Role of Vesicle-Associated Membrane Protein-Associated Proteins (VAP) A and VAPB in Nuclear Egress of the Alphaherpesvirus Pseudorabies Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. CRISPR/Cas9-Based Gene Editing
2.3. Western Blot Analysis
2.4. Actin Staining
2.5. Growth Properties
2.6. Ultrastructural Analysis
3. Results
3.1. Generation of RK13-VAPB KO, RK13-VAPA KO and RK13-VAPA/B DKO Cell Lines
3.2. Characterization of RK13-VAPB KO, RK13-VAPA KO and RK13-VAPA/B DKO
3.3. Absence of VAPA, VAPB or Both Has No Major Impact on PrV Replication
3.4. Absence of VAPA or VAPB or Both Has No Significant Impact on PrV Nuclear Egress or Final Virion Maturation
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fields, B.K.D. Fields Virology; Wolters Kluwer Health: Philadelphia, PA, USA, 2007; Volume 1. [Google Scholar]
- Rothman, J.E.; Bursztyn-Pettegrew, H.; Fine, R.E. Transport of the membrane glycoprotein of vesicular stomatitis virus to the cell surface in two stages by clathrin-coated vesicles. J. Cell Biol. 1980, 86, 162–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tran, E.J.; Wente, S.R. Dynamic nuclear pore complexes: Life on the edge. Cell 2006, 125, 1041–1053. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McGeoch, D.J.; Rixon, F.J.; Davison, A.J. Topics in herpesvirus genomics and evolution. Virus Res. 2006, 117, 90–104. [Google Scholar] [CrossRef] [PubMed]
- Mettenleiter, T.C. Breaching the Barrier-The Nuclear Envelope in Virus Infection. J. Mol. Biol 2016, 428, 1949–1961. [Google Scholar] [CrossRef]
- Wild, P.; Senn, C.; Manera, C.L.; Sutter, E.; Schraner, E.M.; Tobler, K.; Ackermann, M.; Ziegler, U.; Lucas, M.S.; Kaech, A. Exploring the nuclear envelope of herpes simplex virus 1-infected cells by high-resolution microscopy. J. Virol. 2009, 83, 408–419. [Google Scholar] [CrossRef] [Green Version]
- Leuzinger, H.; Ziegler, U.; Schraner, E.M.; Fraefel, C.; Glauser, D.L.; Heid, I.; Ackermann, M.; Mueller, M.; Wild, P. Herpes simplex virus 1 envelopment follows two diverse pathways. J. Virol. 2005, 79, 13047–13059. [Google Scholar] [CrossRef] [Green Version]
- Mettenleiter, T.C. Herpesvirus assembly and egress. J. Virol. 2002, 76, 1537–1547. [Google Scholar] [CrossRef] [Green Version]
- Skepper, J.N.; Whiteley, A.; Browne, H.; Minson, A. Herpes simplex virus nucleocapsids mature to progeny virions by an envelopment --> deenvelopment --> reenvelopment pathway. J. Virol. 2001, 75, 5697–5702. [Google Scholar] [CrossRef] [Green Version]
- Mettenleiter, T.C.; Muller, F.; Granzow, H.; Klupp, B.G. The way out: What we know and do not know about herpesvirus nuclear egress. Cell. Microbiol. 2013, 15, 170–178. [Google Scholar] [CrossRef]
- Johnson, D.C.; Baines, J.D. Herpesviruses remodel host membranes for virus egress. Nat. Rev. Microbiol. 2011, 9, 382–394. [Google Scholar] [CrossRef]
- Mettenleiter, T.C.; Klupp, B.G.; Granzow, H. Herpesvirus assembly: An update. Virus Res. 2009, 143, 222–234. [Google Scholar] [CrossRef]
- Hollinshead, M.; Johns, H.L.; Sayers, C.L.; Gonzalez-Lopez, C.; Smith, G.L.; Elliott, G. Endocytic tubules regulated by Rab GTPases 5 and 11 are used for envelopment of herpes simplex virus. EMBO J. 2012, 31, 4204–4220. [Google Scholar] [CrossRef] [Green Version]
- Klupp, B.G.; Granzow, H.; Mettenleiter, T.C. Primary envelopment of pseudorabies virus at the nuclear membrane requires the UL34 gene product. J. Virol. 2000, 74, 10063–10073. [Google Scholar] [CrossRef] [Green Version]
- Passvogel, L.; Klupp, B.G.; Granzow, H.; Fuchs, W.; Mettenleiter, T.C. Functional characterization of nuclear trafficking signals in pseudorabies virus pUL31. J. Virol. 2015, 89, 2002–2012. [Google Scholar] [CrossRef] [Green Version]
- Funk, C.; Ott, M.; Raschbichler, V.; Nagel, C.H.; Binz, A.; Sodeik, B.; Bauerfeind, R.; Bailer, S.M. The Herpes Simplex Virus Protein pUL31 Escorts Nucleocapsids to Sites of Nuclear Egress, a Process Coordinated by Its N-Terminal Domain. PLoS Pathog. 2015, 11, e1004957. [Google Scholar] [CrossRef] [Green Version]
- Schmeiser, C.; Borst, E.; Sticht, H.; Marschall, M.; Milbradt, J. The cytomegalovirus egress proteins pUL50 and pUL53 are translocated to the nuclear envelope through two distinct modes of nuclear import. J. Gen. Virol. 2013, 94, 2056–2069. [Google Scholar] [CrossRef]
- Bigalke, J.M.; Heldwein, E.E. Nuclear Exodus: Herpesviruses Lead the Way. Annu. Rev. Virol. 2016, 3, 387–409. [Google Scholar] [CrossRef] [Green Version]
- Desai, P.J.; Pryce, E.N.; Henson, B.W.; Luitweiler, E.M.; Cothran, J. Reconstitution of the Kaposi’s sarcoma-associated herpesvirus nuclear egress complex and formation of nuclear membrane vesicles by coexpression of ORF67 and ORF69 gene products. J. Virol. 2012, 86, 594–598. [Google Scholar] [CrossRef] [Green Version]
- Klupp, B.G.; Granzow, H.; Fuchs, W.; Keil, G.M.; Finke, S.; Mettenleiter, T.C. Vesicle formation from the nuclear membrane is induced by coexpression of two conserved herpesvirus proteins. Proc. Natl. Acad. Sci. USA 2007, 104, 7241–7246. [Google Scholar] [CrossRef] [Green Version]
- Lorenz, M.; Vollmer, B.; Unsay, J.D.; Klupp, B.G.; Garcia-Saez, A.J.; Mettenleiter, T.C.; Antonin, W. A single herpesvirus protein can mediate vesicle formation in the nuclear envelope. J. Biol. Chem. 2015, 290, 6962–6974. [Google Scholar] [CrossRef] [Green Version]
- Bigalke, J.M.; Heuser, T.; Nicastro, D.; Heldwein, E.E. Membrane deformation and scission by the HSV-1 nuclear egress complex. Nat. Commun. 2014, 5, 4131. [Google Scholar] [CrossRef]
- Sehl, J.; Portner, S.; Klupp, B.G.; Granzow, H.; Franzke, K.; Teifke, J.P.; Mettenleiter, T.C. Roles of the different isoforms of the pseudorabies virus protein kinase pUS3 in nuclear egress. J. Virol. 2020. [Google Scholar] [CrossRef]
- Mou, F.; Wills, E.; Baines, J.D. Phosphorylation of the U(L)31 protein of herpes simplex virus 1 by the U(S)3-encoded kinase regulates localization of the nuclear envelopment complex and egress of nucleocapsids. J. Virol. 2009, 83, 5181–5191. [Google Scholar] [CrossRef] [Green Version]
- Reynolds, A.E.; Wills, E.G.; Roller, R.J.; Ryckman, B.J.; Baines, J.D. Ultrastructural localization of the herpes simplex virus type 1 UL31, UL34, and US3 proteins suggests specific roles in primary envelopment and egress of nucleocapsids. J. Virol. 2002, 76, 8939–8952. [Google Scholar] [CrossRef] [Green Version]
- Klupp, B.G.; Granzow, H.; Mettenleiter, T.C. Effect of the pseudorabies virus US3 protein on nuclear membrane localization of the UL34 protein and virus egress from the nucleus. J. Gen. Virol. 2001, 82, 2363–2371. [Google Scholar] [CrossRef] [Green Version]
- Wagenaar, F.; Pol, J.M.; Peeters, B.; Gielkens, A.L.; de Wind, N.; Kimman, T.G. The US3-encoded protein kinase from pseudorabies virus affects egress of virions from the nucleus. J. Gen. Virol. 1995, 76 Pt 7, 1851–1859. [Google Scholar] [CrossRef]
- Rothballer, A.; Schwartz, T.U.; Kutay, U. LINCing complex functions at the nuclear envelope: What the molecular architecture of the LINC complex can reveal about its function. Nucleus 2013, 4, 29–36. [Google Scholar] [CrossRef] [Green Version]
- Klupp, B.G.; Hellberg, T.; Granzow, H.; Franzke, K.; Dominguez Gonzalez, B.; Goodchild, R.E.; Mettenleiter, T.C. Integrity of the Linker of Nucleoskeleton and Cytoskeleton Is Required for Efficient Herpesvirus Nuclear Egress. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [Green Version]
- Holper, J.E.; Klupp, B.G.; Luxton, G.W.G.; Franzke, K.; Mettenleiter, T.C. Function of Torsin AAA+ ATPases in Pseudorabies Virus Nuclear Egress. Cells 2020, 9, 738. [Google Scholar] [CrossRef] [Green Version]
- Atai, N.A.; Ryan, S.D.; Kothary, R.; Breakefield, X.O.; Nery, F.C. Untethering the nuclear envelope and cytoskeleton: Biologically distinct dystonias arising from a common cellular dysfunction. Int. J. Cell Biol. 2012, 2012, 634214. [Google Scholar] [CrossRef] [Green Version]
- Nery, F.C.; Zeng, J.; Niland, B.P.; Hewett, J.; Farley, J.; Irimia, D.; Li, Y.; Wiche, G.; Sonnenberg, A.; Breakefield, X.O. TorsinA binds the KASH domain of nesprins and participates in linkage between nuclear envelope and cytoskeleton. J. Cell Sci. 2008, 121, 3476–3486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hirohata, Y.; Arii, J.; Liu, Z.; Shindo, K.; Oyama, M.; Kozuka-Hata, H.; Sagara, H.; Kato, A.; Kawaguchi, Y. Herpes Simplex Virus 1 Recruits CD98 Heavy Chain and beta1 Integrin to the Nuclear Membrane for Viral De-Envelopment. J. Virol. 2015, 89, 7799–7812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Farnsworth, A.; Wisner, T.W.; Webb, M.; Roller, R.; Cohen, G.; Eisenberg, R.; Johnson, D.C. Herpes simplex virus glycoproteins gB and gH function in fusion between the virion envelope and the outer nuclear membrane. Proc. Natl. Acad. Sci. USA 2007, 104, 10187–10192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vallbracht, M.; Backovic, M.; Klupp, B.G.; Rey, F.A.; Mettenleiter, T.C. Common characteristics and unique features: A comparison of the fusion machinery of the alphaherpesviruses Pseudorabies virus and Herpes simplex virus. Adv. Virus Res. 2019, 104, 225–281. [Google Scholar] [CrossRef]
- Klupp, B.; Altenschmidt, J.; Granzow, H.; Fuchs, W.; Mettenleiter, T.C. Glycoproteins required for entry are not necessary for egress of pseudorabies virus. J. Virol. 2008, 82, 6299–6309. [Google Scholar] [CrossRef] [Green Version]
- Lee, C.P.; Liu, P.T.; Kung, H.N.; Su, M.T.; Chua, H.H.; Chang, Y.H.; Chang, C.W.; Tsai, C.H.; Liu, F.T.; Chen, M.R. The ESCRT machinery is recruited by the viral BFRF1 protein to the nucleus-associated membrane for the maturation of Epstein-Barr Virus. PLoS Pathog. 2012, 8, e1002904. [Google Scholar] [CrossRef] [Green Version]
- Arii, J.; Watanabe, M.; Maeda, F.; Tokai-Nishizumi, N.; Chihara, T.; Miura, M.; Maruzuru, Y.; Koyanagi, N.; Kato, A.; Kawaguchi, Y. ESCRT-III mediates budding across the inner nuclear membrane and regulates its integrity. Nat. Commun. 2018, 9, 3379. [Google Scholar] [CrossRef] [Green Version]
- Pawliczek, T.; Crump, C.M. Herpes simplex virus type 1 production requires a functional ESCRT-III complex but is independent of TSG101 and ALIX expression. J. Virol. 2009, 83, 11254–11264. [Google Scholar] [CrossRef] [Green Version]
- Saiz-Ros, N.; Czapiewski, R.; Epifano, I.; Stevenson, A.; Swanson, S.K.; Dixon, C.R.; Zamora, D.B.; McElwee, M.; Vijayakrishnan, S.; Richardson, C.A.; et al. Host Vesicle Fusion Protein VAPB Contributes to the Nuclear Egress Stage of Herpes Simplex Virus Type-1 (HSV-1) Replication. Cells 2019, 8, 120. [Google Scholar] [CrossRef] [Green Version]
- Tran, D.; Chalhoub, A.; Schooley, A.; Zhang, W.; Ngsee, J.K. A mutation in VAPB that causes amyotrophic lateral sclerosis also causes a nuclear envelope defect. J. Cell Sci. 2012, 125, 2831–2836. [Google Scholar] [CrossRef] [Green Version]
- Lev, S.; Ben Halevy, D.; Peretti, D.; Dahan, N. The VAP protein family: From cellular functions to motor neuron disease. Trends Cell Biol. 2008, 18, 282–290. [Google Scholar] [CrossRef]
- Nishimura, Y.; Hayashi, M.; Inada, H.; Tanaka, T. Molecular cloning and characterization of mammalian homologues of vesicle-associated membrane protein-associated (VAMP-associated) proteins. Biochem. Biophys. Res. Commun. 1999, 254, 21–26. [Google Scholar] [CrossRef]
- Teuling, E.; Ahmed, S.; Haasdijk, E.; Demmers, J.; Steinmetz, M.O.; Akhmanova, A.; Jaarsma, D.; Hoogenraad, C.C. Motor neuron disease-associated mutant vesicle-associated membrane protein-associated protein (VAP) B recruits wild-type VAPs into endoplasmic reticulum-derived tubular aggregates. J. Neurosci. 2007, 27, 9801–9815. [Google Scholar] [CrossRef] [Green Version]
- McCune, B.T.; Tang, W.; Lu, J.; Eaglesham, J.B.; Thorne, L.; Mayer, A.E.; Condiff, E.; Nice, T.J.; Goodfellow, I.; Krezel, A.M.; et al. Noroviruses Co-opt the Function of Host Proteins VAPA and VAPB for Replication via a Phenylalanine-Phenylalanine-Acidic-Tract-Motif Mimic in Nonstructural Viral Protein NS1/2. mBio 2017, 8. [Google Scholar] [CrossRef] [Green Version]
- Hamamoto, I.; Nishimura, Y.; Okamoto, T.; Aizaki, H.; Liu, M.; Mori, Y.; Abe, T.; Suzuki, T.; Lai, M.M.; Miyamura, T.; et al. Human VAP-B is involved in hepatitis C virus replication through interaction with NS5A and NS5B. J. Virol. 2005, 79, 13473–13482. [Google Scholar] [CrossRef] [Green Version]
- Arii, J. Host and Viral Factors Involved in Nuclear Egress of Herpes Simplex Virus 1. Viruses 2021, 13, 754. [Google Scholar] [CrossRef]
- Kopp, M.; Klupp, B.G.; Granzow, H.; Fuchs, W.; Mettenleiter, T.C. Identification and characterization of the pseudorabies virus tegument proteins UL46 and UL47: Role for UL47 in virion morphogenesis in the cytoplasm. J. Virol. 2002, 76, 8820–8833. [Google Scholar] [CrossRef] [Green Version]
- Mettenleiter, T.C. Intriguing interplay between viral proteins during herpesvirus assembly or: The herpesvirus assembly puzzle. Vet. Microbiol. 2006, 113, 163–169. [Google Scholar] [CrossRef]
- Kaplan, A.S.; Vatter, A.E. A comparison of herpes simplex and pseudorabies viruses. Virology 1959, 7, 394–407. [Google Scholar] [CrossRef]
- Yates, A.D.; Achuthan, P.; Akanni, W.; Allen, J.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Armean, I.M.; Azov, A.G.; Bennett, R.; et al. Ensembl 2020. Nucleic Acids Res. 2020, 48, D682–D688. [Google Scholar] [CrossRef]
- Labun, K.; Montague, T.G.; Krause, M.; Torres Cleuren, Y.N.; Tjeldnes, H.; Valen, E. CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 2019, 47, W171–W174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hubner, A.; Petersen, B.; Keil, G.M.; Niemann, H.; Mettenleiter, T.C.; Fuchs, W. Efficient inhibition of African swine fever virus replication by CRISPR/Cas9 targeting of the viral p30 gene (CP204L). Sci. Rep. 2018, 8, 1449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Graham, F.L.; van der Eb, A.J. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 1973, 52, 456–467. [Google Scholar] [CrossRef]
- Dong, R.; Saheki, Y.; Swarup, S.; Lucast, L.; Harper, J.W.; De Camilli, P. Endosome-ER Contacts Control Actin Nucleation and Retromer Function through VAP-Dependent Regulation of PI4P. Cell 2016, 166, 408–423. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mettenleiter, T.C. Glycoprotein gIII deletion mutants of pseudorabies virus are impaired in virus entry. Virology 1989, 171, 623–625. [Google Scholar] [CrossRef]
- Hagen, C.; Dent, K.C.; Zeev-Ben-Mordehai, T.; Grange, M.; Bosse, J.B.; Whittle, C.; Klupp, B.G.; Siebert, C.A.; Vasishtan, D.; Bauerlein, F.J.; et al. Structural Basis of Vesicle Formation at the Inner Nuclear Membrane. Cell 2015, 163, 1692–1701. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Walzer, S.A.; Egerer-Sieber, C.; Sticht, H.; Sevvana, M.; Hohl, K.; Milbradt, J.; Muller, Y.A.; Marschall, M. Crystal Structure of the Human Cytomegalovirus pUL50-pUL53 Core Nuclear Egress Complex Provides Insight into a Unique Assembly Scaffold for Virus-Host Protein Interactions. J. Biol. Chem. 2015, 290, 27452–27458. [Google Scholar] [CrossRef] [Green Version]
- Lye, M.F.; Sharma, M.; El Omari, K.; Filman, D.J.; Schuermann, J.P.; Hogle, J.M.; Coen, D.M. Unexpected features and mechanism of heterodimer formation of a herpesvirus nuclear egress complex. EMBO J. 2015, 34, 2937–2952. [Google Scholar] [CrossRef] [Green Version]
- Zeev-Ben-Mordehai, T.; Weberruss, M.; Lorenz, M.; Cheleski, J.; Hellberg, T.; Whittle, C.; El Omari, K.; Vasishtan, D.; Dent, K.C.; Harlos, K.; et al. Crystal Structure of the Herpesvirus Nuclear Egress Complex Provides Insights into Inner Nuclear Membrane Remodeling. Cell Rep. 2015, 13, 2645–2652. [Google Scholar] [CrossRef] [Green Version]
- Bigalke, J.M.; Heldwein, E.E. Structural basis of membrane budding by the nuclear egress complex of herpesviruses. EMBO J. 2015, 34, 2921–2936. [Google Scholar] [CrossRef]
- Di Mattia, T.; Wilhelm, L.P.; Ikhlef, S.; Wendling, C.; Spehner, D.; Nomine, Y.; Giordano, F.; Mathelin, C.; Drin, G.; Tomasetto, C.; et al. Identification of MOSPD2, a novel scaffold for endoplasmic reticulum membrane contact sites. EMBO Rep. 2018, 19. [Google Scholar] [CrossRef] [PubMed]
- Eisenberg-Bord, M.; Shai, N.; Schuldiner, M.; Bohnert, M. A Tether Is a Tether Is a Tether: Tethering at Membrane Contact Sites. Dev. Cell 2016, 39, 395–409. [Google Scholar] [CrossRef]
Name | Sequence (5′–3′) |
---|---|
VAPA_ctrl-seq_Fwd | TCGGGTTTAGATTTCTGCAGTT |
VAPA_ctrl-seq_Rev | GCGTAATTTCATACACTGGCAA |
VAPB_ctrl-seq_Fwd | ATCCTAACTGCTGCTAACTGGC |
VAPB_ctrl-seq_Rev | CTCCAATTCTGAAATCCAGTCC |
VAPA gRNA #1_Fwd | CACCAAACAGTCACAGTCGACCCT |
VAPA gRNA #1_Rev | AAACAGGGTCGACTGTGACTGTTT |
VAPA gRNA #2_Fwd | CACCGGCCTCACACAGTACCGGCG |
VAPA gRNA #2_Rev | AAACCGCCGGTACTGTGTGAGGCC |
VAPA gRNA #3_Fwd | CACCAACAGTGGAATTATTGACCC |
VAPA gRNA #3_Rev | AAACGGGTCAATAATTCCACTGTT |
VAPA gRNA #4_Fwd | CACCTCTTAAATTGCGAAATCCAT |
VAPA gRNA #4_Rev | AAACATGGATTTCGCAATTTAAGA |
VAPB gRNA #1_Fwd | CACCAACAGCGGGATCATTGACGC |
VAPB gRNA #1_Rev | AAACGCGTCAATGATCCCGCTGTT |
VAPB gRNA #2_Fwd | CACCGGGGCCTCCATTAACGTGTC |
VAPB gRNA #2_Rev | AAACGACACGTTAATGGAGGCCCC |
VAPB gRNA #3_Fwd | CACCGTGCTTTAAAGTGAAGACGA |
VAPB gRNA #3_Rev | AAACTCGTCTTCACTTTAAAGCAC |
HU6-F | ATAATTTCTTGGGTAGTTTGCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dorsch, A.D.; Hölper, J.E.; Franzke, K.; Zaeck, L.M.; Mettenleiter, T.C.; Klupp, B.G. Role of Vesicle-Associated Membrane Protein-Associated Proteins (VAP) A and VAPB in Nuclear Egress of the Alphaherpesvirus Pseudorabies Virus. Viruses 2021, 13, 1117. https://doi.org/10.3390/v13061117
Dorsch AD, Hölper JE, Franzke K, Zaeck LM, Mettenleiter TC, Klupp BG. Role of Vesicle-Associated Membrane Protein-Associated Proteins (VAP) A and VAPB in Nuclear Egress of the Alphaherpesvirus Pseudorabies Virus. Viruses. 2021; 13(6):1117. https://doi.org/10.3390/v13061117
Chicago/Turabian StyleDorsch, Anna D., Julia E. Hölper, Kati Franzke, Luca M. Zaeck, Thomas C. Mettenleiter, and Barbara G. Klupp. 2021. "Role of Vesicle-Associated Membrane Protein-Associated Proteins (VAP) A and VAPB in Nuclear Egress of the Alphaherpesvirus Pseudorabies Virus" Viruses 13, no. 6: 1117. https://doi.org/10.3390/v13061117