A Syntenin Inhibitor Blocks Endosomal Entry of SARS-CoV-2 and a Panel of RNA Viruses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Expression and Purification of Proteins
2.2. Peptide Synthesis
2.3. Peptide Cleavage and Purification
2.4. Fluorescence Polarization
2.5. Cells and Viruses
2.6. Viral Infections
2.7. Time of Addition Assay
2.8. Cell Viability Assay and qPCR
2.9. Immunofluorescence Stainings
3. Results
3.1. Syntenin Binds with Low Affinity to the SARS-CoV-2 E Protein and the SARS-CoV-2 NSP11
3.2. KSL-128114 Inhibits Viral Infection
3.3. KSL-128114 Blocks SARS-CoV-2 Entry into Cells
3.4. The Syntenin Inhibitor Can Be Used as a Broad Spectrum Antiviral Agent
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jackson, C.B.; Farzan, M.; Chen, B.; Choe, H. Mechanisms of SARS-CoV-2 entry into cells. Nat. Rev. Mol. Cell Biol. 2022, 23, 3–20. [Google Scholar] [CrossRef] [PubMed]
- Javier, R.T.; Rice, A.P. Emerging theme: Cellular pdz proteins as common targets of pathogenic viruses. J. Virol. 2011, 85, 11544–11556. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ivarsson, Y. Plasticity of pdz domains in ligand recognition and signaling. FEBS Lett. 2012, 586, 2638–2647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Temkin, P.; Lauffer, B.; Jager, S.; Cimermancic, P.; Krogan, N.J.; von Zastrow, M. Snx27 mediates retromer tubule entry and endosome-to-plasma membrane trafficking of signalling receptors. Nat. Cell Biol. 2011, 13, 715–721. [Google Scholar] [CrossRef] [Green Version]
- Kliche, J.; Kuss, H.; Ali, M.; Ivarsson, Y. Cytoplasmic short linear motifs in ace2 and integrin beta3 link SARS-CoV-2 host cell receptors to mediators of endocytosis and autophagy. Sci. Signal. 2021, 14, eabf1117. [Google Scholar] [CrossRef]
- Yang, B.; Jia, Y.; Meng, Y.; Xue, Y.; Liu, K.; Li, Y.; Liu, S.; Li, X.; Cui, K.; Shang, L.; et al. Snx27 suppresses SARS-CoV-2 infection by inhibiting viral lysosome/late endosome entry. Proc. Natl. Acad. Sci. USA 2022, 119, e2117576119. [Google Scholar] [CrossRef]
- Grootjans, J.J.; Zimmermann, P.; Reekmans, G.; Smets, A.; Degeest, G.; Durr, J.; David, G. Syntenin, a pdz protein that binds syndecan cytoplasmic domains. Proc. Natl. Acad. Sci. USA 1997, 94, 13683–13688. [Google Scholar] [CrossRef] [Green Version]
- Zimmermann, P.; Zhang, Z.; Degeest, G.; Mortier, E.; Leenaerts, I.; Coomans, C.; Schulz, J.; N’Kuli, F.; Courtoy, P.J.; David, G. Syndecan recycling [corrected] is controlled by syntenin-pip2 interaction and arf6. Dev. Cell 2005, 9, 377–388. [Google Scholar] [CrossRef] [Green Version]
- Latysheva, N.; Muratov, G.; Rajesh, S.; Padgett, M.; Hotchin, N.A.; Overduin, M.; Berditchevski, F. Syntenin-1 is a new component of tetraspanin-enriched microdomains: Mechanisms and consequences of the interaction of syntenin-1 with cd63. Mol. Cell Biol. 2006, 26, 7707–7718. [Google Scholar] [CrossRef] [Green Version]
- Baietti, M.F.; Zhang, Z.; Mortier, E.; Melchior, A.; Degeest, G.; Geeraerts, A.; Ivarsson, Y.; Depoortere, F.; Coomans, C.; Vermeiren, E.; et al. Syndecan-syntenin-alix regulates the biogenesis of exosomes. Nat. Cell Biol. 2012, 14, 677–685. [Google Scholar] [CrossRef]
- Bermejo-Jambrina, M.; Eder, J.; Kaptein, T.M.; van Hamme, J.L.; Helgers, L.C.; Vlaming, K.E.; Brouwer, P.J.M.; van Nuenen, A.C.; Spaargaren, M.; de Bree, G.J.; et al. Infection and transmission of SARS-CoV-2 depend on heparan sulfate proteoglycans. EMBO J. 2021, 40, e106765. [Google Scholar] [CrossRef] [PubMed]
- Hudak, A.; Letoha, A.; Szilak, L.; Letoha, T. Contribution of syndecans to the cellular entry of SARS-CoV-2. Int. J. Mol. Sci. 2021, 22, 5336. [Google Scholar] [CrossRef] [PubMed]
- Hudak, A.; Veres, G.; Letoha, A.; Szilak, L.; Letoha, T. Syndecan-4 is a key facilitator of the SARS-CoV-2 delta variant’s superior transmission. Int. J. Mol. Sci. 2022, 23, 796. [Google Scholar] [CrossRef] [PubMed]
- Jimenez-Guardeno, J.M.; Nieto-Torres, J.L.; DeDiego, M.L.; Regla-Nava, J.A.; Fernandez-Delgado, R.; Castano-Rodriguez, C.; Enjuanes, L. The pdz-binding motif of severe acute respiratory syndrome coronavirus envelope protein is a determinant of viral pathogenesis. PLoS Pathog 2014, 10, e1004320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chai, J.; Cai, Y.; Pang, C.; Wang, L.; McSweeney, S.; Shanklin, J.; Liu, Q. Structural basis for SARS-CoV-2 envelope protein recognition of human cell junction protein pals1. Nat. Commun. 2021, 12, 3433. [Google Scholar] [CrossRef] [PubMed]
- Shepley-McTaggart, A.; Sagum, C.A.; Oliva, I.; Rybakovsky, E.; DiGuilio, K.; Liang, J.; Bedford, M.T.; Cassel, J.; Sudol, M.; Mullin, J.M.; et al. Sars-cov-2 envelope (e) protein interacts with pdz-domain-2 of host tight junction protein zo1. PLoS ONE 2021, 16, e0251955. [Google Scholar]
- Peng, R.; Wu, L.A.; Wang, Q.; Qi, J.; Gao, G.F. Cell entry by SARS-CoV-2. Trends Biochem. Sci. 2021, 46, 848–860. [Google Scholar] [CrossRef]
- Yan, W.; Zheng, Y.; Zeng, X.; He, B.; Cheng, W. Structural biology of SARS-CoV-2: Open the door for novel therapies. Signal Transduct. Target. Ther. 2022, 7, 26. [Google Scholar] [CrossRef]
- Caillet-Saguy, C.; Durbesson, F.; Rezelj, V.V.; Gogl, G.; Tran, Q.D.; Twizere, J.C.; Vignuzzi, M.; Vincentelli, R.; Wolff, N. Host pdz-containing proteins targeted by SARS-CoV-2. FEBS J. 2021, 288, 5148–5162. [Google Scholar] [CrossRef]
- Siu, K.L.; Yuen, K.S.; Castano-Rodriguez, C.; Ye, Z.W.; Yeung, M.L.; Fung, S.Y.; Yuan, S.; Chan, C.P.; Yuen, K.Y.; Enjuanes, L.; et al. Severe acute respiratory syndrome coronavirus orf3a protein activates the nlrp3 inflammasome by promoting traf3-dependent ubiquitination of asc. FASEB J. 2019, 33, 8865–8877. [Google Scholar] [CrossRef]
- Ren, Y.; Shu, T.; Wu, D.; Mu, J.; Wang, C.; Huang, M.; Han, Y.; Zhang, X.Y.; Zhou, W.; Qiu, Y.; et al. The orf3a protein of SARS-CoV-2 induces apoptosis in cells. Cell. Mol. Immunol. 2020, 17, 881–883. [Google Scholar] [CrossRef] [PubMed]
- Gadhave, K.; Kumar, P.; Kumar, A.; Bhardwaj, T.; Garg, N.; Giri, R. Conformational dynamics of 13 amino acids long nsp11 of SARS-CoV-2 under membrane mimetics and different solvent conditions. Microb. Pathog. 2021, 158, 105041. [Google Scholar] [CrossRef] [PubMed]
- Haugaard-Kedström, L.M.; Clemmensen, L.S.; Sereikaite, V.; Jin, Z.; Fernandes, E.F.A.; Wind, B.; Abalde-Gil, F.; Daberger, J.; Vistrup-Parry, M.; Aguilar-Morante, D.; et al. A high-affinity peptide ligand targeting syntenin inhibits glioblastoma. J. Med. Chem. 2021, 64, 1423–1434. [Google Scholar] [CrossRef]
- Smit, J.M.; Moesker, B.; Rodenhuis-Zybert, I.; Wilschut, J. Flavivirus cell entry and membrane fusion. Viruses 2011, 3, 160–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Asghar, N.; Lee, Y.P.; Nilsson, E.; Lindqvist, R.; Melik, W.; Kroger, A.; Overby, A.K.; Johansson, M. The role of the poly(a) tract in the replication and virulence of tick-borne encephalitis virus. Sci. Rep. 2016, 6, 39265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niedrig, M.; Klockmann, U.; Lang, W.; Roeder, J.; Burk, S.; Modrow, S.; Pauli, G. Monoclonal antibodies directed against tick-borne encephalitis virus with neutralizing activity in vivo. Acta Virol. 1994, 38, 141–149. [Google Scholar]
- Tombuloglu, H.; Sabit, H.; Al-Suhaimi, E.; Al Jindan, R.; Alkharsah, K.R. Development of multiplex real-time rt-pcr assay for the detection of SARS-CoV-2. PLoS ONE 2021, 16, e0250942. [Google Scholar] [CrossRef]
- Schwaiger, M.; Cassinotti, P. Development of a quantitative real-time rt-pcr assay with internal control for the laboratory detection of tick borne encephalitis virus (tbev) rna. J. Clin. Virol. 2003, 27, 136–145. [Google Scholar] [CrossRef]
- Lanciotti, R.S.; Kerst, A.J.; Nasci, R.S.; Godsey, M.S.; Mitchell, C.J.; Savage, H.M.; Komar, N.; Panella, N.A.; Allen, B.C.; Volpe, K.E.; et al. Rapid detection of west nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a taqman reverse transcriptase-pcr assay. J. Clin. Microbiol. 2000, 38, 4066–4071. [Google Scholar] [CrossRef] [Green Version]
- Conceicao, T.M.; Da Poian, A.T.; Sorgine, M.H. A real-time pcr procedure for detection of dengue virus serotypes 1, 2, and 3, and their quantitation in clinical and laboratory samples. J. Virol. Methods 2010, 163, 1–9. [Google Scholar] [CrossRef]
- Nyamwaya, D.K.; Otiende, M.; Omuoyo, D.O.; Githinji, G.; Karanja, H.K.; Gitonga, J.N.; de Laurent, Z.R.; Otieno, J.R.; Sang, R.; Kamau, E.; et al. Endemic chikungunya fever in kenyan children: A prospective cohort study. BMC Infect. Dis. 2021, 21, 186. [Google Scholar] [CrossRef] [PubMed]
- Mandala, V.S.; McKay, M.J.; Shcherbakov, A.A.; Dregni, A.J.; Kolocouris, A.; Hong, M. Structure and drug binding of the SARS-CoV-2 envelope protein transmembrane domain in lipid bilayers. Nat. Struct. Mol. Biol. 2020, 27, 1202–1208. [Google Scholar] [CrossRef] [PubMed]
- Daniloski, Z.; Jordan, T.X.; Wessels, H.H.; Hoagland, D.A.; Kasela, S.; Legut, M.; Maniatis, S.; Mimitou, E.P.; Lu, L.; Geller, E.; et al. Identification of required host factors for SARS-CoV-2 infection in human cells. Cell 2021, 184, 92–105 e116. [Google Scholar] [CrossRef] [PubMed]
- Ou, T.; Mou, H.; Zhang, L.; Ojha, A.; Choe, H.; Farzan, M. Hydroxychloroquine-mediated inhibition of SARS-CoV-2 entry is attenuated by tmprss2. PLoS Pathog. 2021, 17, e1009212. [Google Scholar] [CrossRef] [PubMed]
- Glowacka, I.; Bertram, S.; Muller, M.A.; Allen, P.; Soilleux, E.; Pfefferle, S.; Steffen, I.; Tsegaye, T.S.; He, Y.; Gnirss, K.; et al. Evidence that tmprss2 activates the severe acute respiratory syndrome coronavirus spike protein for membrane fusion and reduces viral control by the humoral immune response. J. Virol. 2011, 85, 4122–4134. [Google Scholar] [CrossRef] [Green Version]
- Rolain, J.M.; Colson, P.; Raoult, D. Recycling of chloroquine and its hydroxyl analogue to face bacterial, fungal and viral infections in the 21st century. Int. J. Antimicrob. Agents 2007, 30, 297–308. [Google Scholar] [CrossRef]
- Hoffmann, M.; Mosbauer, K.; Hofmann-Winkler, H.; Kaul, A.; Kleine-Weber, H.; Kruger, N.; Gassen, N.C.; Muller, M.A.; Drosten, C.; Pohlmann, S. Chloroquine does not inhibit infection of human lung cells with SARS-CoV-2. Nature 2020, 585, 588–590. [Google Scholar] [CrossRef]
- Tomoda, T.; Kim, J.H.; Zhan, C.; Hatten, M.E. Role of unc51.1 and its binding partners in cns axon outgrowth. Genes Dev. 2004, 18, 541–558. [Google Scholar] [CrossRef] [Green Version]
- Imjeti, N.S.; Menck, K.; Egea-Jimenez, A.L.; Lecointre, C.; Lembo, F.; Bouguenina, H.; Badache, A.; Ghossoub, R.; David, G.; Roche, S.; et al. Syntenin mediates src function in exosomal cell-to-cell communication. Proc. Natl. Acad. Sci. USA 2017, 114, 12495–12500. [Google Scholar] [CrossRef] [Green Version]
- Grassel, L.; Fast, L.A.; Scheffer, K.D.; Boukhallouk, F.; Spoden, G.A.; Tenzer, S.; Boller, K.; Bago, R.; Rajesh, S.; Overduin, M.; et al. The cd63-syntenin-1 complex controls post-endocytic trafficking of oncogenic human papillomaviruses. Sci. Rep. 2016, 6, 32337. [Google Scholar] [CrossRef] [Green Version]
- Earnest, J.T.; Hantak, M.P.; Li, K.; McCray, P.B., Jr.; Perlman, S.; Gallagher, T. The tetraspanin cd9 facilitates mers-coronavirus entry by scaffolding host cell receptors and proteases. PLoS Pathog. 2017, 13, e1006546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ooi, Y.S.; Stiles, K.M.; Liu, C.Y.; Taylor, G.M.; Kielian, M. Genome-wide rnai screen identifies novel host proteins required for alphavirus entry. PLoS Pathog. 2013, 9, e1003835. [Google Scholar] [CrossRef] [PubMed]
- Stiles, K.M.; Kielian, M. Role of tspan9 in alphavirus entry and early endosomes. J. Virol. 2016, 90, 4289–4297. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmed, W.; Neelakanta, G.; Sultana, H. Tetraspanins as potential therapeutic candidates for targeting flaviviruses. Front. Immunol. 2021, 12, 630571. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, M.N.; Sukumaran, B.; Pal, U.; Agaisse, H.; Murray, J.L.; Hodge, T.W.; Fikrig, E. Rab 5 is required for the cellular entry of dengue and west nile viruses. J. Virol. 2007, 81, 4881–4885. [Google Scholar] [CrossRef]
Target | Sequence | Reference |
---|---|---|
SARS-CoV-2 forward primer | GTCATGTGTGGCGGTTCACT | [27] |
SARS-CoV-2 reverse primer | CAACACTATTAGCATAAGCAGTTGT | [27] |
SARS-CoV-2 probe | FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ | [27] |
TBEV forward primer | GGGCGGTTCTTGTTCTCC | [28] |
TBEV reverse primer | ACACATCACCTCCTTGTCAGACT | [28] |
TBEV probe | FAM-TGAGCCACCATCACCCAGACACA-BHQ | [28] |
WNV forward primer | TCAGCGATCTCTCCACCAAAG | [29] |
WNV reverse primer | GGGTCAGCACGTTTGTCATTG | [29] |
WNV probe | FAM-TGCCCGACCATGGGAGAAGCTC-BHQ | [29] |
DENV forward primer | ATTAGAGAGCAGATCTCTG | [30] |
DENV reverse primer | TGACACGCGGTTTC | [30] |
DENV probe | FAM-TCAATATGCTGAAACGCG-BHQ | [30] |
CHIKV forward primer | AAAGGGCAAACTCAGCTTCAC | [31] |
CHIKV reverse primer | GCCTGGGCTCATCGTTATTC | [31] |
CHIKV probe | FAM-CGCTGTGATACAGTGGTTTCGTGTG-TAMRA | [31] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lindqvist, R.; Benz, C.; Sereikaite, V.; Maassen, L.; Laursen, L.; Jemth, P.; Strømgaard, K.; Ivarsson, Y.; Överby, A.K. A Syntenin Inhibitor Blocks Endosomal Entry of SARS-CoV-2 and a Panel of RNA Viruses. Viruses 2022, 14, 2202. https://doi.org/10.3390/v14102202
Lindqvist R, Benz C, Sereikaite V, Maassen L, Laursen L, Jemth P, Strømgaard K, Ivarsson Y, Överby AK. A Syntenin Inhibitor Blocks Endosomal Entry of SARS-CoV-2 and a Panel of RNA Viruses. Viruses. 2022; 14(10):2202. https://doi.org/10.3390/v14102202
Chicago/Turabian StyleLindqvist, Richard, Caroline Benz, Vita Sereikaite, Lars Maassen, Louise Laursen, Per Jemth, Kristian Strømgaard, Ylva Ivarsson, and Anna K. Överby. 2022. "A Syntenin Inhibitor Blocks Endosomal Entry of SARS-CoV-2 and a Panel of RNA Viruses" Viruses 14, no. 10: 2202. https://doi.org/10.3390/v14102202
APA StyleLindqvist, R., Benz, C., Sereikaite, V., Maassen, L., Laursen, L., Jemth, P., Strømgaard, K., Ivarsson, Y., & Överby, A. K. (2022). A Syntenin Inhibitor Blocks Endosomal Entry of SARS-CoV-2 and a Panel of RNA Viruses. Viruses, 14(10), 2202. https://doi.org/10.3390/v14102202