease Foot-and-Mouth Disease Virus Replication by Blocking the Viral 3Dpol
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virtual Screening of Small Molecules
2.2. Sources and Preparations of Chemicals
2.3. Cells and Viruses
2.4. Cytotoxicity Assay
2.5. Antiviral Activity Assay
2.6. Immunoperoxidase Monolayer Assay (IPMA)
2.7. Real-Time RT-PCR Assay
2.8. Cell-Based 3Dpol Inhibition Assay
2.9. Cell-Based FMDV 3Cpro Inhibition Assay
3. Results
3.1. Virtual Screening of Small Molecules
3.2. Dose–Response Analysis on the Cell-Based Antiviral Activity of Small Molecules
3.3. Functional Interference on FMDV 3Dpol, but Not 3Cpro, by the Candidate Compounds
3.4. Inhibition of FMDV Replication by Small Compounds
3.5. The Predicted Interaction of the Small Compounds and the Catalytic Active Sites of FMDV 3Dpol
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jamal, S.M.; Belsham, G.J. Foot-and-mouth disease: Past, present and future. Vet. Res. 2013, 44, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belsham, G.J. Towards improvements in foot-and-mouth disease vaccine performance. Acta Vet. Scand. 2020, 62, 20. [Google Scholar] [CrossRef]
- Venkataraman, S.; Prasad, B.; Selvarajan, R. RNA dependent RNA polymerases: Insights from structure, function and evolution. Viruses 2018, 10, 76. [Google Scholar] [CrossRef] [Green Version]
- Ferrerorta, C.; arias, A.; escarmis, C.; Verdaguer, N. A comparison of viral RNA-dependent RNA polymerases. Curr. Opin. Struct. Biol. 2006, 16, 27–34. [Google Scholar] [CrossRef]
- Ferrer-Orta, C.; de la Higuera, I.; Caridi, F.; Sánchez-Aparicio, M.T.; Moreno, E.; Perales, C.; Singh, K.; Sarafianos, S.G.; Sobrino, F.; Domingo, E.; et al. Multifunctionality of a picornavirus polymerase domain: Nuclear localization signal and nucleotide recognition. J. Virol. 2015, 89, 6848–6859. [Google Scholar] [CrossRef] [Green Version]
- Ferrer-Orta, C.; Arias, A.; Perez-Luque, R.; Escarmís, C.; Domingo, E.; Verdaguer, N. Structure of foot-and-mouth disease virus RNA-dependent RNA polymerase and its complex with a template-primer RNA. J. Biol. Chem. 2004, 279, 47212–47221. [Google Scholar] [CrossRef] [Green Version]
- Kempf, B.J.; Peersen, O.B.; Barton, D.J. Poliovirus polymerase Leu420 facilitates RNA recombination and ribavirin resistance. J. Virol. 2016, 90, 8410–8421. [Google Scholar] [CrossRef] [Green Version]
- Sierra, M.; Airaksinen, A.; González-López, C.; Agudo, R.; Arias, A.; Domingo, E. Foot-and-mouth disease virus mutant with decreased sensitivity to ribavirin: Implications for error catastrophe. J. Virol. 2007, 81, 2012–2024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Young, K.-C. Identification of a ribavirin-resistant NS5B mutation of hepatitis C virus during ribavirin monotherapy. Hepatology 2003, 38, 869–878. [Google Scholar] [CrossRef] [PubMed]
- Agudo, R.; Ferrer-Orta, C.; Arias, A.; de la Higuera, I.; Perales, C.; Pérez-Luque, R.; Verdaguer, N.; Domingo, E. A Multi-step process of viral adaptation to a mutagenic nucleoside analogue by modulation of transition types leads to extinction-escape. PLoS Pathog. 2010, 6, e1001072. [Google Scholar] [CrossRef]
- Sakamoto, K.; Ohashi, S.; Yamazoe, R.; Takahashi, K.; Furuta, Y. The Inhibition of FMD Virus Excretion from the Infected Pigs by an Antiviral Agent T-1105; Report of the European Commission for the Control of Foot-and-mouth disease; Appendix 64; FAO: Paphos, Cyprus, 2006; pp. 418–423. [Google Scholar]
- Ohashi, S.; Sakamoto, K.; Fukai, K.; Morioka, K.; Yamazoe, R.; Takahashi, K.; Furuta, Y. An Antiviral Agent, T-1105 Prevents Virus Excretion from Pigs Infected with Porcinophilic Foot-And-Mouth Disease Virus. In The Global Control of FMD—Tools, Ideas and Ideals, 2008; Session of the Research Group of the Standing Technical Committee of the European Commission for the Control of Foot-and-Mouth Disease; Appendix 70; Food and Agricultural Organization of the United Nations: Rome, Italy, 2008; pp. 393–398. [Google Scholar]
- De Vleeschauwer, A.R.; Lefebvre, D.J.; Willems, T.; Paul, G.; Billiet, A.; Murao, L.E.; Neyts, J.; Goris, N.; De Clercq, K. A Refined guinea pig model of foot-and-mouth disease virus infection for assessing the efficacy of antiviral compounds. Transbound. Emerg. Dis. 2016, 63, e205–e212. [Google Scholar] [CrossRef]
- van der Linden, L.; Vives-Adrián, L.; Selisko, B.; Ferrer-Orta, C.; Liu, X.; Lanke, K.; Ulferts, R.; De Palma, A.M.; Tanchis, F.; Goris, N.; et al. The RNA template channel of the RNA-dependent RNA polymerase as a target for development of antiviral therapy of multiple genera within a virus family. PLoS Pathog. 2015, 11, e1004733. [Google Scholar] [CrossRef] [Green Version]
- Tian, L.; Qiang, T.; Liang, C.; Ren, X.; Jia, M.; Zhang, J.; Li, J.; Wan, M.; YuWen, X.; Li, H.; et al. RNA-dependent RNA polymerase (RdRp) inhibitors: The current landscape and repurposing for the COVID-19 pandemic. Eur. J. Med. Chem. 2021, 213, 113201. [Google Scholar] [CrossRef] [PubMed]
- Hardy, J.A.; Wells, J.A. Searching for new allosteric sites in enzymes. Curr. Opin. Struct. Biol. 2004, 14, 706–715. [Google Scholar] [CrossRef]
- Jin, Y.H.; Min, J.S.; Jeon, S.; Lee, J.; Kim, S.; Park, T.; Park, D.; Jang, M.S.; Park, C.M.; Song, J.H.; et al. Lycorine, a non-nucleoside RNA dependent RNA polymerase inhibitor, as potential treatment for emerging coronavirus infections. Phytomedicine 2021, 86, 153440. [Google Scholar] [CrossRef]
- Gharbi-Ayachi, A.; Santhanakrishnan, S.; Wong, Y.H.; Chan, K.W.K.; Tan, S.T.; Bates, R.W.; Vasudevan, S.G.; El Sahili, A.; Lescar, J. Non-nucleoside Inhibitors of Zika virus RNA-dependent RNA polymerase. J. Virol. 2020, 94. [Google Scholar] [CrossRef]
- Kim, Y.; Lovell, S.; Tiew, K.-C.; Mandadapu, S.R.; Alliston, K.R.; Battaile, K.P.; Groutas, W.C.; Chang, K.-O. Broad-spectrum antivirals against 3C or 3C-Like proteases of picornaviruses, noroviruses, and coronaviruses. J. Virol. 2012, 86, 11754–11762. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Semkum, P.; Kaewborisuth, C.; Thangthamniyom, N.; Theerawatanasirikul, S.; Lekcharoensuk, C.; Hansoongnern, P.; Ramasoota, P.; Lekcharoensuk, P. A novel plasmid DNA-based foot and mouth disease virus minigenome for intracytoplasmic mRNA production. Viruses 2021, 13, 1047. [Google Scholar] [CrossRef] [PubMed]
- Chen, V.B.; Arendall, W.B.; Headd, J.J.; Keedy, D.A.; Immormino, R.M.; Kapral, G.J.; Murray, L.W.; Richardson, J.S.; Richardson, D.C. MolProbity: All-atom structure validation for macromolecular crystallography. Acta Crystallogr. Sect. D Biol. Crystallogr. 2010, 66, 12–21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benkert, P.; Biasini, M.; Schwede, T. Toward the estimation of the absolute quality of individual protein structure models. Bioinformatics 2011, 27, 343–350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramachandran, P.; Varoquaux, G. Mayavi: 3D visualization of scientific data. Comput. Sci. Eng. 2011, 13, 40–51. [Google Scholar] [CrossRef] [Green Version]
- Dallakyan, S.; Olson, A.J. Small-molecule library screening by docking with PyRx. Methods Mol. Biol. 2015, 1263, 243–250. [Google Scholar] [PubMed]
- O’Boyle, N.M.; Banck, M.; James, C.A.; Morley, C.; Vandermeersch, T.; Hutchison, G.R. Open Babel: An open chemical toolbox. J. Cheminform. 2011, 3, 33. [Google Scholar] [CrossRef] [Green Version]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2009, 31, 455–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Theerawatanasirikul, S.; Thangthamniyom, N.; Kuo, C.J.; Semkum, P.; Phecharat, N.; Chankeeree, P.; Lekcharoensuk, P. Natural phytochemicals, luteolin and isoginkgetin, inhibit 3C protease and infection of FMDV, in silico and in vitro. Viruses 2021, 13, 2118. [Google Scholar] [CrossRef] [PubMed]
- Lekcharoensuk, P.; Wiriyarat, W.; Petcharat, N.; Lekcharoensuk, C.; Auewarakul, P.; Richt, J.A. Cloned cDNA of A/swine/Iowa/15/1930 internal genes as a candidate backbone for reverse genetics vaccine against influenza A viruses. Vaccine 2012, 30, 1453–1459. [Google Scholar] [CrossRef] [Green Version]
- Stirling, D.R.; Carpenter, A.E.; Cimini, B.A. CellProfiler Analyst 3.0: Accessible data exploration and machine learning for image analysis. Bioinformatics 2021, 37, 3992–3994. [Google Scholar] [CrossRef] [PubMed]
- Gu, C.; Zheng, C.; Shi, L.; Zhang, Q.; Li, Y.; Lu, B.; Xiong, Y.; Qu, S.; Shao, J.; Chang, H. Plus- and minus-stranded foot-and-mouth disease virus RNA quantified simultaneously using a novel real-time RT-PCR. Virus Genes 2007, 34, 289–298. [Google Scholar] [CrossRef]
- Van Der Linden, L.; Ulferts, R.; Nabuurs, S.B.; Kusov, Y.; Liu, H.; George, S.; Lacroix, C.; Goris, N.; Lefebvre, D.; Lanke, K.H.W.; et al. Application of a cell-based protease assay for testing inhibitors of picornavirus 3C proteases. Antiviral Res. 2014, 103, 17–24. [Google Scholar] [CrossRef]
- Srisombundit, V.; Tungthumniyom, N.; Linchongsubongkoch, W.; Lekcharoensuk, C.; Sariya, L.; Ramasoota, P.; Lekcharoensuk, P. Development of an inactivated 3Cpro-3ABC (mu3ABC) ELISA to differentiate cattle infected with foot and mouth disease virus from vaccinated cattle. J. Virol. Methods 2013, 188, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Arias, A.; Arnold, J.J.; Sierra, M.; Smidansky, E.D.; Domingo, E.; Cameron, C.E. Determinants of RNA-dependent RNA polymerase (in)fidelity revealed by kinetic analysis of the polymerase encoded by a foot-and-mouth disease virus mutant with reduced sensitivity to ribavirin. J. Virol. 2008, 82, 12346–12355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, J.; Zhang, Y.; Wang, M.; Liu, Q.; Lei, X.; Wu, M.; Guo, S.; Yi, D.; Li, Q.; Ma, L.; et al. Quinoline and quinazoline derivatives inhibit viral RNA synthesis by SARS-CoV-2 RdRp. ACS Infect. Dis. 2021, 7, 1535–1544. [Google Scholar] [CrossRef] [PubMed]
- Patent: Al-Olaby, R.; Azzazy, H.; Balhorn, R. Ligands that Target Hepatitis C Virus E2 Protein. U.S. Patent 20160361311A1, 15 December 2016. [Google Scholar]
- Chapman, H.D.; Jeffers, T.K.; Williams, R.B. Forty years of monensin for the control of coccidiosis in poultry. Poult. Sci. 2010, 89, 1788–1801. [Google Scholar] [CrossRef] [PubMed]
- Dyall, J.; Coleman, C.M.; Hart, B.J.; Venkataraman, T.; Holbrook, M.R.; Kindrachuk, J.; Johnson, R.F.; Olinger, G.G.J.; Jahrling, P.B.; Laidlaw, M.; et al. Repurposing of clinically developed drugs for treatment of Middle East respiratory syndrome coronavirus infection. Antimicrob. Agents Chemother. 2014, 58, 4885–4893. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Svenningsen, E.B.; Thyrsted, J.; Blay-Cadanet, J.; Liu, H.; Lin, S.; Moyano-Villameriel, J.; Olagnier, D.; Idorn, M.; Paludan, S.R.; Holm, C.K.; et al. Ionophore antibiotic X-206 is a potent inhibitor of SARS-CoV-2 infection in vitro. Antiviral Res. 2021, 185, 104988. [Google Scholar] [CrossRef]
- Jang, Y.; Shin, J.S.; Yoon, Y.-S.; Go, Y.Y.; Lee, H.W.; Kwon, O.S.; Park, S.; Park, M.-S.; Kim, M. Salinomycin inhibits influenza virus infection by disrupting endosomal acidification and viral matrix protein 2 function. J. Virol. 2018, 92, 1–20. [Google Scholar] [CrossRef] [Green Version]
- Irurzun, A.; Perez, L.; Carrasco, L. Involvement of membrane traffic in the replication of poliovirus genomes: Effects of brefeldin A. Virology 1992, 191, 166–175. [Google Scholar] [CrossRef]
- Sander, T.; Freyss, J.; von Korff, M.; Rufener, C. DataWarrior: An open-source program for chemistry aware data visualization and analysis. J. Chem. Inf. Model. 2015, 55, 460–473. [Google Scholar] [CrossRef]
Primers | Sequence (5′–3) | cDNA Derived from | Tm (°C) | References |
---|---|---|---|---|
FMDV-5′UTRF | CTGTTGCTTCGTAGCGGAGC | 5′UTR | 66.3 | [20] |
FMDV-5′UTRR | TCGCGTGTTACCTCGGGGTACC | 66.3 | ||
FMDV-3DF | TAGAGCAGTAGATGTTG | Negative strand | 58 | In this study |
FMDV-3DR | ATGAACATCATGTTTGAGG | 59 |
Compounds | Cytotoxicity CC50 (µM) | Antiviral Activity | SI (CC50/EC50) | |
---|---|---|---|---|
EC50 (µM) | EC90 (µM) | |||
NSC217697 6,6′-methylene bis(2,2,4-trimethyl-1,2-dihydroquinoline) PubChem ID 99342 | >100 | 0.78 ± 0.10 | 9.52 ± 0.18 | >128.20 |
NSC670283 2,2′-spirobi [3,6,7,8-tetrahydro-1H-cyclopenta[g]naphthalene]-5,5′-dione PubChem ID 382634 | >100 | 3.38 ± 1.02 | 30.45 ± 0.25 | >28.65 |
NSC292567 Pandavir/Nigericin PubChem ID 4490 | 49.91 ± 1.70 | 0.42 ± 0.08 | 3.85 ± 0.34 | >118.83 |
NSC65850 sodium;5-[[4-[4-[[2,4-diamino-3-[[4-(carboxymethoxy)phenyl]diazenyl]-5-methylphenyl]diazenyl]phenyl]phenyl]diazenyl]-2-hydroxybenzoic acid PubChem ID 135422251 | >100 | 2.73 ± 0.48 | 7.19 ± 0.10 | >36.63 |
Ribavirin PubChem ID 37542 | >100 | 42.89 ± 0.42 | 393.60 ± 2.56 | >2.33 |
Rupintrivir PubChem ID 6440352 | >100 | 2.02 ± 0.30 | 12.05 ± 1.6 | >49.50 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Theerawatanasirikul, S.; Semkum, P.; Lueangaramkul, V.; Chankeeree, P.; Thangthamniyom, N.; Lekcharoensuk, P. Non-Nucleoside Inhibitors Decrease Foot-and-Mouth Disease Virus Replication by Blocking the Viral 3Dpol. Viruses 2023, 15, 124. https://doi.org/10.3390/v15010124
Theerawatanasirikul S, Semkum P, Lueangaramkul V, Chankeeree P, Thangthamniyom N, Lekcharoensuk P. Non-Nucleoside Inhibitors Decrease Foot-and-Mouth Disease Virus Replication by Blocking the Viral 3Dpol. Viruses. 2023; 15(1):124. https://doi.org/10.3390/v15010124
Chicago/Turabian StyleTheerawatanasirikul, Sirin, Ploypailin Semkum, Varanya Lueangaramkul, Penpitcha Chankeeree, Nattarat Thangthamniyom, and Porntippa Lekcharoensuk. 2023. "Non-Nucleoside Inhibitors Decrease Foot-and-Mouth Disease Virus Replication by Blocking the Viral 3Dpol" Viruses 15, no. 1: 124. https://doi.org/10.3390/v15010124
APA StyleTheerawatanasirikul, S., Semkum, P., Lueangaramkul, V., Chankeeree, P., Thangthamniyom, N., & Lekcharoensuk, P. (2023). Non-Nucleoside Inhibitors Decrease Foot-and-Mouth Disease Virus Replication by Blocking the Viral 3Dpol. Viruses, 15(1), 124. https://doi.org/10.3390/v15010124