High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA
Abstract
1. Introduction
2. Materials and Methods
2.1. Survey and Sample Collection
2.2. Small RNA Sequencing from the Samples
2.3. Detection of Viruses in HTS Data
2.4. Detection of Viruses by Conventional Methods
2.5. Detection of DNA Viruses by Rolling Circle Amplification and HTS
2.6. Construction of Consensus Viral Genome Sequence and Coverage Maps
2.7. Phylogenetic Analysis
3. Results
3.1. Symptomatology
3.2. Virus Detection by Metagenomics
3.3. Virus Prevalence and Distribution among Different Cucurbits
3.4. Phylogenetic Relationships of Cucurbit Chlorotic Yellows Virus and Cucurbit Yellow Stunting Disorder Virus Isolates from Georgia
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Georgia Farm Gate Value Report 2019. Available online: https://caed.uga.edu/publications/georgia-agricultural-statistics.html (accessed on 24 April 2021).
- Srinivasan, R. Whitefly-Transmitted Viruses Pose Problems in Vegetables. Vegetable and Specialty Crops News Magazine. 24 June 2019. Available online: https://vscnews.com/whitefly-transmitted-viruses-pose-problems-in-vegetables/ (accessed on 23 February 2021).
- Larsen, R.; Kmiecik, K. First report of cucurbit leaf crumple virus in snap bean in Georgia. In Proceedings of the 2010 American Phytopathological Society Annual Meeting, Charlotte, NC, USA, 7–11 August 2010; p. S68. [Google Scholar]
- Gadhave, K.R.; Dutta, B.; Coolong, T.; Sparks, A.N.; Adkins, S.; Srinivasan, R. First report of cucurbit yellow stunting disorder virus in cucurbits in Georgia, United States. Plant Health Prog. 2018, 19, 9–10. [Google Scholar] [CrossRef] [Scilit]
- Gautam, S. The Role of Bemisia tabaci in the Transmission of Vegetable Viruses in the Farmscape of Georgia. Doctor of Philosophy; University of Georgia: Athens, GA, USA, 2019. [Google Scholar]
- Kavalappara, S.R.; Milner, H.; Sparks, A.N.; McGregor, C.; Wintermantel, W.M.; Bag, S. First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia. Plant Dis. 2021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bag, S.; Tabassum, A.; Brock, J.; Dutta, B. First report of tobacco streak virus infecting summer squash in Georgia, USA. Plant Dis. 2019, 103, 1443. [Google Scholar] [CrossRef] [Scilit]
- Baker, C.; Webb, S.; Adkins, S. Squash Vein Yellowing Virus, Causal Agent of Watermelon Vine Decline in Florida. Fla. Dept. of Agric. & Consumer Services. Plant Pathology Circular No. 407. June/July 2008. Available online: https://www.fdacs.gov/content/download/11413/file/pp407.pdf (accessed on 24 February 2021).
- Bag, S.; Al Rwahnih, M.; Li, A.; Gonzalez, A.; Rowhani, A.; Uyemoto, J.K.; Sudarshana, M.R. Detection of a new luteovirus in imported nectarine trees: A case study to propose adoption of metagenomics in post-entry quarantine. Phytopathology 2015, 105, 840–846. [Google Scholar] [CrossRef] [Scilit]
- Barba, M.; Czosnek, H.; Hadidi, A. Historical perspective, development and applications of next-generation sequencing in plant virology. Viruses 2014, 6, 106–136. [Google Scholar] [CrossRef] [Scilit]
- Boonham, N.; Kreuze, J.; Winter, S.; van der Vlugt, R.; Bergervoet, J.; Tomlinson, J.; Mumford, R. Methods in virus diagnostics: From ELISA to next generation sequencing. Virus Res. 2014, 186, 20–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kreuze, J.F.; Klein, I.S.; Lazaro, M.U.; Chuquiyuri, W.J.C.; Morgan, G.L.; Mejía, P.G.; Ghislain, M.; Valkonen, J.P. RNA silencing-mediated resistance to a crinivirus (Closteroviridae) in cultivated sweet potato (Ipomoea batatas L.) and development of sweet potato virus disease following co-infection with a potyvirus. Mol. Plant. Pathol. 2008, 9, 589–598. [Google Scholar] [CrossRef] [Scilit]
- Kreuze, J. siRNA Deep Sequencing and Assembly: Piecing together Viral Infections. In Detection and Diagnostics of Plant Pathogens; Gullino, M.L., Bonants, P.J.M., Eds.; Springer: New York, NY, USA, 2014; Volume 5, pp. 21–38. [Google Scholar] [CrossRef] [Scilit]
- Massart, S.; Chiumenti, M.; De Jonghe, K.; Glover, R.; Haegeman, A.; Koloniuk, I.; Komínek, P.; Kreuze, J.; Kutnjak, D.; Lotos, L.; et al. Virus detection by high-throughput sequencing of small RNAs: Large-scale performance testing of sequence analysis strategies. Phytopathology 2019, 109, 488–497. [Google Scholar] [CrossRef] [Scilit]
- Pooggin, M.M. Small RNA-omics for plant virus identification, virome reconstruction, and antiviral defense characterization. Front. Microbiol. 2018, 9, 2779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roossinck, M.J.; Martin, D.P.; Roumagnac, P. Plant virus metagenomics: Advances in virus discovery. Phytopathology 2015, 105, 716–727. [Google Scholar] [CrossRef] [Scilit]
- Wu, Q.; Ding, S.W.; Zhang, Y.; Zhu, S. Identification of viruses and viroids by next-generation sequencing and homology-dependent and homology-independent algorithms. Ann. Rev. Phytopathol. 2015, 53, 425–444. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Gao, S.; Hernandez, A.G.; Wechter, W.P.; Fei, Z.; Ling, K.S. Deep sequencing of small RNAs in tomato for virus and viroid identification and strain differentiation. PLoS ONE 2012, 7, e37127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Villamor, D.E.V.; Ho, T.; Al Rwahnih, T.M.; Martin, R.R.; Tzanetakis, I.E. High throughput sequencing for plant virus detection and discovery. Phytopathology 2019, 109, 716–725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mlotshwa, S.; Pruss, G.; Vance, V. Small RNAs in viral infection and host defense. Trends Plant Sci. 2008, 13, 375–382. [Google Scholar] [CrossRef] [Scilit]
- Ding, S.W. RNA-based antiviral immunity. Nat. Rev. Immunol. 2010, 10, 632–644. [Google Scholar] [CrossRef] [Scilit]
- Ding, S.W.; Lu, R. Virus-derived siRNAs and piRNAs in immunity and pathogenesis. Curr. Opin. Virol. 2011, 1, 533–544. [Google Scholar] [CrossRef] [Scilit]
- Bornancini, V.A.; Irazoqui, J.M.; Flores, C.R.; Vaghi Medina, C.G.; Amadio, A.F.; López Lambertini, P.M. Reconstruction and characterization of full-length begomovirus and alphasatellite genomes infecting pepper through metagenomics. Viruses 2020, 12, 202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vučurović, A.; Kutnjak, D.; Mehle, N.; Stanković, I.; Pecman, A.; Bulajić, A.; Krstić, B.; Ravnikar, M. Detection of four new tomato viruses in Serbia using post-hoc high-throughput sequencing analysis of samples from a large-scale field survey. Plant Dis. 2021. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Y.; Wu, S.; Bai, Y.; Sun, H.; Jiao, C.; Guo, S.; Zhao, K.; Blanca, J.; Zhang, Z.; Huang, S. Cucurbit Genomics Database (CuGenDB): A central portal for comparative and functional genomics of cucurbit crops. Nucleic Acids Res. 2019, 47, D1128–D1136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pecman, A.; Kutnjak, D.; Gutiérrez-Aguirre, I.; Adams, I.; Fox, A.; Boonham, N.; Ravnikar, M. Next generation sequencing for detection and discovery of plant viruses and viroids: Comparison of two approaches. Front. Microbiol. 2017, 8, 1998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Mondal, S.; Hladky, L.L.; Fashing, P.L.; McCreight, J.D.; Turini, T.A.; Wintermantel, W.M. First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California. Plant Dis. 2021. [CrossRef] [Scilit]
- Haible, D.; Kober, S.; Jeske, H. Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. J. Virol. Methods 2006, 135, 9–16. [Google Scholar] [CrossRef] [Scilit]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saitou, N.; Nei, M. The neighbour-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [Scilit]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef] [Scilit]
- Rosen, R.; Kanakala, S.; Kliot, A.; Pakkianathan, B.C.; Farich, B.A.; Santana-Magal, N.; Elimelech, M.; Kontsedalov, S.; Lebedev, G.; Cilia, M.; et al. Persistent, circulative transmission of begomoviruses by whitefly vectors. Curr. Opin. Vir. 2015, 15, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guzman, P.; Sudarshana, M.R.; Seo, Y.S.; Rojas, M.R.; Natwick, E.; Turini, T.; Mayberry, K.; Gilbertson, R.L. A new bipartite geminivirus (Begomovirus) causing leaf curl and crumpling in cucurbits in the Imperial Valley of California. Plant Dis. 2000, 84, 488. [Google Scholar] [CrossRef] [Scilit]
- Adkins, S.; Polston, J.E.; Turechek, W.W. Cucurbit leaf crumple virus identified in common bean in Florida. Plant Dis. 2009, 93, 320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keinath, A.P.; Ling, K.; Adkins, S.T.; Hasegawa, D.K.; Simmons, A.M.; Hoak, S.; Mellinger, C.; Kousik, C.S. First report of cucurbit leaf crumple virus infecting three cucurbit crops in South Carolina. Plant Health Prog. 2018, 19, 322–323. [Google Scholar] [CrossRef] [Scilit]
- Webb, S.E.; Liburd, O.E.; Nyoike, T.W.; Akad, F.; Polston, J.E. Whitefly-Transmitted Cucurbit Leaf Crumple Virus in Florida. University of Florida, Institute of Food and Agricultural Sciences, Extension Publication ENY-477. March 2007. Available online: https://edis.ifas.ufl.edu/pdffiles/IN/IN71600.pdf (accessed on 28 February 2021).
- Brown, J.K.; Idris, A.M.; Alteri, C.; Stenger, D.C. Emergence of a new cucurbit-infecting begomovirus species capable of forming viable reassortants with related viruses in the squash leaf curl virus cluster. Phytopathology 2002, 92, 734–742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hagen, C.; Rojas, M.R.; Sudarshana, M.R.; Xoconostle-Cazares, B.; Natwick, E.; Turini, T.A.; Gilbertson, R.L. Biology and molecular characterization of cucurbit leaf crumple virus, an emergent cucurbit-infecting begomovirus in the Imperial Valley of California. Plant Dis. 2008, 92, 781–793. [Google Scholar] [CrossRef] [Scilit]
- Hassan, A.A.; Duffus, J.E. A review of a yellowing and stunting disorder of cucurbits in the United Arab Emirates. Emir. J. Agric. Sci. 1991, 2, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Wintermantel, W.M. Emergence of greenhouse whitefly (Trialeurodes vaporariorum) transmitted criniviruses as threats to vegetable and fruit production in North America. APSnet Features. 2004. Available online: https://www.apsnet.org/edcenter/apsnetfeatures/Pages/GreenhouseWhitefly.aspx (accessed on 23 February 2021).
- Wintermantel, W.M.; Gilbertson, R.L.; Natwick, E.T.; McCreight, J.D. Emergence and epidemiology of cucurbit yellow stunting disorder virus in the American Desert Southwest, and development of host plant resistance in melon. Virus Res. 2017, 241, 213–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kao, J.; Jia, L.; Tian, T.; Rubio, L.; Falk, B.W. First report of cucurbit yellow stunting disorder virus (genus Crinivirus) in North America. Plant Dis. 2000, 84, 101. [Google Scholar] [CrossRef] [Scilit]
- Kuo, Y.W.; Rojas, M.R.; Gilbertson, R.L.; Wintermantel, W.M. First report of cucurbit yellow stunting disorder virus in California and Arizona, in association with cucurbit leaf crumple virus and squash leaf curl virus. Plant Dis. 2007, 91, 330. [Google Scholar] [CrossRef] [Scilit]
- Brown, J.K.; Guerrero, J.C.; Matheron, M.; Olsen, M.; Idris, A.M. Widespread outbreak of cucurbit yellow stunting disorder virus in melon, squash, and watermelon crops in the Sonoran Desert of Arizona and Sonora, Mexico. Plant Dis. 2007, 91, 773. [Google Scholar] [CrossRef] [Scilit]
- Polston, J.E.; Hladky, L.L.; Akad, F.; Wintermantel, W.M. First report of cucurbit yellow stunting disorder virus in cucurbits in Florida. Plant Dis. 2008, 92, 1251. [Google Scholar] [CrossRef] [Scilit]
- Wintermantel, W.M.; Hladky, L.L.; Cortez, A.A.; Natwick, E.T. A new expanded host range of cucurbit yellow stunting disorder virus includes three agricultural crops. Plant Dis. 2009, 93, 685–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gyoutoku, Y.; Okazaki, S.; Furuta, A.; Etoh, T.; Mizobe, M.; Kuno, K.; Hayashida, S.; Okuda, M. Chlorotic yellows disease of melon caused by cucurbit chlorotic yellows virus, a new crinivirus. Jpn. J. Phytopathol. 2009, 75, 109–111. [Google Scholar] [CrossRef] [Scilit]
- Bananej, K.; Menzel, W.; Vahdat, A.; Winter, S. First report of cucurbit chlorotic yellows virus infecting cucumber, melon, and squash in Iran. Plant Dis. 2013, 97, 1005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamed, K.; Menzel, W.; Dafalla, G.; Gadelseed, A.M.A.; Winter, S. First report of cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Dis. 2011, 95, 1321. [Google Scholar] [CrossRef] [Scilit]
- Abrahamian, P.E.; Sobh, H.; Abou-Jawdah, Y. First report of cucurbit chlorotic yellows virus on cucumber in Lebanon. Plant Dis. 2012, 96, 1704. [Google Scholar] [CrossRef] [Scilit]
- Orfanidou, C.; Maliogka, V.I.; Katis, N.I. First report of cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis. 2014, 98, 1446. [Google Scholar] [CrossRef] [Scilit]
- Wintermantel, W.M.; Hladky, L.L.J.; Fashing, P.; Ando, K.; McCreight, J.D. First report of cucurbit chlorotic yellows virus infecting melon in the New World. Plant Dis. 2019, 103, 778. [Google Scholar] [CrossRef] [Scilit]
- Okuda, M.; Okazaki, S.; Yamasaki, S.; Okuda, S.; Sugiyama, M. Host range and complete genome sequence of cucurbit chlorotic yellows virus, a new member of the genus crinivirus. Phytopathology 2010, 100, 560–566. [Google Scholar] [CrossRef] [Scilit]
- Orfanidou, C.G.; Baltzi, A.; Dimou, N.A.; Katis, N.I.; Maliogka, V.I. Cucurbit chlorotic yellows virus: Insights into its natural host range, genetic variability, and transmission parameters. Plant Dis. 2017, 101, 2053–2058. [Google Scholar] [CrossRef] [Scilit]
- Tzanetakis, I.E.; Martin, R.R.; Wintermantel, W.M. Epidemiology of criniviruses: An emerging problem in world agriculture. Front. Microbiol. 2013, 4, 119. [Google Scholar] [CrossRef] [Scilit]
- Lu, S.H.; Li, J.J.; Wang, X.L.; Song, D.Y.; Bai, R.E.; Shi, Y.; Gu, Q.S.; Kuo, Y.W.; Falk, B.W.; Yan, F.M. A semipersistent plant virus differentially manipulates feeding behaviors of different sexes and biotypes of its whitefly vector. Viruses 2017, 9, 4. [Google Scholar] [CrossRef] [Scilit]
- Lu, S.H.; Chen, M.S.; Li, J.J.; Shi, Y.; Gu, Q.S.; Yan, F.M. Changes in Bemisia tabaci feeding behaviors caused directly and indirectly by cucurbit chlorotic yellows virus. Virol. J. 2019, 16, 106. [Google Scholar] [CrossRef] [Scilit]
- Orfanidou, C.; Katsiani, A.; Papayiannis, L.; Katis, N.I.; Maliogka, V.I. Interplay of cucurbit yellow stunting disorder virus with cucurbit chlorotic yellows virus and transmission dynamics by Bemisia tabaci MED. Plant Dis. 2021, 105, 416–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gadhave, K.R.; Gautam, S.; Dutta, B.; Coolong, T.; Adkins, S.; Srinivasan, R. Low frequency of horizontal and vertical transmission of cucurbit leaf crumple virus in whitefly Bemisia tabaci Gennadius. Phytopathology 2020, 110, 1235–1241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gautam, S.; Gadhave, K.R.; Buck, J.W.; Dutta, B.; Coolong, T.; Adkins, S.; Srinivasan, R. Virus-virus interactions in a plant host and in a hemipteran vector: Implications for vector fitness and virus epidemics. Virus Res. 2020, 286. [Google Scholar] [CrossRef] [Scilit]
- Da Palma, T.; Doonan, B.P.; Trager, N.M.; Kasman, L.M. A systematic approach to virus–virus interactions. Virus Res. 2010, 149, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wintermantel, W.M.; Cortez, A.A.; Anchieta, A.G.; Gulati-Sakhuja, A.; Hladky, L.L. Co-infection by two criniviruses alters accumulation of each virus in a host-specific manner and influences efficiency of virus transmission. Phytopathology 2008, 98, 1340–1345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Domingo-Calap, M.L.; Moreno, A.B.; Pendon, J.A.D.; Moreno, A.; Fereres, A.; Lopez-Moya, J.J. Assessing the impact on virus transmission and insect vector behavior of a viral mixed infection in melon. Phytopathology 2020, 110, 174–186. [Google Scholar] [CrossRef] [Scilit]
- Marco, C.F.; Aranda, M.A. Genetic diversity of a natural population of cucurbit yellow stunting disorder virus. J. Gen. Virol. 2005, 86, 815–822. [Google Scholar] [CrossRef] [Scilit]
- Akhter, M.S.; Bhor, S.A.; Hlalele, N.; Nao, M.; Sekine, K.-T.; Yaeno, T.; Yamaoka, N.; Nishiguchi, M.; Gubba, A.; Kobayashi, K. Review of beet pseudoyellows virus genome structure built the consensus genome organization of cucumber strains and highlighted the unique feature of strawberry strain. Virus Genes 2016, 52, 828–834. [Google Scholar] [CrossRef] [Scilit]
- Orílio, A.F.; Navas-Castillo, J. The complete nucleotide sequence of the RNA2 of the crinivirus tomato infectious chlorosis virus: Isolates from North America and Europe are essentially identical. Arch. Virol. 2009, 154, 683–687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rubio, L.; Abou-Jawdah, Y.; Lin, H.X.; Falk, B.W. Geographically distant isolates of the crinivirus cucurbit yellow stunting disorder virus show very low genetic diversity in the coat protein gene. J. Gen. Virol. 2001, 82, 929–933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- MacDiarmid, R.; Rodoni, B.; Melcher, U.; Ochoa-Corona, F.; Roossinck, M. Biosecurity implications of new technology and discovery in plant virus research. PLOS Pathog. 2013, 9, e1003337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bejerman, N.; Debat, H.; Dietzgen, R.G. The plant negative-sense RNA virosphere: Virus discovery through new eyes. Front. Microbiol. 2020, 11, 2308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adkins, S.; Webb, S.E.; Achor, D.; Roberts, P.D.; Baker, C.A. Identification and characterization of a novel whitefly-transmitted member of the family potyviridae isolated from cucurbits in Florida. Phytopathology 2007, 97, 145–154. [Google Scholar] [CrossRef] [Scilit]
- Roberts, P.; Muchovej, R.M.; Gilreath, P.; McAvoy, G.; Baker, C.A.; Adkins, S. Mature Vine Decline and Fruit Rot of Watermelon. In Citrus and Vegetable Magazine; 30 December 2004. Available online: https://www.ars.usda.gov/research/publications/publication/?seqNo115=173881 (accessed on 24 February 2021).
- Kousik, C.S.; Adkins, S. Detection of cucurbit yellow stunting disorder virus infecting watermelon in South Carolina. Plant Health Prog. 2020, 21, 133–134. [Google Scholar] [CrossRef] [Scilit]
- Batuman, O.; Natwick, E.T.; Wintermantel, W.M.; Tian, T.; McCreight, J.D.; Hladky, L.L.; Gilbertson, R.L. First report of an ipomovirus infecting cucurbits in the Imperial Valley of California. Plant Dis. 2015, 99, 1042. [Google Scholar] [CrossRef] [Scilit]






| Primer Name | Sequence 5′-3′ | Tm (°C) | Amplicon Size | References |
|---|---|---|---|---|
| CCYV_RDRP_1515 | CTCCGAGTAGATCATCCCAAATC | 62 | 953 | [6] |
| CCYV_RDRP_1515 | TCACCAGAAACTCCACAATCTC | |||
| CYSDV_RDRP_1542 | TTTCGGCTCCCAGAGTTAATG | 62 | 492 | [28] |
| CYSDV_RDRP_1542 | CGATCTCCGTGGTGTGATAAG | |||
| CuLCRV CP 259 F | TCAAAGGTTTCCCGCTCTGC | 58 | 588 | (This study) |
| CuLCRV CP 846 R | TCCTGCTTCCTGGTGGTTGTAG |
| Virus a | Cantaloupe | Cucumber | Squash | Zucchini | Total Number of Samples | ||||
|---|---|---|---|---|---|---|---|---|---|
| 2019 | 2020 | 2019 | 2020 | 2019 | 2020 | 2020 | |||
| Single infections | CuLCrV | 6 (29) | 21 (53) | 36 (53) | 66 (69) | 195 (92) | 274 (85) | 52 (87) | 650 (76) |
| CCYV | 21 (100) | 20 (50) | 53 (78) | 71 (74) | 38 (18) | 263 (82) | 23 (38) | 489 (60) | |
| CYSDV | 12 (57) | 36 (90) | 6 (9) | 78 (81) | 31 (15) | 161 (50) | 25 (42) | 349 (43) | |
| Mixed infections | CuLCrV + CCYV | 6 (29) | 10 (25) | 31 (46) | 43 (45) | 41 (19) | 219 (68) | 13 (22) | 363 (44) |
| CuLCrV + CySDV | 4 (19) | 14 (35) | 2 (3) | 49 (51) | 27 (13) | 154 (48) | 18 (30) | 268 (33) | |
| CYSDV + CCYV | 12 (57) | 18 (45) | 6 (9) | 58 (60) | 9 (0.5) | 128 (40) | 17 (28) | 248 (30) | |
| CuLCrV + CYSDV + CCYV | 4 (19) | 9 (23) | 2 (3) | 32 (33) | 9 (0.5) | 122 (38) | 13 (21) | 191 (23) | |
| Total number of samples tested | 21 | 40 | 68 | 96 | 213 | 322 | 60 | 820 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kavalappara, S.R.; Milner, H.; Konakalla, N.C.; Morgan, K.; Sparks, A.N.; McGregor, C.; Culbreath, A.K.; Wintermantel, W.M.; Bag, S. High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA. Viruses 2021, 13, 988. https://doi.org/10.3390/v13060988
Kavalappara SR, Milner H, Konakalla NC, Morgan K, Sparks AN, McGregor C, Culbreath AK, Wintermantel WM, Bag S. High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA. Viruses. 2021; 13(6):988. https://doi.org/10.3390/v13060988
Chicago/Turabian StyleKavalappara, Saritha Raman, Hayley Milner, Naga Charan Konakalla, Kaelyn Morgan, Alton N. Sparks, Cecilia McGregor, Albert K. Culbreath, William M. Wintermantel, and Sudeep Bag. 2021. "High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA" Viruses 13, no. 6: 988. https://doi.org/10.3390/v13060988
APA StyleKavalappara, S. R., Milner, H., Konakalla, N. C., Morgan, K., Sparks, A. N., McGregor, C., Culbreath, A. K., Wintermantel, W. M., & Bag, S. (2021). High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA. Viruses, 13(6), 988. https://doi.org/10.3390/v13060988

