Next Article in Journal
Comparative Transcriptome Profiling of Human and Pig Intestinal Epithelial Cells after Porcine Deltacoronavirus Infection
Next Article in Special Issue
Virus Prospecting in Crickets—Discovery and Strain Divergence of a Novel Iflavirus in Wild and Cultivated Acheta domesticus
Previous Article in Journal
Development and In Vivo Evaluation of a MGF110-1L Deletion Mutant in African Swine Fever Strain Georgia
Previous Article in Special Issue
Nudivirus Sequences Identified from the Southern and Western Corn Rootworms (Coleoptera: Chrysomelidae)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Metatranscriptome Analysis of Sympatric Bee Species Identifies Bee Virus Variants and a New Virus, Andrena-Associated Bee Virus-1

1
Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, MT 59717, USA
2
Pollinator Health Center, Montana State University, Bozeman, MT 59717, USA
3
The Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot 5290002, Israel
4
Agroecology Lab, Newe Ya’ar Research Center, ARO, Ramat Yishay 30095, Israel
5
Department of Microbiology and Immunology, Montana State University, Bozeman, MT 59717, USA
6
Entomology Department, ARO, The Volcani Center, Rishon Lezion 7528809, Israel
7
The Mina & Everard Goodman Faculty of Life Sciences, Bar Ilan University, Ramat Gan 5290002, Israel
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Viruses 2021, 13(2), 291; https://doi.org/10.3390/v13020291
Submission received: 30 December 2020 / Revised: 22 January 2021 / Accepted: 3 February 2021 / Published: 12 February 2021
(This article belongs to the Special Issue Evolution and Diversity of Insect Viruses)

Abstract

Bees are important plant pollinators in agricultural and natural ecosystems. High average annual losses of honey bee (Apis mellifera) colonies in some parts of the world, and regional population declines of some mining bee species (Andrena spp.), are attributed to multiple factors including habitat loss, lack of quality forage, insecticide exposure, and pathogens, including viruses. While research has primarily focused on viruses in honey bees, many of these viruses have a broad host range. It is therefore important to apply a community level approach in studying the epidemiology of bee viruses. We utilized high-throughput sequencing to evaluate viral diversity and viral sharing in sympatric, co-foraging bees in the context of habitat type. Variants of four common viruses (i.e., black queen cell virus, deformed wing virus, Lake Sinai virus 2, and Lake Sinai virus NE) were identified in honey bee and mining bee samples, and the high degree of nucleotide identity in the virus consensus sequences obtained from both taxa indicates virus sharing. We discovered a unique bipartite + ssRNA Tombo-like virus, Andrena-associated bee virus-1 (AnBV-1). AnBV-1 infects mining bees, honey bees, and primary honey bee pupal cells maintained in culture. AnBV-1 prevalence and abundance was greater in mining bees than in honey bees. Statistical modeling that examined the roles of ecological factors, including floral diversity and abundance, indicated that AnBV-1 infection prevalence in honey bees was greater in habitats with low floral diversity and abundance, and that interspecific virus transmission is strongly modulated by the floral community in the habitat. These results suggest that land management strategies that aim to enhance floral diversity and abundance may reduce AnBV-1 spread between co-foraging bees.

1. Introduction

Bees gather plant-produced pollen and nectar as their protein and carbohydrate sources, respectively, and in doing so provide a critical ecosystem service—the pollination of numerous plant species. Approximately 87.5% of flowering plants benefit from animal-mediated pollination, including bees [1]. Bee-pollinated plants include those that produce fruit, nut, and vegetable crops, with a global annual value of $175 billion dollars (USD) [2]. There are over 20,000 known bee species worldwide [3]. Bees differ in many life-history traits including diet breadth (i.e., specialist or generalist foragers based on their preference or lack thereof for particular plants); sociality, ranging from solitary to eusocial; nesting habits, including ground, cavity, and open nesting; activity season; body size and proboscis length [3,4,5], and related flight distance [6]. These traits influence their nutritional requirements, ability to adapt to land-use changes and climate change, and their susceptibility to pathogens.
In many parts of the world, insect populations have declined [7]. These losses are attributed to multiple factors including habitat destruction, insecticide exposure, the loss of quality nutritional resources, climate change, parasites, and pathogens [8,9,10,11]. In particular, many bee populations have suffered range reductions and local extinction, including the rusty patched bumble bee (Bombus affinis) and the western bumble bee (Bombus occidentalis) in the US [12,13,14]. The factors influencing bee population declines vary geographically. In some parts of the world, local bee populations have expanded in part due to management practices (e.g., an increased number of managed Apis mellifera colonies in Argentina and Spain), or have altered occupancy patterns due to climate change and/or urbanization [15,16,17]. Regardless of population trends, insects in general (>1 million species) and bees in particular remain greatly understudied [18].
Although the majority of bee taxa are under-researched, honey bees (Apis mellifera) are one of the most studied insects due to their wide global distribution and their importance in agriculture. Honey bees are eusocial insects that live in colonies of ~30,000 individuals. Colonies are composed of predominantly sterile female workers, one reproductive female (the queen), and hundreds of seasonal males (drones) [19]. Beekeepers manage honey bee colonies for honey production and pollination services. Honey bees forage across longer distances (i.e., typically within two kilometers, but up to 10 km from their hive) compared to most other bee species [20,21,22].
They are generalist foragers that readily visit and pollinate a wide variety of crops and wild flowers. These traits, coupled with the ability to transport managed hives to pollinate many crops, have increased agricultural reliance on migratory beekeeping operations. This is particularly true in the US, where large-scale monoculture is common practice, but also in other parts of the world, including Israel, which has one of the highest beekeeping densities in the world (i.e., 10,000 hives per 7,000 km2) [23]. High annual losses of managed honey bee colonies in many parts of the world (e.g., 37% average annual loss in the United States from 2010 to 2018 and up to 40% in Israel in 2008) [23,24,25,26,27,28,29,30,31,32,33] have heightened the scientific and public interest in the abiotic and biotic factors contributing to these losses and the ecological importance of all bee taxa, including native and/or wild bees such as mining bees.
Mining bees include over 1550 species in the genus Andrena (Andrenidae) [3,34]. These wild bees have a mostly Holarctic distribution [35] and are commonly found in both agricultural and wild landscapes. Bees in this genus are generally solitary and lack social structures, although some species are communal [3,36,37]. Unlike honey bees, all Andrena females can produce offspring, which they must provide nutritional resources, since there is no division of labor or overlap of generations [37]. Andrena species persist on a nectar and pollen diet and show a wide range of foraging behaviors from generalist (broadly polylectic, exploiting multiple plant families) to highly specialist (narrow oligolectic, foraging on a single plant genus) [38,39]. While adults of many species are usually only active for several weeks per year, oligolectic species time their emergence to coincide with the flowering period of preferred host plants [39]. In the Mediterranean and semi-arid eco-regions of Israel, Andrena species are prevalent [35].
High average annual losses of honey bee (Apis mellifera) colonies and regional population declines of some mining bee species (Andrena spp.) are attributed to multiple factors including habitat loss, lack of quality forage, insecticide exposure, and pathogens. Bee pathogens include bacteria, fungi, microsporidia, and numerous viruses [40,41,42,43]. The majority of research investigating the impact of viruses on bee losses has been carried out in honey bees, due to their importance as agricultural pollinators, their well-known biology and behavior, and the fact that they are managed and readily reared and manipulated at the individual and colony scale. Therefore, most bee-associated viruses are known as “honey bee viruses” in recognition of the host from which they were first discovered and described (reviewed in [42,44]). Most of the characterized bee-infecting viruses are positive-sense, single-stranded RNA viruses (+ssRNA) in the Picornaviridae family including Dicistroviruses (acute bee paralysis virus (ABPV), black queen cell virus (BQCV), Israeli acute paralysis virus (IAPV), and Kashmir bee virus (KBV)); the Iflaviruses (deformed wing virus (DWV), Kakugo virus, Varroa destructor virus-1/DWV-B, sacbrood virus (SBV), and slow bee paralysis virus (SBPV)); and taxonomically unclassified viruses (chronic bee paralysis virus (CBPV) and the Lake Sinai viruses (LSVs)) (reviewed in [42,45]). There are very few identified bee-infecting viruses with DNA genomes, which include Apis mellifera filamentous virus (AmFV) [46,47] and Osmia cornuta nudivirus [48,49]. Several honey bee-associated viruses have been detected in wild bee species including BQCV, LSV, SBV, and AmFV in Andrena vaga, and LSV and AmFV in Andrena ventralis in Belgium [50], and DWV, BQCV, and SBV in Andrena spp. sampled in the eastern United States [48,51,52,53,54,55,56]. It is unclear whether virus detections in most of these studies were indicative of active infections in mining bees since viral replication was not assessed by negative strand-specific RT-PCR or inferred by quantitative PCR, though DWV replication was detected in Andrena haemorrhoa in Germany [57].
Recent high-throughput sequencing studies identified additional honey bee-infecting +ssRNA viruses including Bee macula-like virus (BeeMLV) in the Tymoviridae family, Apis mellifera flavivirus, and Apis mellifera nora virus 1 [58,59], as well as the first negative-sense single-stranded RNA viruses (-ssRNA) including Apis mellifera rhabdovirus-1 (ARV-1) [59], also known as Bee rhabdovirus (BRV-1) [60] and Apis mellifera rhabdovirus-2 (ARV-2) (reviewed in [43]). To date, the majority of sequencing efforts aimed at identifying bee-associated viruses have utilized honey bee and the ectoparasitic mite (Varroa destructor) samples [48,59,60,61,62,63] (reviewed in [43]). Sequencing a greater variety of bee and other insect species indicates that many honey bee-infecting viruses have a broader host range that includes bumble bees (Bombus spp.), ants (Camponotus spp.) [64,65], and wasps (Polistes fuscatus and Vespula vulgaris) [56,64,66]. Schoonvaere et al. utilized high-throughput sequencing to detect previously characterized bee viruses and identify new virus and virus-like sequences associated with eight wild bee species, including three mining bee species—Andrena cineraria, Andrena fulva, Andrena haemorrhoa; three bumble bee species—Bombus terrestris, Bombus cryptarum, Bombus pascuorum; and two mason bee species—Osmia bicornis, and Osmia cornuta, collected from four locations in Belgium [49]. Overall, the normalized virus coverage data indicate that the majority of previously described bee viruses were not detected in this sample cohort. Likewise, incomplete genome coverage of detected viruses, including new putative virus-like sequences, suggests low virus abundance, though this result may be in part due to the use of polyA-based sequence libraries. For example, relatively few BQCV and DWV-B/VDV-1 reads were detected in B. terrestris and B. cryptarum, and B. terrestris and O. cornuta, respectively, suggesting either low/initial infection levels or detection of pollen-associated virus [49,51,56]. Furthermore, this study revealed that the viruses detected varied with sample site and bee taxa, indicating that viruses are not necessarily shared between co-foraging bee species. For example, Bee macula-like 2 virus was abundant in A. haemorrhoa samples, but absent from other bee samples, within a single site [49]. Identification of 11 new virus-like sequences in this study, including putative negeviruses, which were detected in numerous samples, suggests that additional sequencing studies are required to identify the complete suite of bee-infecting viruses. Moreover, studies that characterize bee-associated viruses are needed to confirm that virus-like sequences are bona fide viruses. Follow up studies that examine the prevalence and abundance of recently identified viruses in bees and other insects are also required to better understand the ecology of bee/insect-infecting viruses, including determining which viruses negatively impact bee communities.
Virus transmission within species occurs vertically from parents to offspring. Horizontal transmission within species occurs through several mechanisms including close contact, especially among eusocial colony-dwelling insect species and via behaviors such as trophallaxis (mouth-to-mouth food transfer) and grooming. Horizontal virus transmission, both within and between honey bee colonies, includes vector-mediated transmission (reviewed in [42,67]). For example, the Varroa destructor mites that parasitize honey bee colonies can be productively infected by several bee viruses (e.g., DWV [68,69,70,71], IAPV [72], KBV [73], and CBPV [74]). Viruses are transmitted to bees within and between honey bee colonies when infected mites feed on bees. Wax moths (Galleria mellonella) and small hive beetles (Aethina tumida) are other honey bee colony infesting insects that can host active IAPV and BQCV, and DWV infections, respectively [75,76,77,78,79]. It is likely that these insects host additional bee-infecting viruses. Carnivorous wasp and ant species can also be productively infected by DWV, IAPV, and BQCV [65,80]. Though commonly described as “bee virus” infections in other insects, virus transmission between parasitic insects and their hosts is bidirectional.
The most prevalent route of virus transmission between different bee taxa is likely via shared floral resources [53,56,81,82,83,84,85,86,87]. Specifically, infected bees can deposit viruses on flowers as they forage, and these viruses can then infect other bees that visit these flowers. Clear experimental based evidence of interspecies transmission was demonstrated in greenhouse studies of IAPV-transmission from honey bees to bumble bees and vice versa via shared food resource [56]. However, co-foraging species do not necessarily share viruses, as demonstrated by deposition of BQCV and DWV onto floral resources by honey bees, and lack of infection in bumble bees that foraged on the same flowers [53] and lack of virus infection via oral inoculation [88]. At the community level, interspecies virus transmission in sympatric honey bees and bumble bees was indicated by the extent of virus sequence identity in both taxa [87]. Directionality of infections is often inferred based on the prevalence and abundance of viruses in particular species within a sample cohort [52,87]. However, it is important to note that studies based on sample cohorts obtained at a single snapshot in time and/or from a single geographic location may not accurately represent virus ecology, as virus infections in honey bee colonies vary with sample date [89,90,91,92,93,94]. Thus, longitudinal studies with large samples sizes and/or the cumulative evidence from numerous smaller-scale studies are required to document biologically important trends. Examples of such studies include those that documented high DWV prevalence and abundance in the fall, coupled with high Varroa mite infestation correlate with over-winter honey bee colony death [69,89,91,95,96].
Evidence indicating that virologists, entomologists, and ecologists are in the initial phases of characterizing the bee-associated virome is provided in a recent study that sequenced virus-augmented samples from honey bees obtained as part of a large-scale sampling effort in Belgium, coupled with in-depth analyses of existing sequence data [97]. The study by Deboutte et al. not only resulted in the discovery of new virus-like sequences, virus strains, and potential recombinant viruses in honey bees, it also included bioinformatic analyses of over 5000 sequence datasets, which revealed that a high number of viral genomes were common to numerous Apidae family members, as well as widely distributed across different families within the order Hymenoptera [97]. These results, coupled with smaller-scale studies documenting virus replication in species beyond that of the host(s) from which particular viruses were discovered, suggest that many Hymenopteran viruses, and likely insect viruses in general, infect a wide range of species, and thus the concepts of species-specific viruses and paradigm of “spillover” from honey bees to other bee species should be reevaluated [97].
To evaluate virus diversity and prevalence in sympatric, co-foraging bee species, and to identify ecological factors that are associated with patterns of virus spread, we conducted a field survey across 14 sites in Israel within a single blooming season, sampling populations of honey bees and dominant mining bee species. From these samples, we identified bee-associated viruses using high-throughput sequencing, including viral genome variants of BQCV, DWV, LSV-2, and LSV-NE, which would likely escape detection with the use of widely adopted primer sets that were developed based on virus sequences obtained from North America and Europe. Sequencing efforts resulted in the discovery of a unique bipartite +ssRNA Tombo-like virus. This virus was very prevalent and abundant in Andrena samples and therefore named Andrena-associated bee virus-1 (AnBV-1). AnBV-1 was also detected in honey bee samples albeit at lower frequency and abundance. Statistical modeling indicated that the probability of AnBV-1 infection in honey bees was greater in habitats with low floral diversity and abundance, suggesting that interspecific virus transmission is strongly modulated by the floral community in the habitat. Laboratory based experiments were carried out to confirm that AnBV-1 is a bona fide virus that replicates in primary honey bee pupal cells maintained in culture. There is a dearth of bee viruses that can be studied in the lab, and therefore future development of AnBV-1 may result in a new experimentally tractable system for investigating bee host–virus interactions. These studies are essential to understanding the impact of viruses on bees.

2. Materials and Methods

2.1. Study Region and Survey Design

We conducted a field survey during March 2018 in the Judean Foothills, central Israel, a Mediterranean agro-ecosystem comprised of a mosaic of agricultural fields, planted forests, and shrublands. Honey bees are commonly managed in this region for crop pollination and honey production. Previous studies in this region revealed diverse and abundant wild bee communities in both agricultural fields and surrounding natural and semi-natural habitats [98,99]. The survey included a total of fourteen sites (Figure 1 and Supplementary Table S1); sites were patches of wild bloom dominated by yellow-flowering Brassicaceae species, mainly Sinapis alba, Hirschfeldia incana, and Rapistrum rugosum. The average distance between neighboring sites was 1914 m, ranging between 524 and 4960 m. Eight of the sites were characterized by up to six blooming floral species (that were seen visited by bees during the survey), and classified as low-floral-diversity habitats. The other six sites, classified as high-floral-diversity habitats, were characterized by having greater than nine blooming floral species (that were seen visited by bees during the survey), including families other than Brassicaceae. While this initial classification of the sites to high and low floral diversity was performed for the purpose of site selection, subsequent characterization of each site was based on pollinator resource use and floral abundance data recorded at the site (Figure 6).
Each site was sampled for one day, from 8:00 to 16:00. Sampling was conducted only during favorable weather conditions (temperature >17 °C, wind velocity <3 m/s, and clear or partially clear skies). In each site, we marked a 25 by 25 m plot where sampling of bee foraging activity and of the floral community was carried out. The bee foraging activity sampling was conducted by slowly walking throughout the plot and netting bees from flowers for 40 min (excluding bee handling time). Each captured bee was identified in situ to the lowest taxonomic level possible, immediately placed in a separate vial, and kept on dry ice. The visited flower species of each captured bee was recorded. At the end of each sampling day, all the collected specimens were transported to the lab and stored at −80 °C.
To sample the floral community in each site, we sampled each plot by randomly placing ten 1 m radius hoops. In each hoop, we identified all the flowering species and counted the abundance of each species’ distinct floral units. We defined distinct floral units for most taxa as individual flowers or distinct florets within sparse inflorescences. In Compositae, Umbelliferae and Trifolium, floral units were defined as individual inflorescences. To account for the large surfaces of inflorescences in these families, we multiplied their counts by their surface size relative to that of dominant single flowers in the field.
The studied region is generally characterized by a patchy, fine-grained land-use mosaic, in which wild flower patches are relatively similar to each other in terms of the floral community (verified visually during site selection). Therefore, each of our sampled plots well represented the flower patches in the broader area, in a radius of at least several hundreds of meters.

Virus Analysis

The two most abundant bee taxa in this sample cohort were mining bees (i.e., genus Andrena; A. combusta ochraceohirta, A. aerinifrons levantina, A. urfanella and an unidentified morphospecies of the subgenus Truncandrena) and honey bees (Apis mellifera). Therefore, virus identification efforts were focused on these two bee taxa. A subset of the samples (i.e., between 7 and 11 individuals, with a median number of 11 individuals) per taxa per site were used for virus identification via high-throughput sequencing, and subsequent determination of the prevalence and abundance of AnBV-1. The first round of sequencing was carried out on sequencing libraries representing each bee species (i.e., pooled Apis mellifera or Andrena spp. samples) obtained from the following sites: Galon3—low floral diversity, low relative A. mellifera activity; N. Zanoah—high floral diversity, high relative A. mellifera activity; R.B.Sh—low floral diversity, high relative A. mellifera activity; and Berko2—high floral diversity, low relative A. mellifera activity (relative honey bee activity per site was categorized as high/low for sites with more/less than 20% honeybee foragers, out of the total number of sampled bees, respectively). In addition, sequencing libraries were prepared from two virus-augmented samples, as described below. To identify the most prevalent and abundant viruses in additional sites from this study, a second round of sequencing was carried out on pooled virus-augmented samples from each species (i.e., Apis mellifera or Andrena spp.) obtained from the following sites: Nahala—low floral diversity, low relative A. mellifera activity; Alon—high floral diversity, high relative A. mellifera activity; R.B.Sh2—low floral diversity, high relative A. mellifera activity; and Alon2—high floral diversity, low relative A. mellifera activity.

2.2. RNA Extraction

Individual bees in 2 mL safe-lock Eppendorf tubes were homogenized in 500 µL sterile buffer (100 mM Tris, 100 mM NaCl Tris pH 7.6) using 2 tungsten balls (2.85 mm, Ultraparts) in a Geno/Grinder (Spex SamplePrep) at 1550 rpm for 1.5 min. Samples were centrifuged for 2 min at 13,500 rpm at 4 °C to pellet debris. Supernatants (i.e., 150–200 µL for Andrena spp. and 400 µL for Apis mellifera) were transferred to a new tube and combined with 1–2 volumes of Trizol reagent (Life Technologies), vortexed, and incubated at room temperature for 5 min. Next, 150 µL of chloroform was added and each sample was mixed by hand for 15 s, followed by incubation at room temperature for 3 min. Samples were centrifuged for 15 min at 12,000× g at 4 °C, and the aqueous phase was removed from each sample and transferred to a fresh tube. An equal volume of isopropanol was added to each sample, along with 20 µg glycogen to aid in precipitation. Samples were precipitated at −20 °C for 24–72 h, then centrifuged for 10 min at 12,000× g at 4 °C. Supernatants were carefully removed by pipetting, and each pellet was washed twice with 75% ethanol. Final pellets were air dried at room temperature for 15 min, then dissolved in 20–30 µL sterile distilled water. RNA was quantified by spectrometry using a NanoDrop instrument (ThermoFisher). RNA samples of poor quality, where A260/A280 <1.7, were re-precipitated with lithium chloride or sodium acetate by combining the sample with an equal volume of isopropanol containing 700 mM LiCl or 1.5 M NaOAc, and precipitated at −20 °C for 1.5 h. RNA was washed with 75% ethanol as before and suspended in sterile distilled water. All RNA samples were stored at −80 °C until analysis.

2.3. RNAseq Library Preparation and Sequencing

RNA was sent to the Roy J. Carver Biotechnology Center at the University of Illinois for library preparation (Illumina TruSeq Stranded RNA Sample Prep kit) and paired-end sequencing on Illumina HiSeq 4000 or MiSeq sequencing systems. Libraries were prepared and quantitated using an Illumina Library quantification kit (Kapa). Paired end sequencing libraries were generated according to manufacturers’ instructions (lllumina). In brief, RNA from individual bees (n = 11 per library) was pooled to generate sequencing libraries representing each bee species (i.e., Apis mellifera or Andrena spp.) obtained from four sites (i.e., Galon3, N. Zanoah, RBSh, and Berko2), resulting in a total of eight sequencing libraries. The goal of sequencing these eight samples was to sequence bee-associated viruses (genomes/transcripts). Therefore, ribosomal RNA (rRNA) was depleted using the Ribo-Zero-Gold (Human/Mouse/Rat), which is compatible with Apis mellifera rRNA and Andrena spp. rRNA, which is very similar to honey bee rRNA (92% identical, e = 0), prior to the preparation of the libraries. Each of the libraries were paired-end sequenced on a HiSeq 4000 using a HiSeq 4000 SBS sequencing kit version 1, yielding ~44 million reads (2 × 100 nt) per sample.
In addition, the first round of sequencing included two virus-augmented libraries (i.e., one library representing Apis mellifera (n = 44) and one library representing Andrena spp. (n = 44), pooled from the four sites mentioned above) were prepared as follows. To enhance the amount of viral RNA sequenced, bee lysates were augmented for virion-protected/encapsidated nuclease treated by mixing 150 µL bee lysate with 50 U Benzoase (Sigma) and 40 U RNase I (Thermo) in total reaction volume of 250 µL, incubated at 37 °C for 1.5 h, then extracted with Trizol reagent (Thermo) according to the manufacturer’s instructions. Glycogen (Thermo) was added at a concentration of 20 µg per sample to aid in nucleic acid precipitation. Illumina paired-end 100 bp libraries were prepared without polyA selection (since not all virus genome segments are poly-adenylated) or rRNA removal steps since presumably the majority of rRNAs and the cytoplasmic mRNAs would have been degraded by RNAse treatments. RNA quality and abundance were estimated by NanoDrop and Qubit, which indicated very low abundance of RNA in virus-augmented samples. Reverse transcription was primed using random hexamers, followed by second strand synthesis, and amplification. Sequencing was as described above (HiSeq 4000) except that these virus-augmented libraries were diluted such that they would account for only 5% of the total sequencing lane capacity. Sequencing was on a single HiSeq 4000 lane, in combination with the above mentioned eight samples and yielded ~12 million reads (2 × 100 nt) for each of these virus-augmented samples.
A second round of virus-augmented RNAseq was carried out similarly to the first round of virus-augmented samples, but with new pools for Apis mellifera (n = 44) and Andrena spp. (n = 44) from samples obtained from four additional sites (i.e., Alon, Alon2, RBSh, and Nahala). This second round was sequenced on an Illumina MiSeq and yielded ~3.5 million reads (2 × 250 nt) each.
To obtain additional sequence data for AnBV-1, lysate from a single mining bee with a high abundance of AnBV-1 (i.e., sample 13, Supplementary Table S6), was nuclease treated by mixing 150 µL bee lysate with 50 U Benzoase (Sigma) and 40 U RNase I (Thermo) in total reaction volume of 250 µL, incubated at 37 °C for 1.5 h, then extracted with Trizol reagent (Life Technologies) according to the manufacturer’s instructions. Glycogen (Thermo) was added at a concentration of 20 µg to aid in precipitation. The RNA from this sample was prepared and sequenced identically to the round two virus-augmented samples. This individual sample was sequenced on an Illumina MiSeq and yielded ~3 million reads (2 × 250 nt).

2.4. Apis mellifera (Honey Bee) Genome Alignment

To remove as much bee genome sequence from the RNAseq libraries prior to analyses, sequences were aligned to the Apis mellifera genome (i.e, GCA_003254395.2_Amel_HAv3.1_genomic.fna, downloaded from NCBI 2019–02-07).

2.5. HoloBee Database Expansion (March 2019)

To identify and group sequences in the RNAseq libraries that corresponded to previously sequenced honey bee-associated microbes and viruses, the HoloBee-barcode and HoloBee-mop databases were downloaded from (https://data.nal.usda.gov/dataset/holobee-database-v20161) and split into virus and non-virus portions [100]. The virus database was supplemented to reflect numerous discoveries of bee-sample associated putative viral sequences (Supplementary Table S9) [48,49,59,60,66]. Reads and contigs were also aligned (HISAT2) and queried (BLAST, blastn, and dc-megablast) against the ref_viruses_rep_genomes database (11,015 sequences, downloaded from NCBI as a BLAST database 2019–03–24) and CLC de novo viral binned contigs from eight wild bee species [49] (567 contigs, fig share, https://figshare.com/authors/Karel_Schoonvaere/4182034, downloaded 2019–02–01); Supplementary Table S10).

2.6. RNA Sequencing and Analyses

RNAseq and viral sequencing resulted in a total of 379,840,320, 2 × 100 nt read pairs, and 10,222,370, 2 × 250 nt read pairs (see Supplementary Table S2). Reads were downloaded from DNA Services at University of Illinois at Urbana-Champaign. The reads were already trimmed of their 3′ adaptor sequences and barcode sequences that distinguished samples within the same lane. FastQC was used to view qualities both before and after further quality trimming with Trimmomatic-0.36 [101]. An example trimming reads on a macbook: java -jar /Applications/Trimmomatic-0.36/trimmomatic-0.36.jar PE -threads 8 read1.fastq.gz read2.fastq.gz read1.paired.fastq.gz read1.unpaired.fastq.gz read2.paired.fastq.gz read2.unpaired.fastq.gz ILLUMINACLIP:TruSeq3-PE-2.fa:2:10:10:6 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36.
Reads surviving trimming as pairs were aligned to the honey bee genome using HISAT2 [102]. The HISAT2 indexes were built: hisat2–2.1.0/hisat2-build “$target.fasta”, where $target.fasta” referred to the honey bee genome. To remove reads aligning to, for example, honey bee, HISAT2 was combined with gsed and samtools (1.9) [102,103] to recover only the unaligned reads: hisat2-2.1.0/hisat2 –threads 6 –summary-file metrics.metrics -x “$target” -1 read1.fastq.gz -2 read2.fastq.gz | gsed ‘/\t\( 77 \ | 141 \ )\t[*]/!d′ | samtools sort -n –threads 4 | samtools fastq –threads 4 -1 new.R1.fastq -2 new.R2.fastq -, where $target” was the index built above (e.g., the HISAT2 index for honey bee). Reads that aligned to honey bee were thereby omitted from further analyses. If only one of the read mats aligned to honey bee, both mates were omitted.
A complete Andrena genome was not available and thus sequences obtained from Andrena samples were also aligned to the honey bee genome (to remove at least some Andrena reads). The number of reads for each sample that aligned to the honey bee genome varied for each sample, but averaged ~54% for honey bee samples and ~14% for Andrena samples (Supplementary Table S2).
The RNAseq library reads (sequences) that did not align to honey bee (i.e., neither mate in the pair aligned) were then aligned to non-viral sequences from the Holobee database (described above) and the Lotmaria passim (formerly known as Crithidia mellificae, sf) to identify and remove non-viral reads that aligned to sequences within the augmented honey bee holobiome [104]. The procedure was identical to removal of the honey bee aligned reads.
The remaining RNAseq paired-end reads (i.e., non-Apis mellifera, and with the holobee non-virus reads likewise removed) from each library were assembled into contigs using Trinityrnaseq v2.10.0 via a docker image (docker pull trinityrnaseq/trinityrnaseq, 2019 and 2020) on either a macbook pro or AWS EC2 instances (e.g., m5 d.12× large with 48 GiB Memory, 192 vCPU). Libraries from each sample were separately assembled. Contig assessment and quantification were performed using scripts included with trinityrnaseq. An example running trinityrnaseq via docker on EC2: sudo docker run --rm -v‘pwd‘:‘pwd‘ trinityrnaseq/trinityrnaseq Trinity --seqType fq --CPU 46 --max_memory 182 G --left ‘pwd‘/read1.fastq --right ‘pwd‘/read2.fastq --output ‘pwd‘/out_trinity.
For contig quantitation, we used the trinityrnaseq utility script, align_and_estimate_abundance.pl, specifying kallisto as the aligner [105]. An example on a macbook: trinityrnaseq/util/align_and_estimate_abundance.pl --transcripts contigs.fasta --seqType fq --left read1.fastq.gz --right read2.fastq.gz --est_method kallisto --trinity_mode --prep_reference --output_dir out_quant. At times, we added the parameter --kmer-size = 21 to better align more variant reads. Kmer size of 21 was experimentally determined to balance the alignment of the most reads to viral transcripts, while minimizing alignment of possibly non-target reads. To create virus-level abundance (e.g., all BQCV), we added a mapping from all contigs to all virus groupings (as labeled by their BLAST results) and supplied that as a custom trans_map as an argument to align_and_estimate_abundance.pl using the --gene_trans_map option. In other words, where this script usually quantitates contigs on a trinity concept of gene, consolidating all the isoforms, we applied an organism name instead of gene, so that we could review summaries at the organism level.
To identify candidate viral contigs, the assembled contigs were aligned to NCBI’s BLAST nt database (downloaded 2020–05–26) and BLAST databases constructed from the candidate virus contigs of eight wild bee species using blastn and dc-megablast with NCBI’s BLAST+ suite (versions 2.10.1) [49,106]. Likewise, DIAMOND (version 0.9.35 downloaded 2020–06–21) was used to align contigs to nr with taxonomy enabled (nr, prot.accession2taxid.gz and taxdmp.zip downloaded 2020–05–26) [107]. To build the DIAMOND database (database version 3): diamond makedb --in nr.gz --taxonmap prot.accession2taxid.gz --taxonnodes taxdmp/nodes.dmp --taxonnames taxdmp/names.dmp --db n. The DIAMOND preconfigured reporting fields were extended to include stitle, sscinames, staxids, sphylums, skingdoms. An example aligning contigs to nr with DIAMOND on an EC2 instance (48 CPUs, 192 GiB memory, and 900 GiB NVMe SSD Drives i.e., EC2 m5 d.12 xlarge instance): sudo diamond blastx --query contigs.fasta --db nr --sensitive --evalue 0.001 --max-target-seqs 1 --max-hsps 1 --index-chunks 1 --block-size 7 --log --outfmt 6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore stitle sscinames staxids sphylums skingdoms -o diamond_out.tsv. BLAST results were post-processed, to retain the top hit of any putative viral contig, provided that the viral contig was greater than or equal to 400 nt.
To quantify reads and create coverage maps of the viral genome sequence variants described herein, reads were aligned and counted using kallisto and resulting bam files manipulated with using Samtools [103,105]. More specifically, reads were aligned (using a kallisto index built with --kmer-size = 21, appropriate for more sensitive alignments in this dataset) to all the candidate viral contigs to estimate abundances. For example, to align as many reads as possible to individual contigs, such as AnBV-1 RNA1 or other selected contigs, we created kallisto indexes from fasta files containing single contigs in parallel parallel kallisto index --index = {/.}21kmer.kallisto_index --kmer-size = 21 {} 2> kallisto_index.log ::: *.fasta (“{}” are placeholders for substitutions in parallel based on the glob “*” in *.fasta). Using those indexes, we aligned each sample to each individual contig to quantitate and to generate pseudobams for coverage maps, for example: kallisto quant --threads = 6 --pseudobam --output-dir index_name.sample_name --index kallisto_index_of_contig read1.fastq.gz read2.fastq.gz. Pseudobams were sorted and indexed using samtools. Read coverage was visualized by loading the indexed bam files into Integrative Genomics Viewer (IGV_MacApp_2.8.12_WithJava). RNAseq, Trinity assembly and BLAST analyses were performed on a Mid 2015 MacBook Pro (Quad-Core Intel Core I7, macOS 10.14–10.15) or high CPU and/or high Memory AWS EC2 instances (detailed above) with Amazon Linux AMIs. Job control, read counts, extracting, and relabeling candidate viral trinity contigs, etc., were performed using bash and R. Some examples within this section are simplifications. Detailed code is available at: https://github.com/charlieccarey/viral_transcriptome_of_bees.

2.7. Reverse Transcription/cDNA Synthesis

Reverse transcription (RT) reactions to produce complementary DNA (cDNA) were performed by incubating 300 ng of RNA from each RNA pool or individual RNA sample with M-MLV reverse transcriptase (Promega) and 500 ng random hexamer primers (IDT) for 1 hr at 37 °C according to the manufacturer’s instructions. Samples were diluted 1:1 with sterile distilled water prior to analysis.

2.8. Polymerase Chain Reaction (PCR)

PCR was performed according to standard methods [91,108]. In brief, 2 μL cDNA template was combined with 10 pmol of each forward and reverse primer, and amplified with 0.5 μL (5 U/μL) ChoiceTaq polymerase (Thomas Scientific) according to the manufacturer’s instructions using the following cycling conditions: 95 °C for 5 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s–1 min, 35 cycles; followed by final elongation at 72 °C for 4 min. PCR products were visualized by 2% agarose gel electrophoresis and staining with SYBRsafe (Invitrogen). Positive and negative control reactions were included for all analyses and exhibited the expected results. Select products were purified with the Qiaquick PCR Purification Kit (Qiagen), quantified by NanoDrop spectrometry, and Sanger sequenced.

2.9. Quantitative Polymerase Chain Reaction (qPCR)

Quantitative PCR (qPCR) using primer sets listed in Supplementary Table S2 was utilized to quantify the viral RNA (i.e., genome and transcript) abundance in the samples. The specificity of virus-specific primer sets was confirmed through melt-point analysis, gel electrophoresis, and Sanger sequencing of select qPCR products. Primers for LSV (reverse primer only), BQCV, and AnBV-1 were designed based on the sequencing information obtained as part of this study. Importantly, qPCR analyses using previously described primers would have resulted in false-negatives since the viral consensus sequences described herein differed from previously reported virus strains.
All qPCR reactions were performed in triplicate using 2 μL cDNA template (diluted 1:1 with sterile distilled water) per reaction. In addition, each 20 μL qPCR reaction contained 1× ChoiceTaq Mastermix (Thomas Scientific), 0.4 μM each forward and reverse primer, 1× SYBR green (Life Technologies), and 3 mM MgCl2. Reactions were carried out in 96-well plates using a CFX Connect Real-Time instrument using Maestro software (Bio-Rad) with the following thermo-profile: pre-incubation at 95 °C for one minute; 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 15 s; final extension at 72 °C for 1 min, followed by melt curve analysis. Positive and negative control reactions were included for all qPCR analyses and exhibited the expected results.
Virus-specific qPCR-target amplicons were cloned into the pGEM-T (Promega) or pCR2.1TOPO (Life Technologies) vectors, as described previously [89]. Plasmid standards, containing 103 to 109 copies per reaction, were used as qPCR templates to assess primer efficiency and generate standard curves used for quantifying viral RNA copy numbers for each sample. Primer efficiencies were evaluated using qPCR assays of cDNA and plasmid dilution series, and calculated by plotting log10 of the concentration versus the crossing point threshold (C(t)) values and using the primer efficiency equation, (10(1/Slope)-1) × 100) [109]. The virus-specific qPCR primer sets utilized in this study had efficiencies ranging from 86 to 103% and provided accurate quantitative assessment of >103 RNA copies per reaction. The linear standard equations for virus-specific plasmid standards and qPCR primers listed in Supplementary Table S3 were as follows: Rpl8 Ct = -3.937× + 40.506, R2 = 0.9982; LSV Ct = -3.252× + 39.697, R2 = 0.9979; DWV Ct = -3.4093× + 41.641, R2 = 0.99756; AmFv Ct = -3.3185× + 39.489, R2 = 0.99151; BQCV Ct = -3.2918× + 40.332, R2 = 0.99378; SBV Ct = -3.725× + 44.017, R2 = 0.99018; AnBV-1 RNA 1 Ct = -3.5923× + 42.246, R2 = 0.99893; AnBV-1 RNA2 Ct = -3.3896× + 44.259, R2 = 0.94813; negative strand AnBV-1 RNA1 Ct = -3.417× + 40.427, R2 = 0.9995; negative strand AnBV-1 RNA2 Ct = -3.5973× + 44.846, R2 = 0.9972. All reported qPCR data were normalized to genome copies per 100 ng RNA.

2.10. Statistical Analysis of qPCR

To test for differences in AnBV-1 RNA copies relative to the zero hour time point in honey bee pupal cells, base R version 3.3.3 was used to perform a pairwise Wilcoxon Rank Sums test with no multiple comparisons correction [110]. A Benjamini-Hochberg correction was performed to correct for increased rate of false positives for additional pairwise comparisons to the zero hour time point. Briefly, the p-values were ranked from lowest to highest, then each individual p-value’s Benjamini–Hochberg critical value was calculated with the formula (i/m) 0.25, where “I” is the p-value’s rank, m is the number of comparisons, and 0.25 is the false discovery rate. The largest p-value that was smaller than the critical value was considered as the cutoff for significance. Therefore, any p-value equal to or smaller than the cutoff was considered statistically significant and is indicated in each figure legend.

2.11. Negative Strand-Specific PCR

AnBV-1-positive samples were analyzed for the presence of negative-strand RNA1 and RNA 2 using strand-specific RT-PCR according to published methods [111]. Briefly, RNA from select samples was extracted with Trizol as above, and cDNA synthesis reactions were performed with MMLV-RT (Promega) according to the manufacturer’s instructions using negative strand-specific RNA 1 and RNA 2 primers (TAGS-AnBV-1-RNA1 and TAGS-AnBV-1-RNA2, respectively) tagged with an additional 21 nt of sequence at their 5′ end. The TAGS sequence (5′GGCCGTCATGGTGGCGAATAA3′) shares no homology with AnBV-1 nor to the honey bee genome. In brief, 50 ng RNA, relevant primer, and 0.5 mM each dNTP were combined with RT Buffer containing 200 U MMLV-RT (Promega), and 40 U RNaseOUT (Life Technologies). Reactions were incubated for 120 min at 37 °C, then unincorporated primers present in the RT reactions were digested with 2 U exonuclease I (Life Technologies) per reaction at 37 °C for 30 min, followed by heat inactivation at 85 °C for 5 min. PCR was performed using 2 μL of this cDNA template in 25 μL reactions containing 10 pmol each of a tag-specific forward primer (TAGS) and an RNA 1 or RNA 2 reverse primer (AnBV-1-RNA1-R545 and AnBV-1-RNA2-R659, respectively) using the following cycling conditions: 95 °C for 5 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, 35 cycles; final elongation 72 °C for 4 min, hold at 12 °C. For negative controls, PCR was performed using template incubated in the absence of RT enzyme during the reverse transcription reaction, and with the reverse primer only. Positive controls included PCR with PCR primers (AnBV-1-RNA1-F366 and AnBV-1-RNA1-R545, and AnBV-1-RNA2-F461 and AnBV-1-RNA2-R659) for detection of RNA 1 and RNA 2, respectively. Self-priming was tested by performing reverse transcription reactions in the absence of exogenous primers, followed by PCR with qPCR primers as described above. PCR products were analyzed by 2% agarose gel electrophoresis and were stained with SYBR safe (Life Technologies).

2.12. Rapid Amplification of cDNA Ends

Rapid Amplification of cDNA Ends (RACE) was performed to extend the sequence of AnBV-1 RNA 1 and RNA 2 using the SMARTer RACE 5′/3′ kit (Takara) according to the manufacturer’s instructions. Briefly, RNA containing high amounts of AnBV-1 as determined by qPCR extracted from an individual Andrena spp. sample was used as template to make 5′ and 3′ RACE-ready cDNA products. Prior to making 3′ RACE ready cDNA approximately 500 ng of RNA was polyadenylated using E. Coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions, since RNAseq data indicated that neither RNA 1 nor RNA 2 were polyadenylated. PCR for the 5′ end of RNA 1 was performed using 5′RACE-ready cDNA as template and primer AnBV-1-RNA1-R73. This PCR product was used as template for nested PCR using primer AnBV-1-RNA1-R43. The resulting PCR product was cloned using the In-Fusion system supplied with the RACE kit. Approximately 10–12 colonies were selected and grown in Leuria-Bertani broth supplemented with 100 μg/mL ampicillin and cultured overnight at 37 °C. Plasmid DNA was extracted using the Promega PureYield Plasmid Miniprep System (Promega). Plasmid DNA was sequenced using the M13R sequencing primer, and sequences were aligned to the corresponding consensus sequence obtained by RNAseq. PCR for the 3′ end of RNA 1 was performed using 3′RACE-ready cDNA as template and primer AnBV-1-RNA1-F1862. This PCR product was used as template for nested PCR using primer AnBV-1-RNA1-F1972. PCR for the 5′ end of RNA 2 was performed using 5′RACE-ready cDNA as template and primer AnBV-1-RNA2-R122. This PCR product was used as template for nested PCR using primer AnBV-1-RNA2-R69. PCR for the 3′ end of RNA 2 was performed using 3′RACE-ready cDNA as template and primer AnBV-1-RNA2-F2572. This PCR product was used as template for nested PCR using primer AnBV-1-RNA2-F2612. All RACE products were cloned, sequenced, and aligned as described above.

2.13. Honey Bee Pupal Cell Cultures and AnBV-1 Infection

Purple-eyed honey bee pupae were removed from the wax comb cells, in which they develop, using featherweight forceps (Bioquip). The pupae were incubated at 28 °C overnight in 12-well plates. Damaged (i.e., melanized) pupae were discarded. Primary cells were harvested from surface sterilized honey bee pupae in a biosafety cabinet. Surface sterilization was carried out in a 50 mL conical tube in which pupae were swirled in 0.6% hypochlorite solution (diluted bleach) for 3 min, 70% ethanol for 3 min, and in sterile water for injection (Gibco). In groups of two, pupae were dissected into head, thorax, and abdomen segments in 2 mL WH2 medium [112] in a 47 mm dish using sterile 18-gauge needles to vigorously disturb tissues and release cells into the medium. The cells were transferred to a 15 mL conical tube, while the carcasses were washed again with 2 mL of fresh medium, which was added to the same conical tube. Carcasses were then discarded. The total volume was brought to 14.5 mL with fresh WH2 medium, and 300 μL of this cell suspension were plated into each well of a 48 well plate (approximately 106 cells per well) and incubated at room temperature overnight before infection.
To infect cells with AnBV-1, 3 μL Andrea spp. lysate containing 1.3–2.6 × 108 copies AnBV-1 per µL, or lysate without virus (mock), were added to each well of pupal cells and incubated at room temperature. To quantify virus abundance over the course of infection, RNA was isolated from cell culture wells on multiple days post-infection (dpi) (i.e., 0, 1, 2, 3, 4, 5, or 7 dpi) using two volumes of Trizol reagent (Life Technologies) (i.e., 600 μL per well) and pipetting to dislodge adherent cells and facilitate cell lysis. The entire contents of each well were transferred into 1.5 mL centrifuge tubes and RNA was extracted according to manufacturers’ instructions as described above.

2.14. Andrena-associated bee virus-1 (AnBV-1) Genome and Phylogenetic Analyses

AnBV-1 open reading frames were predicted in SnapGene Viewer (www.snapgene.com) using the standard start codon option and using the Glimmer ORF finder tool in Geneious Prime (version 2020.2.3, www.geneious.com). Predicted ORF sequences and their translations were queried with BLAST and PHMMER online utilities [113,114]. AnBV-1 ORF1 is 1740 nt and encodes a putative 540 aa protein. Initial BLAST analyses (i.e., protein-protein BLAST (BLASTp) and Position-Specific Iterated BLAST (PSI BLAST) did not identify orthologous proteins and/or motifs in ORF1, ORF3, or ORF4. However, subsequent PHMMER analyses indicated that ORF2 of RNA1 encodes a 161 amino acid (aa) virion protein based on its similarity to a putative virion protein from spider-associated Loderio virus (NC_031748) [115]. AnBV-1 RNA 1 ORF2 shares 25.7% aa identity with Loderio virus ORF3, which is a 193 aa protein in the European Molecular Biology Laboratory database (EMBL-EBI), and both of these proteins fall into the SP24 (PF16504) family (Uniprot A0A1D9CFP5).
To construct a maximum likelihood phylogeny of viral RNA-dependent RNA polymerases (RdRp), 57 protein or polyprotein sequences were selected from a published list of insect and plant infecting viruses and were downloaded from NCBI (access data October 2020) [49]. These sequences were aligned using the LINSI option in MAFFT [116]. Columns composed of ≥80% gaps were removed from the alignment with Trimal before the alignment was manually inspected to remove sequences composed primarily of gapped positions [117]. ProtTest 3 was used to determine the best model for phylogenetic tree building and the alignment was used to construct a tree in PhyML with the BLOSUM62 + I + G model [118,119]. The resulting tree was rendered in FigTree [120]. GenBank accession numbers for either the RdRp sequences or the genome sequences from where the RdRp sequence obtained are as follows: Q9J5U7.1, BAU68080.1, NP_077730.1, YP_009160324.1, YP_009159826.1, YP_009143521.1, YP_009111338.1, YP_009032634.1, YP_009026384.1, YP_007761581.1, NP_042510.2, YP_003622540.1, YP_001718499.1, YP_001040002.1, NP_853560.2, YP_145791.1, YP_052864.1, NP_945134.1, NP_932306.1, NP_919040.1, NP_851403.1, NP_690806.1, NP_690839.1, NP_663297.1, NP_620648.1, NP_620564.1, NP_619751.1, NP_613283.1, NP_604464.1, NP_599247.1, NP_056825.2, NP_203553.1, NP_116487.1, NP_068549.1, NP_066241.1, NP_037647.1, NP_049374.1, NP_044335.1, NP_041277.1, ASU47554.1, ANH71250.1, CAB95006.3, AFR34027.1, ACU32794.1, AEH26189.1, AEH26193.1, QAY29244.1, YP_009552019.1, YP_009337113.1, QED21532.1, ANG56339.1, YP_009336934.1, AZS32325.1, YP_009333257.1, YP_009345113.1, YP_009337165.1.

2.15. Statistical Modeling of AnBV-1 Prevalence in the Field

To explain the prevalence of AnBV-1 in honey bees, we used three explanatory variables: (1) infected Andrena forager density, (2) the species diversity of floral resources utilized by honey bees in the habitat, and (3) the abundance of floral species that were shared between Andrena and honey bees in each site (scaled to 10,000 floral units to enable model convergence). Infected Andrena forager density was estimated for each site using the proportion of virus-positive Andrena individuals from the virological sample (median n = 11 per site), multiplied by the number of Andrena individuals collected in the bee forager sampling. The diversity of floral resources utilized by honey bees in each site was calculated using the Shannon diversity index, weighing species abundances based on their relative utilization by honey bees, as observed across all sites in the survey.
We used package lme4 in R version 4.0.3 to fit the data with generalized linear mixed effect models (GLMMs) with binomially-distributed errors and logit link functions [110,121]. The infection status (AnBV-1 present/absent) of individual honey bees was used as the response variable. The saturated model included all three explanatory variables, and the interaction term between infected Andrena density and shared flower abundance. Sites were included in all models as a random intercept factor. We also fitted reduced forms of the saturated model, as well as a null model that included only the site random factor. All models were ranked by their AICc scores using package bbmle [122]. The model with the lowest AICc score was selected as the best model and used for inference, and any model with ΔAICc >2 was considered significantly weaker. The overall significance of the best model is represented by its ΔAICc from the null. Model diagnostics were performed using package DHARM [123]. To exclude the possibility of spatial autocorrelation between adjacent plots (direct statistical testing is not possible in a sample of 14 sites [124]), we examined the distances between the three sites (Ramat Beit Shemesh 2, Luzit, and Srigim) that had the greatest AnBV-1 prevalence in honey bees, and found that they were far apart from each other (11.5 km, 7.9 km, and 4.4 km) and beyond the typical ~2 km foraging range of the majority of honey bee foragers) [22], whereas their five nearest sites (within 2 km) had zero AnBV-1 prevalence in honey bees.

3. Results and Discussion

3.1. Metatranscriptome Assessment of Viruses in Sympatric Bee Species

To investigate the degree of virus overlap and transmission between sympatric bee species in different environments, we collected samples of foraging bees from 14 sites in Israel. These sites were classified as high or low floral diversity and high or low honey bee activity and sampled on a single date between 13 March and 1 April 2018 (Figure 1). Over 2323 bees were observed and 1331 were collected. The most predominant bee taxa were Apis mellifera (honey bees, n = 263) and Andrena species, commonly known as mining bees (n = 876). Therefore, these bee taxa were the focus of our investigation (Figure 1 and Supplementary Table S1). The Andrena species in this study included A. combusta ocraceohirta, A. aerinifrons levantina, and A. urfanella, and an unidentified morphospecies of the subgenus Truncandrena. Distinct bee species may differentially contribute to interspecific virus spread. However, we considered these congeneric Andrena species as a single epidemiological population, because they are closely related phylogenetically and also share similar ecological niches with respect to phenology, dial activity, nesting habits, and diet. They are yellow mustard specialists, and we observed that greater than 96% of their floral visits were on Sinapis alba and Hirschfeldia incana.
The majority of honey bee-infecting viruses are single-stranded positive-sense RNA viruses (+ssRNA) (reviewed in [42,43,44]). To identify bee-associated viruses, RNA was extracted from 9 to 11 individual bees per taxon per site, and samples were pooled by bee taxon (i.e., Apis mellifera or Andrena spp.) for each of eight sites representing four distinct classifications including: low floral diversity and low honey bee activity, high floral diversity and high honey bee activity, high floral diversity and low honey bee activity, and low floral diversity and high honey bee activity. Ten species-specific sequencing libraries were generated from honey bees and mining bees obtained from eight representative sites (Figure 1). In addition, two virus-augmented libraries (one from Apis mellifera samples and one from Andrena spp. samples) were prepared and sequenced on an Illumina Hiseq (paired-end 200 nt) resulting in an average of 44.4 million reads per bee transcriptome library and 8 million reads per virus-augmented library (Supplementary Table S2, BioProject ID PRJNA687318 SRA files). The majority of reads in the A. mellifera sequencing libraries aligned to the A. mellifera genome (Amel_HAv3.1) and were removed from further analysis, as were any reads in the Andrena spp. libraries that aligned to the A. mellifera genome (Supplementary Table S2) [125,126]. The remaining reads (i.e., non-honey bee) were then aligned to previously characterized honey bee virus and virus-like sequences [49,59,60,100,104,127,128,129,130] (Supplementary Tables S9 and S10). The most frequently detected viruses in these sequencing libraries included black queen cell virus (BQCV), deformed wing virus (DWV), sacbrood virus (SBV), the DNA virus Apis mellifera filamentous virus (AmFv), and members of the more sequence-divergent Lake Sinai virus group [111,131,132,133]. To facilitate discovery of previously unreported virus strains and virus-like sequences, sequence reads corresponding to non-viral pathogens, including the parasites Varroa destructor and Lotmaria passim (formerly known as Crithidia mellificae, strain sf), were removed [100,104,130]. The remaining sequences were de novo assembled into contiguous overlapping DNA segments (contigs) using Trinity [134]. The most abundant contigs were further characterized and described herein as a novel, bipartite, positive-sense single-stranded RNA virus, Andrena-associated bee virus-1 (AnBV-1, MW397640).

3.2. Sequence Variants of Bee-Infecting Viruses: Black Queen Cell Virus, Deformed Wing Virus, and Members of the Lake Sinai Virus Group

RNA viruses replicate using virally encoded RNA-dependent RNA polymerases (RdRp), which typically have higher error rates than DNA-dependent DNA polymerases and often lack proof-reading capabilities [135]. Therefore, an actively replicating RNA virus results in millions/billions of sequence variants, referred to as quasispecies [136,137,138]. The degree of variation that warrants a new virus strain is not well established for all viruses and thus the term “sequence variant” is often used to describe a sequence that differs from previously reported viral genomes.
To assess variation in this sample cohort, sequences corresponding to well-characterized honey bee-infecting viruses, including BQCV, DWV-A, DWV-B/VDV-1, SBV, and representative LSVs were binned following identification using BLAST and assembled into contigs [106]. Unique representative contigs were aligned to corresponding viral genome reference sequences in order to identify the most similar viral genome currently reported in the NCBI database, which was used as a scaffold for contig assembly. Consensus sequences that represent the majority sequences of the viral variants described herein (i.e., Israel-2018 variants) were deposited in the NCBI database.
This analysis revealed nucleotide differences in black queen cell virus, deformed wing virus, and Lake Sinai virus genomes that may have precluded reliable detection of these viruses using commonly employed primers, which were developed based on virus genome sequences obtained from other geographic locations (e.g., United States, Germany, Belgium, and China). Therefore, new qPCR primers were designed for future quantification of the relative virus abundance in honey bee and mining bee samples obtained in this study (Supplementary Table S3).

3.2.1. Black queen cell virus

The BQCV variant identified in this study, BQCV Israel-2018 (MW397638), shares the greatest percent nucleotide identity (i.e., 90%) with a BQCV variant (MH267693) associated with bees obtained in 2009 from mite-resistant honey bee colonies on the Island of Gotland, Sweden (Supplementary Figure S1) [139]. Nucleotide alignment of the consensus sequence identified herein revealed numerous single-nucleotide polymorphisms, which were avoided in qPCR primer design. The depth sequence coverage for BQCV Israel-2018 varied by site and was greatest in the Apis mellifera library generated from the Ramat Beit Shemesh (RBSh) site (i.e., up to 6601x coverage) (Figure 2). This sampling site was dominated by Hirschfeldia incana (Mediterranean mustard) and a high degree of honey bee activity (Figure 1 and Supplementary Table S1).
Deformed wing virus strains commonly infect honey bees, replicate in and are transmitted by Varroa destructor mites that parasitize honey bees, and infect native and wild bee species and other insects [52,55,65,79,80,86,88,140,141]. Infection of developing honey bees may result in wing deformities that result in death during or shortly after emergence, whereas viral load and the ill effects of virus infection vary in adults, which can harbor between 1 × 105 to ≥ 5 × 1012 viral RNA copies per bee (estimated from qPCR values ≥2 × 109 copes/100 ng RNA and a total RNA per bee ~50 mg) [61,89,91,142,143,144]. Deformed wing virus infections have been associated with small colony population size and overwinter losses [89,95,145], and DWV infections coupled with high infestation of Varroa destructor mites, which also vector DWV, can kill colonies [69,78,146,147,148].
The DWV strains described in the literature include DWV-A, DWV-B (also called VDV-1), and DWV-C, as well as recombinant viruses [127,144,149,150]. DWV-A and DWV-B share approximately 84% nucleotide identity [70], and DWV-A/B recombinants are the most predominantly reported in literature in the US, Israel, and Europe (reviewed in [42,45,146]). Experimental evidence indicates that pupae infected with either DWV-A or DWV-B, and recombinant DWV-A/B viruses, can develop deformed wing pathology [144,151,152]. The deformed wing virus consensus sequence obtained in this study, DWV Israel-2018 (MW397639), is 97.3% identical to a recombinant DWV sequence (HM067438), which was originally described as having 5′ and 3’ untranslated regions (UTRs) that are more similar to DWV-A, and a central protein encoding region more similar to DWV-B [127,144] (Supplementary Figures S2 and S3 and Table S4). Although DWV Israel-2018 and DWV-HM067438 share 97.3% nucleotide identity across most of the genome, they are divergent in a small region within the 5′ end of the polyprotein coding sequence (i.e., nucleotides 1160–1540). In this small region, DWV Israel-2018 best aligns to DWV-A (NC_004830; Supplementary Figure S3). DWV Israel-2018 is similar to DWV-B strains in that it has an 11 nt gap when aligned with DWV-A strains (Supplementary Figure S3). Together, this and other studies indicate that recombinant strains are prevalent and abundant. Overall, the extent of DWV variability and abundance may be under appreciated since most studies quantify viruses using primers that amplify short products from conserved regions of the genome, including the RNA-dependent RNA polymerase encoding region (Figure 2). The depth of sequence coverage was highest in the Apis mellifera library generated from the Galon3 site (GB3) which was dominated by white mustard (Sinapis alba), but had low honey bee activity on the sample date (Figure 2). The depth of sequence coverage was very high over most of the genome (i.e., up to 121,593× coverage).

3.2.2. Lake Sinai virus

Lake Sinai virus-1 (LSV-1) and Lake Sinai virus-2 (LSV-2) were the first two viruses identified in what is now recognized as the Sinaivirus group, which includes over 200 NCBI sequence entries ranging in nucleotide identity from ~63% to 100% (Supplementary Table S5) [61,111,132]. LSV-1 and LSV-2, which serve as type species for this group, are 71% identical at the nucleotide level and are also distinguished by differences in their protein coding regions [61]. The LSV-1 capsid encoding region overlaps with the RdRp gene in the +1 reading frame for 125 nt before ending in a pair of stop codons, whereas the LSV-2 capsid is in frame with the RdRp [61]. The protein coding regions of LSV-2 are separated by 18 nt, whereas other isolates, including those described from a 2015 Belgium sample cohort, contain a variable spacer (19–23 nt) between the capsid protein and the RdRp protein encoding region [153].
The majority of the unique LSV contigs in this study were most similar to LSV-2 (HQ888865). The LSV-2 contigs included the longest (up to 5997 nt) and most abundant contig (2.4 million estimate counts or 49,514 transcripts per million (tpm)), which accounted for 37.4% of the LSV-2 contigs that were clearly assigned to a particular NCBI designated LSV species/strain. Contigs most similar to LSV-NE (NC_035113) were also well represented in sequence libraries (i.e., accounting for 41% of easily assigned unique contigs, including a 5952 nt in length contig with an estimated read count of 251,659).
The LSV-2 Israel-2018 consensus sequence (MW397637) identified in this study, via alignment and assembly of unique LSV-2 contigs >400 nt, was 77% identical to LSV-2 (HQ888865) (Supplementary Figure S4 and Table S5). Interestingly, the LSV-2 Israel-2018 consensus sequence and LSV-2 HQ888865 sequence share less nucleotide identity from nucleotide position 2006 to 2156, whereas this region of LSV-1 (HQ871931) and LSV-2 (HQ888865) virus strains is identical (i.e., 2105−2231). LSV-2 Israel-2018 sequence coverage was greatest in the Apis mellifera library from the RBSh site, with up to 326,028x coverage in the middle of the genome and over 50,000x coverage at the 5′ and 3′ ends of the genome (Figure 2). The capsid and RdRp encoding regions of this variant were separated by 19 nucleotides.
The LSV-NE Israel-2018 consensus sequence (MW397636) is most similar to LSV-NE sequence (NC_035113) with which it shares 84% nucleotide identity (Supplementary Figure S5 and Table S5). Unique contigs (>400 nt) assembled from RNAseq reads provided up to 12× contig coverage. However, it is important to note that this does not depict true sequencing depth, which is illustrated in Figure 2 with coverage of up to 198,843× in the Apis mellifera sequencing library from the Berko2 (B2) site, which had high floral diversity and low honey bee activity. LSV-NE contig 51 was the longest (5952 nt), well-represented contig (i.e., 9209 tpm and 251,659 estimated read counts (Supplementary Figure S5)).
High-throughput sequencing of representative samples obtained from this sample cohort was essential in the development of new qPCR primers designed to detect the viral variants in this study (Supplementary Table S3). This result underscores the importance of full sequence characterization prior to the assessment of relative viral abundance in samples obtained in different parts of the world, and likely for any sample cohort due to the quasispecies nature of RNA viruses and the potential for consensus sequence drift over time in all geographic areas. High-throughput sequencing was used to characterize the virus genomes in this study, but sequencing across a larger target nucleotide range using multiple primer sets would likely be sufficient. In addition, for some studies, designing primers for more conserved areas of the genome (i.e., the RdRp encoding region) may be best, whereas other studies may require specific primer sets for particular viral strains [111,149].

3.3. Novel Bipartite Positive-Sense RNA Virus Identified in Andrena Mining Bees

A novel bipartite positive-sense single-stranded RNA virus, Andrena-associated bee virus-1 (AnBV-1), was discovered via high-throughput sequencing of RNA samples from mining bees. Virus discovery efforts focused on sequence data obtained from “virus-augmented” sequence libraries, which were generated from RNA isolated from nuclease treated lysates of pooled mining bee or honey bee samples. The purpose of nuclease treatment prior to RNA isolation was to digest all unprotected, non-encapsidated nucleic acid in bee lysates and thus augment the amount of nucleic acid that was protected by virus capsids in sequencing libraries. Assembly of contigs, using Trinity, from reads that did not align with the Apis mellifera genome nor with the non-viral sequences in the bee holobiome revealed two large, novel contigs that we named AnBV-1 RNA 1 (2005 nt) and RNA 2 (2721 nt) (Supplementary Figures S6 and S7) [100,134]. These contigs were the most abundant virus-like contigs in the Andrena spp. virus-augmented library. They are also unique, as nucleotide BLAST analyses of either RNA segment resulted in no significant returns. To ensure that these contigs were not the result of assembly errors, the sequences were confirmed by PCR amplification coupled with Sanger (chain termination) sequencing (Supplementary Figure S8). Attempts to bridge the two contigs using combinations of forward and reverse primers from the individual contigs failed, and thus supported assembly data indicating that the AnBV-1 genome is bipartite (Supplementary Table S3). Collectively, these data suggest that the two contigs are derived from AnBV-1, a novel bipartite positive-sense single-stranded RNA virus (MW397640, MW397641).
High-throughput sequencing coverage of AnBV-1 was greatest in the library prepared from Andrena spp. collected at the Ramat Beit Shemesh (RBSh) site, which had low floral diversity and high honey bee activity. AnBV-1 coverage reached up to 1.45 × 106-fold for RNA 1 and up to 5.9 × 105-fold for RNA 2 (Figure 2). AnBV-1 coverage was also high from RNA extracted from a virus-augmented (i.e., nuclease treated) lysate obtained from a single Andrena bee sample that was positive for AnBV-1, but not positive for several other bee viruses, as assessed by virus/sequence-specific polymerase chain reaction (PCR) (i.e., LSV-U, IAPV, CBPV, KBV, and ABPV) and quantitative PCR for SBV, BQCV, LSV, DWV, and AmFV (Supplementary Figures S9 and S10). Rapid Amplification of cDNA Ends (RACE) in conjunction with Sanger sequencing was performed to confirm the sequence of RNA termini, which notoriously difficult to sequence due to potential RNA structure and/or repetitive sequence.
AnBV-1 open reading frames (ORFs) were predicted in SnapGene Viewer and Geneious Prime (Figure 3A and Supplementary Figures S6,7). Predicted ORF sequences and their translations were queried with BLAST and PHMMER online utilities [113,114]. AnBV-1 RNA 1 encodes four predicted ORFs. The largest, ORF1, is 1740 nt in length and encodes a putative 540 aa protein. Initial BLAST analyses did not identify orthologous proteins and/or motifs in ORF1, ORF3, or ORF4. However, PHMMER analyses indicated that ORF2 of RNA 1 encodes a 161 amino acid (aa) virion protein based on its similarity to a putative virion protein from spider-associated Loderio virus (NC_031748) [115]. AnBV-1 RNA 1 ORF2 shares 25.7% aa identity with Loderio virus ORF3, which is a 193 aa protein in the European Molecular Biology Laboratory database, and both of these proteins fall into the SP24 family (PF16504, Uniprot A0A1D9CFP5). This protein family includes SP24, which is a 24 kD structural protein, in a family of putative virion membrane proteins of plant and insect viruses, including the honey bee-infecting chronic bee paralysis virus. Chronic bee paralysis virus (CBPV), like AnBV-1, has a bipartite genome structure [154]. The putative CBPV capsid protein is a 183 aa protein encoded by ORF3 of RNA 2 (NC_010712). The putative AnBV-1 and CBPV capsid proteins share 21.3% aa identity. Further support of AnBV-1 RNA 1 ORF2 encoding a virion protein was obtained from an HHpred search of the Pfam database (Pfam-A v33.1) which returned the ‘SP24; putative virion membrane protein of plant and insect virus’ as a top match (e-value = 0.00091) [155].
Analysis of the two largest open reading frames of AnBV-1 RNA 2 using BLASTp indicates that ORF2 encodes the putative RNA-dependent RNA polymerase (RdRp) (Supplementary Figures S7,11). The putative 499 aa AnBV-1 RdRp sequence produces the strongest alignment with a putative Castleton Burn virus RNA-dependent RNA polymerase, (BLASTp e-value = 0), which was identified by sequencing bumble bee samples (Supplementary Figure S11) [156]. The RNA-dependent RNA polymerase proteins of AnBV-1 and Castleton Burn virus are similar. However, they share only 53.3% amino acid identity (Supplementary Figure S11).
To gain further insight into the relationship between AnBV-1 and other insect-infecting viruses, including common well-characterized honey bee viruses in the Dicistroviridae (i.e., ABPV, BQCV, IAPV, KBV), Iflaviridae (i.e., DWV-A, DWV-B/VDV-1), and Sinaiviridae (e.g., LSV-1, LSV-2, LSV-NE) families, we constructed a phylogenetic tree of viral RdRp amino acid sequences. This analysis revealed that the AnBV-1 RdRp sequence forms a well-supported monophyletic clade with sequences from tombus-like viruses. In particular, these results indicate that, based on their RdRp sequences, AnBV-1 shares a most recent common ancestor with Castleton Burn virus (Figure 3).
Sequence and phylogenetic data indicate that AnBV-1 is a positive-sense single-stranded RNA virus (+ssRNA). Therefore, like other +ssRNA viruses, a negative-strand copy of the viral genome must be produced during viral replication, as it serves as the template for the production of viral transcripts and full-length genome segments. Strand-specific reverse-transcription (RT)-PCR was performed on RNA isolated from AnBV-1-positive samples. Visualization of AnBV-1 RNA 1 and RNA 2 products from negative-strand targeting reactions indicate that AnBV-1 productively infects bees (Supplementary Figure S12).

3.4. Andrena-associated bee virus-1 (AnBV-1) is More Prevalent in Mining Bees

The prevalence and abundance of AnBV-1 in honey bees and mining bees, which represents a single sampling date at each of 14 sites, was assessed at the individual bee level by qPCR (Supplementary Table S6). AnBV-1 was more prevalent in mining bees. Specifically, 71 of the 148 mining bee samples analyzed were AnBV-1 positive (48%), whereas 22 of the 143 honey bee samples analyzed were AnBV-1 positive (15%) (X2 = 44.057, df = 1, and * p-value = 3 × 10−11) (Figure 4). Comparison of AnBV-1 RNA 1 or RNA 2 copy number in individual AnBV-1-positive bee samples indicate that AnBV-1 RNA 1 abundance was greater in mining bees compared to honey bee samples (p = 0.0279), whereas the difference in RNA 2 abundance was not significant, p = 0.29 (Figure 4). Since qPCR values represent differences in RNA abundance, including both genomic and messenger RNAs (transcripts), differences in the quantities of the AnBV-1 RNA segments may be biological and/or due to differences in qPCR efficiencies (Supplementary Table S6). Together, these data indicate that AnBV-1 is more prevalent and abundant in mining bees.

3.5. AnBV-1 Replicates in Primary Honey Bee Pupal Cell Cultures

Since AnBV-1 was detected in honey bees, albeit in lower frequency and abundance, and honey bee cells support the replication of other bee-infecting viruses including SBV, IAPV, DWV, and BQCV [157,158,159], we examined the ability of AnBV-1 to infect and replicate in primary honey bee pupal cells maintained in culture. The inoculum for infection studies was clarified lysate obtained from a single Andrena sample with high AnBV-1 abundance (1.3–2.6 × 108 copies AnBV-1 per µl lysate). Mock infections were carried out with clarified lysate obtained from a separate individual Andrena sample without detectable levels of AnBV-1 (Figure 5). Samples from three independent replicates of honey bee pupal cell cultures were harvested at 0, 1, 2, 4, 5, and 7 days post-infection (dpi) (Figure 5 and Supplementary Figure S13). Assessment of the abundance of AnBV-1 RNA 1 and RNA 2 by qPCR indicated virus replication by 4 or 5 days post-infection in three replicates (Supplementary Figure S13). The abundance of housekeeping gene Rpl8 was consistent in each AnBV-1 and mock sample in all replicates, indicating that the cells were not dying, senescing, nor differentially replicating during the course of this experiment (Supplementary Table S7). When combined, median AnBV-1 RNA 1 levels at 4 dpi (3.6 × 107 +/−2.9 × 106 copies per 24 ng RNA) were greater than at 0 dpi (1.4 × 107 +/−1.5 × 106 copies per 24 ng RNA) (Figure 5A, left panel, p-value = 0.0714). Though a similar trend was observed for AnBV-1 RNA 2, the increase was not statistically significant until 7 dpi (5 × 107 +/−2.5 × 106 copies per 24 ng RNA) as compared to 0 dpi (1.2 × 107 +/−3.4 × 106 copies per 24 ng RNA) (Figure 5A, right panel, p-value = 0.0095), which is likely a reflection of the low sample size (i.e., n = 2−6 per time point) due to the limited availability of honey bee pupal cells for infection in the late fall in Montana, when honey bee queens cease egg laying in preparation for winter. Together the increasing trend in AnBV-1 RNA, which persisted until the conclusion of the experiments at 7 dpi, indicates that AnBV-1 replicates in honey bee pupal cells (Figure 5 and Supplementary Figure S13). To provide further evidence of AnBV-1 replication in cultured primary honey bee cells, strand-specific qPCR was carried out on select samples. Results indicate an upward trend in AnBV-1-negative strand abundance over the course of infection (Figure 5B). Levels of AnBV-1 RNA 1 and RNA 2 were approximately 2–3 fold greater at 7 dpi as compared to 1 dpi, confirming that AnBV-1 replicates in primary honey bee pupal cells.

3.6. Sequence Analyses Indicate Virus Transmission between Sympatric Bee Species

Previous studies that indicated viruses were shared among sympatric bee taxa based their conclusions on the phylogenetic similarity of viral RdRp or capsid amino acid sequences, which represent only a portion of the viral genomes [54,56,64,87,160]. Herein, we compared nucleotide identity over entire viral genomes. Viral genome sequences with greater than 90% nucleotide identity are likely shared, as this level of variation can be easily explained by the RNA diversity generated during viral genomic replication [137]. Virus consensus sequence data from specific sites and from the virus-augmented sequencing libraries indicate that viruses are transmitted between honey bees and mining bees. However, sequence data from samples pooled by site and by bee taxa indicate the suite of viruses in sympatric honey bees and mining bees was not always shared. Sequence data indicate that AnBV-1 is transmitted between mining bees and honey bees, as the consensus sequences obtained from both site-specific and virus-augmented sequencing libraries share over 99% nucleotide identity. Likewise, DWV virus transmission between species was supported by 92% nt sequence identity in the RbSh site and in the entire sample cohort (i.e., virus-augmented libraries shared 97% nt identity). Similarly, interspecies transmission of BQCV sequences was indicated at the RBSh site (i.e., 96% nt identity), though the coverage was lower in the mining bee sample compared to the honey bee sample. The high degree of similarity in the Lake Sinai virus group made it difficult to assess potential transmission between bee species. Sequence data indicated that LSV-NE is transmitted between honey bees and mining bees, which shared over 97% nucleotide identity in the regions of the genome with sufficient coverage in the mining bee sample (i.e., ~50% of the genome, nt positions 700–1600 and 2800 to 4400), whereas the potential of LSV-2 transmission could not be adequately assessed by sequence analysis alone. Together, data from this single-time point, multiple-site observational cohort study indicate that viruses are transmitted between honey bees and mining bees. Sequence analysis alone is insufficient to assess the directionality of transmission. Furthermore, it is likely that for many bee-infecting viruses, interspecific virus transmission is multidirectional (i.e., viruses are transmitted among several bee and other insect species), and influenced by additional parameters including parasitic vectors, co-infection status, species density, habitat quality, and sample date. Therefore, studies that longitudinally monitor the prevalence and abundance in the context of numerous other factors that may impact virus transmission are required in order to better understand bee virus ecology.

3.7. The Probability of AnBV-1 Infection in Honey Bees Is Modulated by the Floral Community

Since interspecies virus transmission may occur between sympatric bee species foraging on shared floral resources, we investigated patterns of virus spread in honey bee and mining bee populations in the context of the floral community and infected mining bee density in the habitat. The field data were fit with statistical models of AnBV-1 prevalence in honey bees, with the following explanatory variables: (i) the density of AnBV-1-infected mining bees, (ii) the species diversity of flowers utilized by honey bees, and (iii) the abundance of flowers of plant species visited by both mining bees and honey bees. In this study, honey bees, which are generalist pollinators, visited more flower species than the mining bees, which preferred to forage on yellow mustards (i.e., Brassicaceous plants) (Supplementary Figure S14). In the best fit model, AnBV-1 infection prevalence in honey bees was most strongly associated with low floral diversity (p < 0.0001) (Figure 6B). Indeed, AnBV-1 infections in honey bees were detected in sites with low floral diversity and were absent in honey bees in high floral diversity sites (Figure 6C and Supplementary Table S6). These results suggest a strong effect of epidemiological dilution by flower species diversity [161,162,163,164]; in sites with high floral diversity, the generalist honey bees can forage on a wide range of floral species, and therefore their exposure to flowers that are visited by mining bees, which primarily forage on yellow mustard plants, is reduced. The correlation between low flower diversity and AnBV-1 infection in honey bees can also be explained by other, non-mutually-exclusive mechanisms. For example, honey bees foraging in sites with high floral diversity may benefit from higher quality nutritional resources, which may increase their resilience against virus infections [141,165,166,167].
The density of AnBV-1-infected mining bees alone did not have a consistent effect on AnBV-1 infection prevalence in honey bees (p = 0.1496) (Figure 6B). However, its effect varied in magnitude, depending on the abundance of shared floral species between mining bees and honey bees (interaction p = 0.0038) (Figure 6C). This suggests, epidemiological dilution by flower abundance. Since flowers can serve as virus transmission hubs [161], the number of AnBV-1 contaminated flowers can be diluted by many non-contaminated flowers, reducing the probability of sharing the same individual flowers between an infected mining bee and an uninfected honey bee. At very high densities of AnBV-1-infected mining bees, the impact of shared flower abundance in sites with low floral diversity appears to reverse (Figure 6B, red lines), perhaps because of honey bee recruitment to dominant floral resources [168]. In habitats with low floral diversity and a low abundance of flowers (e.g., Luzit) that are shared with mining bees, AnBV-1 infection in honey bees can occur even in the absence of detected AnBV-1 infection in mining bees (Figure 6B). The observation that AnBV-1 infections were detected only in honey bees at the Luzit site, which had low floral diversity and high honey bee activity, indicates that AnBV-1 may also spread between co-foraging honey bees (Supplementary Table S6). Whereas the relationships observed here are consistent with those expected under interspecific transmission through shared flowers, and similar to reported results from other studies that followed the temporal dynamics of different pollinator pathogen infections [161], our field data were obtained on a single sample date, and it is likely that AnBV-1 infection prevalence in honey bees, mining bees, and other bees and insects not screened in our study varies with time. Therefore, prevalence at a particular sampling date represents the status of the system on a particular sampling date (or point in time).

4. Conclusions

In summary, data from this sample cohort underscore the importance of a broad investigation of the bee-associated virome and provide a framework for future investigation of bee virus ecology. The majority of bee-infecting viruses are RNA viruses, which often exist as quasispecies. Therefore, it is important to incorporate sequencing (e.g., high-throughput sequencing and/or targeted PCR with multiple primer sets per virus coupled with Sanger sequencing) to identify novel viruses and viral variants, prior to assessing viral prevalence and abundance at the individual bee, colony, and community levels. Virus discovery efforts have primarily focused on honey bees, but it is clear from this and other studies that the diversity of bee-infecting viruses is greater than currently appreciated. Likewise, detection of bee-infecting viruses, which are typically referred to as “honey bee-infecting viruses”, in a broad range of hymenopteran insects, indicates that investigation of interspecific virus transmission should consider a broader potential host range.
For this study, we opted to sample multiple sites, with distinct floral and bee communities, within a single blooming season and focus our analyses on the two most prevalent co-foraging bee taxa (i.e., Apis mellifera and four specialist Andrena spp.) and a novel bipartite +ssRNA virus named Andrena-associated bee virus-1 (AnBV-1) that replicates in mining bees, honey bees, and primary honey bee pupal cell culture. AnBV-1 was most prevalent and abundant in mining bees, though it was also detected in honey bees, albeit at lower frequency. Statistical modeling that examined the roles of ecological factors, including floral diversity and infected mining bee density, indicated that the probability of AnBV-1 infection in honey bees is greater in low-floral-diversity habitats, and suggested that interspecific transmission is strongly modulated by the floral community in the habitat. Future studies that examine the temporal dynamics of bee/insect density, virus prevalence and abundance, and habitat-associated parameters will be important to reveal patterns of virus transmission, clearance, and reinfection of bee taxa within bee communities. Likewise, studies aimed at understanding the impact of AnBV-1 on individual bees, bee colonies, and bee communities are required. It will also be interesting to investigate the impact of multiple viruses (individually and in the context of other co-infections) from the individual bee to community levels to determine their impact on bee behavior and pollination activity, and/or survival. The data from this study suggest effects of epidemiological dilution by floral diversity and abundance, and that interspecific virus transmission is modulated by the floral community in the habitat. Therefore, land management strategies that aim to enhance floral diversity and abundance may reduce AnBV-1 (and possibly other viruses) spread between co-foraging bees. Regardless of the impact of the bee/insect community virome, efforts aimed at enhancing and/or maintaining bee forage in managed and wild landscapes will likely benefit all plant and animal communities.

Supplementary Materials

The following are available online at https://www.mdpi.com/1999-4915/13/2/291/s1. Excel file with Supplementary Tables S1–S10, and combined pdf document with Supplementary Figures S1–S14. Supplementary Figure titles listed below for review: Supplementary Table S1. Sample site description. Supplementary Table S2. Summary of samples analyzed by high-throughput (RNAseq) sequencing and data summary. Supplementary Table S3. Primers used in this study. Supplementary Table S4. Percent nucleotide identity of select deformed wing virus (DWV) genomes. Supplementary Table S5. Percent nucleotide identity of select Lake Sinai virus genomes. Supplementary Table S6. Abundance of Andrena-associated bee virus-1 (AnBV-1) in individual bee samples. Supplementary Table S7. Positive and negative strand analysis of AnBV-1 RNA 1 and RNA 2 abundance in individual wells of honey bee pupal cells. Supplementary Table S8. Virus analysis in individual bee samples utilized as AnBV-1 inocula to infect primary honey bee pupal cells. Supplementary Table S9. Virus sequence source and NCBI identification numbers. Supplementary Table S10. Sequences downloaded from Schoonvaere et al. 2018 publication. Supplementary Figure S1. Black queen cell virus Israel-2018 nucleotide alignment with BQCV reference sequence. Supplementary Figure S2. Virus nucleotide alignments between reference sequence and DWV variant from Israel-2018. Supplementary Figure S3. Virus nucleotide alignments between reference sequences and DWV variant from Israel-2018. Supplementary Figure S4. Lake Sinai virus 2 Israel-2018 nucleotide alignment with LSV-2 reference sequence. Supplementary Figure S5. Lake Sinai virus NE Israel-2018 nucleotide alignment with LSV-NE Reference Sequence. Supplementary Figure S6. Andrena-associated bee virus-1 (AnBV-1) RNA 1. Supplementary Figure S7. Andrena-associated bee virus-1 (AnBV-1) RNA 2. Supplementary Figure S8. Sanger sequencing confirmation of AnBV-1 RNA 1 and AnBV-1 RNA 2 sequences. Supplementary Figure S9. Assessment of virus presence in Individual Andrena spp. lysates confirms absence of LSVs, IAPV, CBPV, KBV, and ABPV. Supplementary Figure S10. Andrena-associated bee virus-1 (AnBV-1) RNA 1 and RNA 2 RNAseq coverage from virus-augmented sequencing library. Supplementary Figure S11. Andrena-associated bee virus 1 (AnBV-1) RNA 2-RdRp. Supplementary Figure S12. AnBV-1 RNA 1 and RNA 2 negative strand detection. Supplementary Figure S13. AnBV-1 replicates in honey bee pupal cells—three independent replicates. Supplementary Figure S14. Visits distribution of Apis mellifera and Andrena spp. by flower species.

Author Contributions

Conceptualization, M.L.F., Y.M., A.S. and N.C.; methodology, M.L.F., C.C.C., Y.M., N.C., A.S., I.K., N.A., K.F.D., A.J.M., T.E. and N.A.; validation, K.F.D., C.C.C., M.L.F., I.K., A.S. and Y.M.; formal analysis, M.L.F., K.F.D., A.J.M., C.C.C., T.W., I.K., A.S and Y.M., investigation, M.L.F., K.F.D., A.J.M., C.C.C., I.K., N.A., T.E., A.S., B.R. and Y.M.; resources, Y.M., M.L.F., A.S. and N.C.; data curation, C.C.C., K.F.D. and M.L.F.; writing—original draft preparation, M.L.F., K.F.D., A.J.M., T.W., Y.M., A.S. and I.K.; writing—review and editing, M.L.F., C.C.C., K.F.D., A.J.M., B.W., T.W., N.C., A.S., Y.M., I.K. and B.R.; visualization, M.L.F., K.F.D., A.J.M., T.W., C.C.C., I.K. and A.S., supervision, M.L.F., Y.M., A.S. and N.C.; project administration, Y.M., M.L.F., and A.S.; funding acquisition, Y.M., M.L.F., A.S. and N.C. All authors have read and agreed to the published version of this manuscript.

Funding

The research described herein was funded by the United States-Israel Binational Science Foundation (BSF) (award number 2016383). Funding was awarded to Y.M., M.L.F., A.S., and N.C. In addition, A.J.M. is partially funded by the Project Apis m.-Costco Scholar Fellowship and M.L.F. is supported by the National Science Foundation CAREER Program (award number 1651561). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of this manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The majority of the data generated or analyzed during this study are included in this published article and its Supplementary Materials files (available online). Additional data are available from the corresponding author upon request, and sequence data are available on GenBank and the NCBI Sequence Read Archive (BioProject ID PRJNA687318). Custom bash and R scripts: https://github.com/charlieccarey/viral_transcriptome_of_bees.

Acknowledgments

We are grateful to Achik Dorchin and Gideon Pisanty, the Steinhardt Museum of Natural History, Tel-Aviv University, for help in the field and for identification of collected mining bee species. We thank Flenniken Lab members (Fenali Parekh and Naomi Kaku) for reviewing this manuscript prior to submission.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ollerton, J.; Winfree, R.; Tarrant, S. How many flowering plants are pollinated by animals? Oikos 2011, 120, 321–326. [Google Scholar] [CrossRef] [Scilit]
  2. Gallai, N.; Salles, J.-M.; Settele, J.; Vaissière, B.E. Economic valuation of the vulnerability of world agriculture confronted with pollinator decline. Ecol. Econ. 2009, 68, 810–821. [Google Scholar] [CrossRef] [Scilit]
  3. Michener, C.D. The Bees of the World, 2nd ed.; John Hopkins University Press: Baltimore, MD, USA; London, UK, 2007. [Google Scholar]
  4. Cariveau, D.P.; Nayak, G.K.; Bartomeus, I.; Zientek, J.; Ascher, J.S.; Gibbs, J.; Winfree, R. The Allometry of Bee Proboscis Length and Its Uses in Ecology. PLoS ONE 2016, 11, e0151482. [Google Scholar] [CrossRef] [Scilit]
  5. Kimoto, C.; Debano, S.J.; Thorp, R.W.; Rao, S.; Stephen, W.P. Investigating temporal patterns of a native bee community in a remnant North American bunchgrass prairie using blue vane traps. J. Insect Sci. 2012, 12, 108. [Google Scholar] [CrossRef] [Scilit]
  6. Gathmann, A.; Tscharntke, T. Foraging ranges of solitary bees. J. Anim. Ecol. 2002, 71, 757–764. [Google Scholar] [CrossRef] [Scilit]
  7. Wagner, D.L. Insect Declines in the Anthropocene. Annu. Rev. Entomol. 2020, 65, 457–480. [Google Scholar] [CrossRef] [Scilit]
  8. Van Klink, R.; Bowler, D.E.; Gongalsky, K.B.; Swengel, A.B.; Gentile, A.; Chase, J.M. Meta-analysis reveals declines in terrestrial but increases in freshwater insect abundances. Science 2020, 368, 417. [Google Scholar] [CrossRef] [Scilit]
  9. Duchenne, F.; Thebault, E.; Michez, D.; Gerard, M.; Devaux, C.; Rasmont, P.; Vereecken, N.J.; Fontaine, C. Long-term effects of global change on occupancy and flight period of wild bees in Belgium. Glob. Chang. Biol. 2020, 26, 6753–6766. [Google Scholar] [CrossRef] [Scilit]
  10. Goulson, D.; Nicholls, E.; Botias, C.; Rotheray, E.L. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 2015, 347, 1255957. [Google Scholar] [CrossRef] [Scilit]
  11. Mathiasson, M.; Rehan, S. Status changes in the wild bees of north-eastern North America over 125 years revealed through museum specimens. Insect Conserv. Divers. 2019, 12, 278–288. [Google Scholar] [CrossRef] [Scilit]
  12. Goulson, D.; Lye, G.C.; Darvill, B. Decline and Conservation of Bumble Bees. Annu. Rev. Entomol. 2008, 53, 191–208. [Google Scholar] [CrossRef] [Scilit]
  13. Cameron, S.A.; Lozier, J.D.; Strange, J.P.; Koch, J.B.; Cordes, N.; Solter, L.F.; Griswold, T.L. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. USA 2011, 108, 662–667. [Google Scholar] [CrossRef] [Scilit]
  14. Arbetman, M.P.; Gleiser, G.; Morales, C.L.; Williams, P.; Aizen, M.A. Global decline of bumblebees is phylogenetically structured and inversely related to species range size and pathogen incidence. Proc. R. Soc. B Biol. Sci. 2017, 284, 20170204. [Google Scholar] [CrossRef] [Scilit]
  15. Aizen, M.A.; Harder, L.D. The Global Stock of Domesticated Honey Bees Is Growing Slower Than Agricultural Demand for Pollination. Curr. Biol. 2009, 19, 915–918. [Google Scholar] [CrossRef] [Scilit]
  16. van Engelsdorp, D.; Meixner, M.D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J. Invertebr. Pathol. 2010, 103, S80–S95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Russo, L. Positive and Negative Impacts of Non-Native Bee Species around the World. Insects 2016, 7, 69. [Google Scholar] [CrossRef] [Scilit]
  18. Stork, N.E. How Many Species of Insects and Other Terrestrial Arthropods Are There on Earth? Annu. Rev. Entomol. 2018, 63, 31–45. [Google Scholar] [CrossRef] [Scilit]
  19. Langstroth, L. Langstroth on the Hive and the Honey Bee; Xist Publishing: Rosenberg, TX, USA, 2014. [Google Scholar]
  20. Beekman, M.; Ratnieks, F.L.W. Long-Range Foraging by the Honey-Bee, Apis mellifera L. Funct. Ecol. 2000, 14, 490–496. [Google Scholar] [CrossRef] [Scilit]
  21. Visscher, P.K.; Seeley, T.D. Foraging Strategy of Honeybee Colonies in a Temperate Deciduous Forest. Ecology 1982, 63, 1790–1801. [Google Scholar] [CrossRef] [Scilit]
  22. Couvillon, M.J.; Pearce, F.C.R.; Accleton, C.; Fensome, K.A.; Quah, S.K.L.; Taylor, E.L.; Ratnieks, F.L.W. Honey bee foraging distance depends on month and forage type. Apidologie 2015, 46, 61–70. [Google Scholar] [CrossRef] [Scilit]
  23. Soroker, V.; Hetzroni, A.; Yakobson, B.; David, D.; David, A.; Voet, H.; Slabezki, Y.; Efrat, H.; Levski, S.; Kamer, Y.; et al. Evaluation of colony losses in Israel in relation to the incidence of pathogens and pests. Apidologie 2011, 42. [Google Scholar] [CrossRef] [Scilit]
  24. Lee, K.V.; Steinhauer, N.; Rennich, K.; Wilson, M.E.; Tarpy, D.R.; Caron, D.M.; Rose, R.; Delaplane, K.S.; Baylis, K.; Lengerich, E.J.; et al. A national survey of managed honey bee 2013–2014 annual colony losses in the USA. Apidologie 2015, 46, 292–305. [Google Scholar] [CrossRef] [Scilit]
  25. Spleen, A.M.; Lengerich, E.J.; Rennich, K.; Caron, D.; Rose, R.; Pettis, J.S.; Henson, M.; Wilkes, J.T.; Wilson, M.; Stitzinger, J.; et al. A national survey of managed honey bee 2011–2012 winter colony losses in the United States: Results from the Bee Informed Partnership. J. Apic. Res. 2015, 52, 44–53. [Google Scholar] [CrossRef] [Scilit]
  26. Steinhauer, N.; van Engelsdorp, D. Using Epidemiological Methods to Improve Honey Bee Colony Health. In Beekeeping—From Science to Practice; Springer International Publishing: Cham, Switzerland, 2017; Volume 19, pp. 125–142. [Google Scholar]
  27. Steinhauer, N.A.; Rennich, K.; Wilson, M.E.; Caron, D.M.; Lengerich, E.J.; Pettis, J.S.; Rose, R.; Skinner, J.A.; Tarpy, D.R.; Wilkes, J.T.; et al. A national survey of managed honey bee 2012–2013 annual colony losses in the USA: Results from the Bee Informed Partnership. J. Apic. Res. 2015, 53, 1–18. [Google Scholar] [CrossRef] [Scilit]
  28. Traynor, K.S.; Rennich, K.; Forsgren, E.; Rose, R.; Pettis, J.; Kunkel, G.; Madella, S.; Evans, J.; Lopez, D.; vanEngelsdorp, D. Multiyear survey targeting disease incidence in US honey bees. Apidologie 2016, 47, 325–347. [Google Scholar] [CrossRef] [Scilit]
  29. van Engelsdorp, D.; Caron, D.; Hayes, J.; Underwood, R.; Henson, M.; Rennich, K.; Spleen, A.; Andree, M.; Snyder, R.; Lee, K.; et al. A national survey of managed honey bee 2010–11 winter colony losses in the USA: Results from the Bee Informed Partnership. J. Apic. Res. 2015, 51, 115–124. [Google Scholar] [CrossRef] [Scilit]
  30. van Engelsdorp, D.; Hayes, J.; Underwood, R.M.; Pettis, J. A Survey of Honey Bee Colony Losses in the U.S. Fall 2007 to Spring 2008. PLoS ONE 2008, 3, e4071. [Google Scholar]
  31. Bruckner, S.; Steinhauer, N.; Aurell, S.D.; Caron, D.M.; Ellis, J.D.; Fauvel, A.M.; Kulhanek, K.; McArt, S.; Mullen, E.; Rangel, J.; et al. 2018–2019 Honey Bee Colony Losses in the United States: Preliminary Results; The Bee Informed Partnership: Bethesda, MD, USA, 2020. [Google Scholar]
  32. Seitz, N.; Traynor, K.S.; Steinhauer, N.; Rennich, K.; Wilson, M.E.; Ellis, J.D.; Rose, R.; Tarpy, D.R.; Sagili, R.R.; Caron, D.M.; et al. A national survey of managed honey bee 2014–2015 annual colony losses in the USA. J. Apic. Res. 2015, 54, 292–304. [Google Scholar] [CrossRef] [Scilit]
  33. Kulhanek, K.; Steinhauer, N.; Rennich, K.; Caron, D.M.; Sagili, R.R.; Pettis, J.S.; Ellis, J.D.; Wilson, M.E.; Wilkes, J.T.; Tarpy, D.R.; et al. A national survey of managed honey bee 2015–2016 annual colony losses in the USA. J. Apic. Res. 2017, 56, 328–340. [Google Scholar] [CrossRef] [Scilit]
  34. Ascher, J.S. Pickering Discover Life Bee Species Guide and World Checklist (Hymenoptera: Apoidea: Anthophila). Available online: http://www.discoverlife.org/mp/20q?guide=Apoidea_species (accessed on 12 January 2020).
  35. Pisanty, G.; Richter, R.; Martin, T.; Dettman, J.; Cardinal, S. Molecular phylogeny and historical biogeography of andrenine bees (Hymenoptera: Andrenidae). bioRxiv 2020. [Google Scholar] [CrossRef] [Scilit]
  36. Paxton, R.J.; Thoren, P.A.; Tengo, J.; Estoup, A.; Pamilo, P. Mating structure and nestmate relatedness in a communal bee, Andrena jacobi (Hymenoptera, Andrenidae), using microsatellites. Mol. Ecol. 1996, 5, 511–519. [Google Scholar] [CrossRef] [Scilit]
  37. Michener, C.D. The Social Behavior of the Bees: A Comparative Study; Belknap Pr.: Cambridge, MA, USA, 1974. [Google Scholar]
  38. Wood, T.J.; Roberts, S.P.M. An assessment of historical and contemporary diet breadth in polylectic Andrena bee species. Biol. Conserv. 2017, 215, 72–80. [Google Scholar] [CrossRef] [Scilit]
  39. Larkin, L.L.; Neff, J.L.; Simpson, B.B. The evolution of a pollen diet: Host choice and diet breadth of Andrena bees (Hymenoptera: Andrenidae). Apidologie 2008, 39, 133–145. [Google Scholar] [CrossRef] [Scilit]
  40. Cornman, R.S.; Tarpy, D.R.; Chen, Y.; Jeffreys, L.; Lopez, D.; Pettis, J.S.; vanEngelsdorp, D.; Evans, J.D. Pathogen Webs in Collapsing Honey Bee Colonies. PLoS ONE 2012, 7, e43562. [Google Scholar] [CrossRef] [Scilit]
  41. Brutscher, L.M.; McMenamin, A.J.; Flenniken, M.L. The Buzz about Honey Bee Viruses. PLoS Pathog. 2016, 12, e1005757. [Google Scholar] [CrossRef] [Scilit]
  42. Grozinger, C.M.; Flenniken, M.L. Bee Viruses: Ecology, Pathogenicity, and Impacts. Annu. Rev. Entomol. 2019, 64, 205–226. [Google Scholar] [CrossRef] [Scilit]
  43. McMenamin, A.J.; Flenniken, M.L. Recently identified bee viruses and their impact on bee pollinators. Curr. Opin. Insect Sci. 2018, 26, 120–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Ryabov, E.V. Invertebrate RNA virus diversity from a taxonomic point of view. J. Invertebr. Pathol. 2017, 147, 37–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Beaurepaire, A.; Piot, N.; Doublet, V.; Antunez, K.; Campbell, E.; Chantawannakul, P.; Chejanovsky, N.; Gajda, A.; Heerman, M.; Panziera, D.; et al. Diversity and Global Distribution of Viruses of the Western Honey Bee, Apis mellifera. Insects 2020, 11, 239. [Google Scholar] [CrossRef] [Scilit]
  46. Gauthier, L.; Cornman, S.; Hartmann, U.; Cousserans, F.; Evans, J.; de Miranda, J.; Neumann, P. The Apis mellifera Filamentous Virus Genome. Viruses 2015, 7, 3798–3815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Hou, C.; Li, B.; Deng, S.; Chu, Y.; Diao, Q. Diagnosis and distribution of the Apis mellifera filamentous virus (AmFV) in honey bees (Apis mellifera) in China. Insectes Soc. 2017, 64, 597–603. [Google Scholar] [CrossRef] [Scilit]
  48. Galbraith, D.A.; Fuller, Z.; Brockmann, A.; Frazier, M.; Gikungu, M.W.; Kapheim, K.M.; Kerby, J.T.; Kocher, S.D.; Losyev, O.; Muli, E.; et al. Investigating the viral ecology of global bee communities with high-throughput metagenomics. Sci. Rep. 2018, 8, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Schoonvaere, K.; Smagghe, G.; Francis, F.; de Graaf, D.C. Study of the Metatranscriptome of Eight Social and Solitary Wild Bee Species Reveals Novel Viruses and Bee Parasites. Front. Microbiol. 2018, 9, 177. [Google Scholar] [CrossRef] [Scilit]
  50. Ravoet, J.; De Smet, L.; Meeus, I.; Smagghe, G.; Wenseleers, T.; de Graaf, D.C. Widespread occurrence of honey bee pathogens in solitary bees. J. Invertebr. Pathol. 2014, 122, 55–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Dolezal, A.G.; Hendrix, S.D.; Scavo, N.A.; Carrillo-Tripp, J.; Harris, M.A.; Wheelock, M.J.; O’Neal, M.E.; Toth, A.L. Honey Bee Viruses in Wild Bees: Viral Prevalence, Loads, and Experimental Inoculation. PLoS ONE 2016, 11, e0166190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Alger, S.A.; Burnham, P.A.; Boncristiani, H.F.; Brody, A.K. RNA virus spillover from managed honeybees (Apis mellifera) to wild bumblebees (Bombus spp.). PLoS ONE 2019, 14, e0217822. [Google Scholar] [CrossRef] [Scilit]
  53. Alger, S.A.; Burnham, P.A.; Brody, A.K. Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species. PLoS ONE 2019, 14, e0221800. [Google Scholar] [CrossRef] [Scilit]
  54. Tehel, A.; Brown, M.J.; Paxton, R.J. Impact of managed honey bee viruses on wild bees. Curr. Opin. Virol. 2016, 19, 16–22. [Google Scholar] [CrossRef] [Scilit]
  55. Zhang, X.; He, S.Y.; Evans, J.D.; Pettis, J.S.; Yin, G.F.; Chen, Y.P. New evidence that deformed wing virus and black queen cell virus are multi-host pathogens. J. Invertebr. Pathol. 2012, 109, 156–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Singh, R.; Levitt, A.L.; Rajotte, E.G.; Holmes, E.C.; Ostiguy, N.; van Engelsdorp, D.; Lipkin, W.I.; Depamphilis, C.W.; Toth, A.L.; Cox-Foster, D.L. RNA Viruses in Hymenopteran Pollinators: Evidence of Inter-Taxa Virus Transmission via Pollen and Potential Impact on Non-Apis Hymenopteran Species. PLoS ONE 2010, 5, e14357. [Google Scholar] [CrossRef] [Scilit]
  57. Radzevičiūtė, R.; Theodorou, P.; Husemann, M.; Japoshvili, G.; Kirkitadze, G.; Zhusupbaeva, A.; Paxton, R.J. Replication of honey bee-associated RNA viruses across multiple bee species in apple orchards of Georgia, Germany and Kyrgyzstan. J. Invertebr. Pathol. 2017, 146, 14–23. [Google Scholar] [CrossRef] [Scilit]
  58. de Miranda, J.; Cornman, R.; Evans, J.; Semberg, E.; Haddad, N.; Neumann, P.; Gauthier, L. Genome Characterization, Prevalence and Distribution of a Macula-Like Virus from Apis mellifera and Varroa destructor. Viruses 2015, 7, 3586–3602. [Google Scholar] [CrossRef] [Scilit]
  59. Remnant, E.J.; Shi, M.; Buchmann, G.; Blacquiere, T.; Holmes, E.C.; Beekman, M.; Ashe, A. A Diverse Range of Novel RNA Viruses in Geographically Distinct Honey Bee Populations. J. Virol. 2017, 91, e00158-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Levin, S.; Galbraith, D.; Sela, N.; Erez, T.; Grozinger, C.M.; Chejanovsky, N. Presence of Apis Rhabdovirus-1 in Populations of Pollinators and Their Parasites from Two Continents. Front. Microbiol. 2017, 8, 2482. [Google Scholar] [CrossRef] [Scilit]
  61. Runckel, C.; Flenniken, M.L.; Engel, J.C.; Ruby, J.G.; Ganem, D.; Andino, R.; DeRisi, J.L. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE 2011, 6, e20656. [Google Scholar] [CrossRef] [Scilit]
  62. Levin, S.; Sela, N.; Chejanovsky, N. Two novel viruses associated with the Apis mellifera pathogenic mite Varroa destructor. Sci. Rep. 2016, 6, 37710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Levin, S.; Sela, N.; Erez, T.; Nestel, D.; Pettis, J.; Neumann, P.; Chejanovsky, N. New Viruses from the Ectoparasite Mite Varroa destructor Infesting Apis mellifera and Apis cerana. Viruses 2019, 11, 94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Levitt, A.L.; Singh, R.; Cox-Foster, D.L.; Rajotte, E.; Hoover, K.; Ostiguy, N.; Holmes, E.C. Cross-species transmission of honey bee viruses in associated arthropods. Virus Res. 2013, 176, 232–240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Payne, A.N.; Shepherd, T.F.; Rangel, J. The detection of honey bee (Apis mellifera)-associated viruses in ants. Sci. Rep. 2020, 10, 2923. [Google Scholar] [CrossRef] [Scilit]
  66. Mordecai, G.J.; Brettell, L.E.; Pachori, P.; Villalobos, E.M.; Martin, S.J.; Jones, I.M.; Schroeder, D.C. Moku virus; a new Iflavirus found in wasps, honey bees and Varroa. Sci. Rep. 2016, 6, 1304. [Google Scholar] [CrossRef] [Scilit]
  67. Chen, Y.P.; Siede, R. Honey Bee Viruses. In Advances in Clinical Chemistry; Elsevier: Amsterdam, The Netherlands, 2007; Volume 70, pp. 33–80. [Google Scholar]
  68. Bowen-Walker, P.L.; Martin, S.J.; Gunn, A. The transmission of deformed wing virus between honeybees (Apis mellifera L.) by the ectoparasitic mite Varroa jacobsoni Oud. J. Invertebr. Pathol. 1999, 73, 101–106. [Google Scholar] [CrossRef] [Scilit]
  69. Nazzi, F.; Brown, S.P.; Annoscia, D.; Del Piccolo, F.; Di Prisco, G.; Varricchio, P.; Della Vedova, G.; Cattonaro, F.; Caprio, E.; Pennacchio, F. Synergistic Parasite-Pathogen Interactions Mediated by Host Immunity Can Drive the Collapse of Honeybee Colonies. PLoS Pathog. 2012, 8, e1002735. [Google Scholar] [CrossRef] [Scilit]
  70. Ongus, J.R. Complete sequence of a picorna-like virus of the genus Iflavirus replicating in the mite Varroa destructor. J. Gen. Virol. 2004, 85, 3747–3755. [Google Scholar] [CrossRef] [Scilit]
  71. Wilfert, L.; Long, G.; Leggett, H.C.; Schmid-Hempel, P.; Butlin, R.; Martin, S.J.M.; Boots, M. Deformed wing virus is a recent global epidemic in honeybees driven by Varroa mites. Science 2016, 351, 594–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Chen, Y.P.; Pettis, J.S.; Corona, M.; Chen, W.P.; Li, C.J.; Spivak, M.; Visscher, P.K.; De Grandi-Hoffman, G.; Boncristiani, H.; Zhao, Y.; et al. Israeli Acute Paralysis Virus: Epidemiology, Pathogenesis and Implications for Honey Bee Health. PLoS Pathog. 2014, 10, e1004261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Chen, Y.; Pettis, J.S.; Evans, J.D.; Kramer, M.; Fedlaufer, M. Transmission of Kashmir bee virus by the ectoparasitic mite Varroa destructor. Apidologie 2004, 35, 441–448. [Google Scholar] [CrossRef] [Scilit]
  74. Celle, O.; Blanchard, P.; Olivier, V.; Schurr, F.; Cougoule, N.; Faucon, J.-P.; Ribière, M. Detection of Chronic bee paralysis virus (CBPV) genome and its replicative RNA form in various hosts and possible ways of spread. Virus Res. 2008, 133, 280–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Eyer, M.; Chen, Y.P.; Schäfer, M.O.; Pettis, J.; Neumann, P. Small hive beetle, Aethina tumida, as a potential biological vector of honeybee viruses. Apidologie 2009, 40, 419–428. [Google Scholar] [CrossRef] [Scilit]
  76. Kwadha, C.A.; Ong’amo, G.O.; Ndegwa, P.N.; Raina, S.K.; Fombong, A.T. The Biology and Control of the Greater Wax Moth, Galleria mellonella. Insects 2017, 8, 61. [Google Scholar] [CrossRef] [Scilit]
  77. Traiyasut, P.; Mookhploy, W.; Kimura, K.; Yoshiyama, M.; Khongphinitbunjong, K.; Chantawannakul, P. First Detection of Honey Bee Viruses in Wax Moth. Chiang Mai J. Sci. 2016, 43, 695–698. [Google Scholar]
  78. Di Prisco, G.; Annoscia, D.; Margiotta, M.; Ferrara, R.; Varricchio, P.; Zanni, V.; Caprio, E.; Nazzi, F.; Pennacchio, F. A mutualistic symbiosis between a parasitic mite and a pathogenic virus undermines honey bee immunity and health. Proc. Natl. Acad. Sci. USA 2016, 113, 3203–3208. [Google Scholar] [CrossRef] [Scilit]
  79. Gisder, S.; Aumeier, P.; Genersch, E. Deformed wing virus: Replication and viral load in mites (Varroa destructor). J. Gen. Virol. 2009, 90, 463–467. [Google Scholar] [CrossRef] [Scilit]
  80. Martin, S.J.; Brettell, L.E. Deformed Wing Virus in Honeybees and Other Insects. Annu. Rev. Virol. 2019, 6, 49–69. [Google Scholar] [CrossRef] [Scilit]
  81. Yanez, O.; Piot, N.; Dalmon, A.; de Miranda, J.R.; Chantawannakul, P.; Panziera, D.; Amiri, E.; Smagghe, G.; Schroeder, D.; Chejanovsky, N. Bee Viruses: Routes of Infection in Hymenoptera. Front. Microbiol. 2020, 11, 943. [Google Scholar] [CrossRef] [Scilit]
  82. McArt, S.H.; Koch, H.; Irwin, R.E.; Adler, L.S. Arranging the bouquet of disease: Floral traits and the transmission of plant and animal pathogens. Ecol. Lett. 2014, 17, 624–636. [Google Scholar] [CrossRef] [Scilit]
  83. Koch, H.; Brown, M.J.F.; Stevenson, P.C. The role of disease in bee foraging ecology. Curr. Opin. Insect Sci. 2017, 21, 60–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  84. Mazzei, M.; Carrozza, M.L.; Luisi, E.; Forzan, M.; Giusti, M.; Sagona, S.; Tolari, F.; Felicioli, A. Infectivity of DWV Associated to Flower Pollen: Experimental Evidence of a Horizontal Transmission Route. PLoS ONE 2014, 9, e113448. [Google Scholar]
  85. Gisder, S.; Genersch, E. Viruses of commercialized insect pollinators. J. Invertebr. Pathol. 2017, 147, 51–59. [Google Scholar] [CrossRef] [Scilit]
  86. Tapia-González, J.M.; Morfin, N.; Macías-Macías, J.O.; De la Mora, A.; Tapia-Rivera, J.C.; Ayala, R.; Contreras-Escareño, F.; Gashout, H.A.; Guzman-Novoa, E. Evidence of presence and replication of honey bee viruses among wild bee pollinators in subtropical environments. J. Invertebr. Pathol. 2019, 168, 107256. [Google Scholar] [CrossRef] [Scilit]
  87. Fürst, M.A.; McMahon, D.P.; Osborne, J.L.; Paxton, R.J.; Brown, M.J.F. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature 2014, 506, 364–366. [Google Scholar] [CrossRef] [Scilit]
  88. Gusachenko, O.N.; Woodford, L.; Balbirnie-Cumming, K.; Ryabov, E.V.; Evans, D.J. Evidence for and against deformed wing virus spillover from honey bees to bumble bees: A reverse genetic analysis. Sci. Rep. 2020, 10, 16847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  89. Glenny, W.; Cavigli, I.; Daughenbaugh, K.F.; Radford, R.; Kegley, S.E.; Flenniken, M.L. Honey bee (Apis mellifera) colony health and pathogen composition in migratory beekeeping operations involved in California almond pollination. PLoS ONE 2017, 12, e0182814. [Google Scholar] [CrossRef] [Scilit]
  90. Cavigli, I.; Daughenbaugh, K.F.; Martin, M.; Lerch, M.; Banner, K.; Garcia, E.; Brutscher, L.M.; Flenniken, M.L. Pathogen prevalence and abundance in honey bee colonies involved in almond pollination. Apidologie 2016, 47, 251–266. [Google Scholar] [CrossRef] [Scilit]
  91. Faurot-Daniels, C.; Glenny, W.; Daughenbaugh, K.F.; McMenamin, A.J.; Burkle, L.A.-O.; Flenniken, M.A.-O. Longitudinal monitoring of honey bee colonies reveals dynamic nature of virus abundance and indicates a negative impact of Lake Sinai virus 2 on colony health. PLoS ONE 2020, 15, e0237544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  92. Alger, S.A.; Burnham, P.A.; Lamas, Z.S.; Brody, A.K.; Richardson, L.L. Home sick: Impacts of migratory beekeeping on honey bee (Apis mellifera) pests, pathogens, and colony size. PeerJ 2018, 6, e5812. [Google Scholar] [CrossRef] [Scilit]
  93. Ricigliano, V.A.; Mott, B.M.; Floyd, A.S.; Copeland, D.C.; Carroll, M.J.; Anderson, K.E. Honey bees overwintering in a southern climate: Longitudinal effects of nutrition and queen age on colony-level molecular physiology and performance. Sci. Rep. 2018, 8, 10475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  94. van Engelsdorp, D.; Tarpy, D.R.; Lengerich, E.J.; Pettis, J.S. Idiopathic brood disease syndrome and queen events as precursors of colony mortality in migratory beekeeping operations in the eastern United States. Prev. Vet. Med. 2013, 108, 225–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  95. Genersch, E.; von der Ohe, W.; Kaatz, H.; Schroeder, A.; Otten, C.; Büchler, R.; Berg, S.; Ritter, W.; Mühlen, W.; Gisder, S.; et al. The German bee monitoring project: A long term study to understand periodically high winter losses of honey bee colonies. Apidologie 2010, 41, 332–352. [Google Scholar] [CrossRef] [Scilit]
  96. Nazzi, F.; Pennacchio, F. Disentangling multiple interactions in the hive ecosystem. Trends Parasitol. 2014, 30, 556–561. [Google Scholar] [CrossRef] [Scilit]
  97. Deboutte, W.; Beller, L.; Yinda, C.K.; Shi, C.; Smets, L.; Vanmechelen, B.; Conceição-Neto, N.; Dallmeier, K.; Maes, P.; de Graaf, D.C.; et al. Hymenoptera associated eukaryotic virome lacks host specificity. bioRxiv 2020. [Google Scholar] [CrossRef] [Scilit]
  98. Pisanty, G.; Mandelik, Y. Profiling crop pollinators: Life history traits predict habitat use and crop visitation by Mediterranean wild bees. Ecol. Appl. 2015, 25, 742–752. [Google Scholar] [CrossRef] [Scilit]
  99. Pisanty, G.; Afik, O.; Wajnberg, E.; Mandelik, Y. Watermelon pollinators exhibit complementarity in both visitation rate and single-visit pollination efficiency. J. Appl. Ecol. 2016, 53, 360–370. [Google Scholar] [CrossRef] [Scilit]
  100. Evans, J.D.; Schwarz, R.; Childers, A. HoloBee Database v2016.1. Ag Data Commons. 2016. Available online: https://doi.org/10.15482/USDA.ADC/1255217 (accessed on 1 February 2019).
  101. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  102. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Scilit]
  103. Li, H.; Handsaker, B.; Fau-Wysoker, A.; Wysoker, A.; Fau-Fennell, T.; Fennell, T.; Fau-Ruan, J.; Ruan, J.; Fau-Homer, N.; Homer, N.; et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  104. Runckel, C.; DeRisi, J.; Flenniken, M.L. A draft genome of the honey bee trypanosomatid parasite Crithidia mellificae. PLoS ONE 2014, 9, e95057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  105. Bray, N.L.; Pimentel, H.; Melsted, P.A.-O.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  106. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  107. Buchfink, B.; Xie, C.; Huson, D.H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef] [Scilit]
  108. de Miranda, J.R.; Bailey, L.; Ball, B.V.; Blanchard, P.; Budge, G.E.; Chejanovsky, N.; Chen, Y.-P.; Gauthier, L.; Genersch, E.; de Graaf, D.C.; et al. Standard methods for virus research in Apis mellifera. J. Apic. Res. 2015, 52, 1–56. [Google Scholar] [CrossRef] [Scilit]
  109. Ginzinger, D.G. Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Exp. Hematol. 2002, 30, 503–512. [Google Scholar] [CrossRef] [Scilit]
  110. R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. 2020. Available online: http://www.R-project.org/ (accessed on 9 January 2020).
  111. Daughenbaugh, K.F.; Martin, M.; Brutscher, L.M.; Cavigli, I.; Garcia, E.; Lavin, M.; Flenniken, M.L. Honey Bee Infecting Lake Sinai Viruses. Viruses 2015, 7, 3285–3309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  112. Hunter, W.B. Medium for development of bee cell cultures (Apis mellifera: Hymenoptera: Apidae). In Vitro Cell. Dev. Biol. Anim. 2010, 46, 83–86. [Google Scholar] [CrossRef] [Scilit]
  113. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Scilit]
  114. Eddy, S.R. Accelerated Profile HMM Searches. PLoS Comput. Biol. 2011, 7, e1002195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  115. Greninger, A.L.; Makhsous, N.; Shean, R.; Jerome, K.; Crawford, R. Genome Sequences of Viruses from Spiders around Seattle. 2020. Available online: https://www.genome.jp/virushostdb/1911102 (accessed on 10 January 2020).
  116. Katoh, K.; Kuma, K.; Fau-Toh, H.; Toh, H.; Fau-Miyata, T.; Miyata, T. MAFFT version 5: Improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 2005, 33, 511–518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  117. Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. trimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef] [Scilit]
  118. Darriba, D.; Gl Fau-Doallo, R.T.; Doallo, R.; Fau-Posada, D.; Posada, D. ProtTest 3: Fast selection of best-fit models of protein evolution. Bioinformatics 2011, 27, 1164–1165. [Google Scholar] [CrossRef] [Scilit]
  119. Guindon, S.; Dufayard, J.-F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [Scilit]
  120. Rambaut, A.D.A. FigTree Version 1.4.0. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 9 January 2020).
  121. Bates, D.; Maechler, M.; Bolker, B.; Walker, S. Package ‘lme4’. Available online: http://dk.archive.ubuntu.com/pub/pub/cran/web/packages/lme4/lme4.pdf (accessed on 9 January 2020).
  122. Ben Bolker, R.D.C.T. bbmle: Tools for General Maximum Likelihood Estimation Methods and Functions for Fitting Maximum Likelihood Models in R. Available online: https://CRAN.R-project.org/package=bbmle (accessed on 9 January 2020).
  123. Hartig, F. DHARMa: Residual Diagnostics for Hierarchical (Multi-Level/Mixed) Regression Models. Available online: https://cran.r-project.org/web/packages/DHARMa/vignettes/DHARMa.html (accessed on 9 January 2020).
  124. Fortin, M.-J.; Dale, M.R.T. Spatial Analysis: A Guide for Ecologists; Cambridge University Press: Cambridge, UK, 2005. [Google Scholar]
  125. Consortium, H.G.S. Insights into social insects from the genome of the honeybee Apis mellifera. Nature 2006, 443, 931–949. [Google Scholar]
  126. Elsik, C.G.; Worley, K.C.; Bennett, A.K.; Beye, M.; Camara, F.; Childers, C.P.; de Graaf, D.C.; Debyser, G.; Deng, J.; Devreese, B.; et al. Finding the missing honey bee genes: Lessons learned from a genome upgrade. BMC Genom. 2014, 15, 86. [Google Scholar] [CrossRef] [Scilit]
  127. Moore, J.; Jironkin, A.; Chandler, D.; Burroughs, N.; Evans, D.J.; Ryabov, E.V. Recombinants between Deformed wing virus and Varroa destructor virus-1 may prevail in Varroa destructor-infested honeybee colonies. J. Gen. Virol. 2010, 92, 156–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  128. Chen, Y.P.; Pettis, J.S.; Zhao, Y.; Liu, X.; Tallon, L.J.; Sadzewicz, L.D.; Li, R.; Zheng, H.; Huang, S.; Zhang, X.; et al. Genome sequencing and comparative genomics of honey bee microsporidia, Nosema apis reveal novel insights into host-parasite interactions. BMC Genom. 2013, 14, 451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  129. Cornman, R.S.; Chen, Y.P.; Schatz, M.C.; Street, C.; Zhao, Y.; Desany, B.; Egholm, M.; Hutchison, S.; Pettis, J.S.; Lipkin, W.I.; et al. Genomic Analyses of the Microsporidian Nosema ceranae, an Emergent Pathogen of Honey Bees. PLoS Pathog. 2009, 5, e1000466. [Google Scholar] [CrossRef] [Scilit]
  130. Cornman, S.R.; Schatz, M.C.; Johnston, S.J.; Chen, Y.P.; Pettis, J.; Hunt, G.; Bourgeois, L.; Elsik, C.; Anderson, D.; Grozinger, C.M.; et al. Genomic survey of the ectoparasitic mite Varroa destructor, a major pest of the honey bee Apis mellifera. BMC Genom. 2010, 11, 602. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  131. Bigot, D.; Dalmon, A.; Roy, B.; Hou, C.; Germain, M.; Romary, M.; Deng, S.; Diao, Q.; Weinert, L.A.; Cook, J.M.; et al. The discovery of Halictivirus resolves the Sinaivirus phylogeny. J. Gen. Virol. 2017, 98, 2864–2875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  132. Cornman, R.A.-O. Relative Abundance and Molecular Evolution of Lake Sinai Virus (Sinaivirus) Clades. PeerJ 2019, 7, e6305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  133. Iwanowicz, D.D.; Wu-Smart, J.Y.; Olgun, T.; Smart, A.H.; Otto, C.R.V.; Lopez, D.; Evans, J.D.; Cornman, R. An updated genetic marker for detection of Lake Sinai Virus and metagenetic applications. PeerJ 2020, 8, e9424. [Google Scholar] [CrossRef] [Scilit]
  134. Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M.; et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef] [Scilit]
  135. Moustafa, I.M.; Korboukh, V.K.; Arnold, J.J.; Smidansky, E.D.; Marcotte, L.L.; Gohara, D.W.; Yang, X.; Sánchez-Farrán, M.A.; Filman, D.; Maranas, J.K.; et al. Structural dynamics as a contributor to error-prone replication by an RNA-dependent RNA polymerase. J. Biol. Chem. 2014, 289, 36229–36248. [Google Scholar] [CrossRef] [Scilit]
  136. Lauring, A.S. Within-Host Viral Diversity: A Window into Viral Evolution. Annu. Rev. Virol. 2020, 7, 63–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  137. Lauring, A.S.; Andino, R. Quasispecies Theory and the Behavior of RNA Viruses. PLoS Pathog. 2010, 6, e1001005. [Google Scholar] [CrossRef] [Scilit]
  138. Andino, R.; Domingo, E. Viral quasispecies. Virology 2015, 479–480, 46–51. [Google Scholar] [CrossRef] [Scilit]
  139. Thaduri, S.; Locke, B.; Granberg, F.; de Miranda, J.R. Temporal changes in the viromes of Swedish Varroa-resistant and Varroa-susceptible honeybee populations. PLoS ONE 2018, 13, e0206938. [Google Scholar] [CrossRef] [Scilit]
  140. Yue, C. RT-PCR analysis of Deformed wing virus in honeybees (Apis mellifera) and mites (Varroa destructor). J. Gen. Virol. 2005, 86, 3419–3424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  141. McNeil, D.J.; McCormick, E.; Heimann, A.C.; Kammerer, M.; Douglas, M.R.; Goslee, S.C.; Grozinger, C.M.; Hines, H.M. Bumble bees in landscapes with abundant floral resources have lower pathogen loads. Sci. Rep. 2020, 10, 22306. [Google Scholar] [CrossRef] [Scilit]
  142. Annoscia, D.; Brown, S.P.; Di Prisco, G.; De Paoli, E.; Del Fabbro, S.; Frizzera, D.; Zanni, V.; Galbraith, D.A.; Caprio, E.; Grozinger, C.M.; et al. Haemolymph removal by Varroa mite destabilizes the dynamical interaction between immune effectors and virus in bees, as predicted by Volterra’s model. Proc. Biol. Sci. 2019, 286, 20190331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  143. Zhao, Y.; Heerman, M.; Peng, W.; Evans, J.D.; Rose, R.; De Grandi-Hoffman, G.; Simone-Finstrom, M.; Li, J.; Li, Z.; Cook, S.C.; et al. The Dynamics of Deformed Wing Virus Concentration and Host Defensive Gene Expression after Varroa Mite Parasitism in Honey Bees, Apis mellifera. Insects 2019, 10, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  144. Zioni, N.; Soroker, V.; Chejanovsky, N. Replication of Varroa destructor virus 1 (VDV-1) and a Varroa destructor virus 1–deformed wing virus recombinant (VDV-1–DWV) in the head of the honey bee. Virology 2011, 417, 106–112. [Google Scholar] [CrossRef] [Scilit]
  145. Barroso-Arévalo, S.; Fernández-Carrión, E.; Goyache, J.; Molero, F.; Puerta, F.; Sánchez-Vizcaíno, J.M. High Load of Deformed Wing Virus and Varroa destructor Infestation Are Related to Weakness of Honey Bee Colonies in Southern Spain. Front. Microbiol. 2019, 10, 1331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  146. de Miranda, J.R.; Genersch, E. Deformed wing virus. J. Invertebr. Pathol. 2010, 103, S48–S61. [Google Scholar] [CrossRef] [Scilit]
  147. Genersch, E. Honey bee pathology: Current threats to honey bees and beekeeping. Appl. Microbiol. Biotechnol. 2010, 87, 87–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  148. McMenamin, A.J.; Genersch, E. Honey bee colony losses and associated viruses. Curr. Opin. Insect Sci. 2015, 8, 121–129. [Google Scholar] [CrossRef] [Scilit]
  149. Kevill, J.L.; Highfield, A.; Mordecai, G.J.; Martin, S.J.; Schroeder, D.C. ABC Assay: Method Development and Application to Quantify the Role of Three DWV Master Variants in Overwinter Colony Losses of European Honey Bees. Viruses 2017, 9, 314. [Google Scholar] [CrossRef] [Scilit]
  150. Dalmon, A.; Desbiez, C.; Coulon, M.; Thomasson, M.; Le Conte, Y.; Alaux, C.; Vallon, J.; Moury, B. Evidence for positive selection and recombination hotspots in Deformed wing virus (DWV). Sci. Rep. 2017, 7, 41045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  151. Dubois, E.; Dardouri, M.; Schurr, F.; Cougoule, N.; Sircoulomb, F.; Thiéry, R. Outcomes of honeybee pupae inoculated with deformed wing virus genotypes A and B. Apidologie 2020, 51, 18–34. [Google Scholar] [CrossRef] [Scilit]
  152. Mockel, N.; Gisder, S.; Genersch, E. Horizontal transmission of deformed wing virus: Pathological consequences in adult bees (Apis mellifera) depend on the transmission route. J. Gen. Virol. 2011, 92, 370–377. [Google Scholar] [CrossRef] [Scilit]
  153. Ravoet, J.; De Smet, L.; Wenseleers, T.; de Graaf, D.C. Genome sequence heterogeneity of Lake Sinai Virus found in honey bees and Orf1/RdRP-based polymorphisms in a single host. Virus Res. 2015, 201, 67–72. [Google Scholar] [CrossRef] [Scilit]
  154. Chevin, A.; Coutard, B.; Blanchard, P.; Dabert-Gay, A.-S.; Ribière-Chabert, M.; Thiéry, R. Characterisation of Structural Proteins from Chronic Bee Paralysis Virus (CBPV) Using Mass Spectrometry. Viruses 2015, 7, 3329–3344. [Google Scholar] [CrossRef] [Scilit]
  155. Zimmermann, L.; Stephens, A.; Nam, S.-Z.; Rau, D.; Kübler, J.; Lozajic, M.; Gabler, F.; Söding, J.; Lupas, A.N.; Alva, V. A Completely Reimplemented MPI Bioinformatics Toolkit with a New HHpred Server at its Core. J. Mol. Biol. 2018, 430, 2237–2243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  156. Pascall, D.J.; Tinsley, M.C.; Obbard, D.J.; Wilfert, L. Host evolutionary history predicts virus prevalence across bumblebee species. bioRxiv 2019. [Google Scholar] [CrossRef] [Scilit]
  157. Carrillo-Tripp, J.; Dolezal, A.G.; Goblirsch, M.J.; Miller, W.A.; Toth, A.L.; Bonning, B.C. In vivo and in vitro infection dynamics of honey bee viruses. Sci. Rep 2016, 6, S50. [Google Scholar] [CrossRef] [Scilit]
  158. Guo, Y.; Goodman, C.L.; Stanley, D.W.; Bonning, B.C. Cell Lines for Honey Bee Virus Research. Viruses 2020, 12, 236. [Google Scholar] [CrossRef] [Scilit]
  159. Goblirsch, M.J.; Spivak, M.S.; Kurtti, T.J. A Cell Line Resource Derived from Honey Bee (Apis mellifera) Embryonic Tissues. PLoS ONE 2013, 8, e69831. [Google Scholar] [CrossRef] [Scilit]
  160. McMahon, D.P.; Fürst, M.A.; Caspar, J.; Theodorou, P.; Brown, M.J.F.; Paxton, R.J. A sting in the spit: Widespread cross-infection of multiple RNA viruses across wild and managed bees. J. Anim. Ecol. 2015, 84, 615–624. [Google Scholar] [CrossRef] [Scilit]
  161. Graystock, P.; Ng, W.H.; Parks, K.; Tripodi, A.D.; Muñiz, P.A.; Fersch, A.A.; Myers, C.R.; McFrederick, Q.S.; McArt, S.H. Dominant bee species and floral abundance drive parasite temporal dynamics in plant-pollinator communities. Nat. Ecol. Evol. 2020, 4, 1358–1367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  162. Ostfeld, R.S.; Keesing, F. Biodiversity and Disease Risk: The Case of Lyme Disease. Conserv. Biol. 2000, 14, 722–728. [Google Scholar] [CrossRef] [Scilit]
  163. Figueroa, L.L.; Grab, H.; Ng, W.H.; Myers, C.R.; Graystock, P.; McFrederick, Q.S.; McArt, S.H. Landscape simplification shapes pathogen prevalence in plant-pollinator networks. Ecol. Lett. 2020, 23, 1212–1222. [Google Scholar] [CrossRef] [Scilit]
  164. Luis, A.D.; Kuenzi, A.J.; Mills, J.N. Species diversity concurrently dilutes and amplifies transmission in a zoonotic host-pathogen system through competing mechanisms. Proc. Natl. Acad. Sci. USA 2018, 115, 7979–7984. [Google Scholar] [CrossRef] [Scilit]
  165. De Grandi-Hoffman, G.; Chen, Y. Nutrition, immunity and viral infections in honey bees. Curr. Opin. Insect Sci. 2015, 10, 170–176. [Google Scholar] [CrossRef] [Scilit]
  166. Alaux, C.; Dantec, C.; Parrinello, H.; Le Conte, Y. Nutrigenomics in honey bees: Digital gene expression analysis of pollen’s nutritive effects on healthy and varroa-parasitized bees. BMC Genom. 2011, 12, 583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  167. Dolezal, A.G.; Toth, A.L. Feedbacks between nutrition and disease in honey bee health. Curr. Opin. Insect Sci. 2018, 26, 114–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  168. Wenner, A.M.; Meade, D.E.; Friesen, L.J. Recruitment, Search Behavior, and Flight Ranges of Honey Bees1. Am. Zool 1991, 31, 768–782. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Overview of sampling and analysis of sympatric bee species collected from 14 sites in Israel. (A). The table provides a summary of the site-specific data obtained in this 2018 sample cohort. Sampling sites were selected for the survey as either high or low floral diversity, based on their floral species richness. Honey bee activity at each site was also categorized as either high or low, based on the percentage of honey bees out of the total number of bees sampled. This study resulted in the collection of over 1331 bee samples, including 263 Apis mellifera and 876 Andrena spp. samples. Assessment of viral diversity and abundance was carried out on a subset of individual bees (i.e., a median of 11 individual bees per taxon per site). (B). Map of Israel with sample sites labeled and marked with green and red dots indicating high and low floral diversity, respectively. (C). Schematic of the sample sizes and molecular analyses.
Figure 1. Overview of sampling and analysis of sympatric bee species collected from 14 sites in Israel. (A). The table provides a summary of the site-specific data obtained in this 2018 sample cohort. Sampling sites were selected for the survey as either high or low floral diversity, based on their floral species richness. Honey bee activity at each site was also categorized as either high or low, based on the percentage of honey bees out of the total number of bees sampled. This study resulted in the collection of over 1331 bee samples, including 263 Apis mellifera and 876 Andrena spp. samples. Assessment of viral diversity and abundance was carried out on a subset of individual bees (i.e., a median of 11 individual bees per taxon per site). (B). Map of Israel with sample sites labeled and marked with green and red dots indicating high and low floral diversity, respectively. (C). Schematic of the sample sizes and molecular analyses.
Viruses 13 00291 g001
Figure 2. Sequence coverage of virus genome variants characterized by high-throughput sequencing and virus-specific qPCR. Reads in the sequence library with the highest number of reads were aligned to the consensus genome variants identified in this study including BQCV Israel-2018 (MW397638), DWV Israel-2018 (MW397639), LSV-2 Israel-2018 (MW397637), and LSV-NE Israel-2018 (MW397636), and to both genome segments of Andrena-associated bee virus-1 (AnBV-1), the novel bicistronic (+) ssRNA virus identified in this study (MW397640, MW397640). Vertical and horizontal Scheme 3.2.2. Deformed wing virus.
Figure 2. Sequence coverage of virus genome variants characterized by high-throughput sequencing and virus-specific qPCR. Reads in the sequence library with the highest number of reads were aligned to the consensus genome variants identified in this study including BQCV Israel-2018 (MW397638), DWV Israel-2018 (MW397639), LSV-2 Israel-2018 (MW397637), and LSV-NE Israel-2018 (MW397636), and to both genome segments of Andrena-associated bee virus-1 (AnBV-1), the novel bicistronic (+) ssRNA virus identified in this study (MW397640, MW397640). Vertical and horizontal Scheme 3.2.2. Deformed wing virus.
Viruses 13 00291 g002
Figure 3. Andrena-associated bee virus-1 is a bipartite RNA tombus-like virus. (A). Schematic diagram of AnBV-1 genome, RNA 1 and RNA 2, with predicted open reading frames (ORFs) labeled with gene annotations based on PHMMER, HHpred and BLAST analyses and corresponding percent amino acid identity. (B). The AnBV-1 RdRp sequence forms a well-supported monophyletic clade with sequences in the Tombusviridae family (highlighted in gray). The AnBV-1 phylogenetic relationship was inferred from a maximum likelihood consensus tree of insect viruses, including previously described honey bee viruses in the Sinaiviridae, Dicistroviridae, and Iflaviridae families. Numbers on branches are Bayesian posterior probabilities (0–1); the scale bar indicates substitutions per site, and GenBank accession numbers for either the RdRp sequences or the genome sequences from where the RdRp sequence obtained are in parentheses. (C). Detailed view of the Tombusviridae clade in panel (B), illustrated that AnBV-1 RdRp is most similar to Castleton burn virus and Hubei tombus-like viruses. GenBank accessions are indicated in gray.
Figure 3. Andrena-associated bee virus-1 is a bipartite RNA tombus-like virus. (A). Schematic diagram of AnBV-1 genome, RNA 1 and RNA 2, with predicted open reading frames (ORFs) labeled with gene annotations based on PHMMER, HHpred and BLAST analyses and corresponding percent amino acid identity. (B). The AnBV-1 RdRp sequence forms a well-supported monophyletic clade with sequences in the Tombusviridae family (highlighted in gray). The AnBV-1 phylogenetic relationship was inferred from a maximum likelihood consensus tree of insect viruses, including previously described honey bee viruses in the Sinaiviridae, Dicistroviridae, and Iflaviridae families. Numbers on branches are Bayesian posterior probabilities (0–1); the scale bar indicates substitutions per site, and GenBank accession numbers for either the RdRp sequences or the genome sequences from where the RdRp sequence obtained are in parentheses. (C). Detailed view of the Tombusviridae clade in panel (B), illustrated that AnBV-1 RdRp is most similar to Castleton burn virus and Hubei tombus-like viruses. GenBank accessions are indicated in gray.
Viruses 13 00291 g003
Figure 4. Andrena-associated bee virus-1 (AnBV-1) is more prevalent in Andrena. (A). AnBV-1 prevalence in this sample cohort, which represents a single sampling date at each of 14 sites, was determined from binary analysis of quantitative PCR (i.e., a sample was designated either positive (1) or negative (0) for AnBV-1) and presented as the percent AnBV-1 positive samples for each species. Specifically, 22 of the 143 Apis mellifera samples analyzed were AnBV-1 positive (15%) and 71 of the 148 Andrena spp. samples analyzed were AnBV-1 positive (48%). The data were analyzed using a chi square test for proportions, where X2 = 44.057, df = 1, and * p-value = 3 × 10−11. (B). Quantitative PCR was used to determine the AnBV-1 RNA 1 or RNA 2 copy number in individual AnBV-1-positive Apis mellifera and Andrena spp. samples. Samples with undetectable AnBV-1 levels were not graphed or analyzed. Comparison of the RNA abundance between species using Dunnett’s test indicates that AnBV-1 RNA 1 abundance was greater in Andrena spp. samples compared to Apis mellifera samples (p = 0.0279), but RNA 2 abundance between the two species was not significant, p = 0.29.
Figure 4. Andrena-associated bee virus-1 (AnBV-1) is more prevalent in Andrena. (A). AnBV-1 prevalence in this sample cohort, which represents a single sampling date at each of 14 sites, was determined from binary analysis of quantitative PCR (i.e., a sample was designated either positive (1) or negative (0) for AnBV-1) and presented as the percent AnBV-1 positive samples for each species. Specifically, 22 of the 143 Apis mellifera samples analyzed were AnBV-1 positive (15%) and 71 of the 148 Andrena spp. samples analyzed were AnBV-1 positive (48%). The data were analyzed using a chi square test for proportions, where X2 = 44.057, df = 1, and * p-value = 3 × 10−11. (B). Quantitative PCR was used to determine the AnBV-1 RNA 1 or RNA 2 copy number in individual AnBV-1-positive Apis mellifera and Andrena spp. samples. Samples with undetectable AnBV-1 levels were not graphed or analyzed. Comparison of the RNA abundance between species using Dunnett’s test indicates that AnBV-1 RNA 1 abundance was greater in Andrena spp. samples compared to Apis mellifera samples (p = 0.0279), but RNA 2 abundance between the two species was not significant, p = 0.29.
Viruses 13 00291 g004
Figure 5. AnBV-1 replicates in honey bee pupal cells. To examine the ability of AnBV-1 to replicate in primary honey bee cells, cultures of pupal cells were incubated with AnBV-1-negative lysate (mock) or AnBV-1-positive lysate (AnBV-1). Total RNA was isolated from each cell culture well at 0, 1, 4, 5, or 7 days post-infection (dpi) and virus replication was assessed via strand-specific reverse transcription followed by qPCR. (A). Quantification of positive-strand, including both genome copies and transcripts, of AnBV-1 RNA 1 and AnBV-1 RNA 2 at each designated dpi. For RNA 1, 3.6 × 107 +/−2.9 × 106 copies per 24 ng RNA at 4 dpi vs. 1.4 × 107 +/−1.5 × 106 copies per 24 ng RNA at 0 dpi. For RNA 2, 5 × 107 +/−2.5 × 106 copies per 24 ng at 7 dpi vs. 1.2 × 107 +/−3.4 × 106 copies per 24 ng RNA at 0 dpi. (B). Quantitative assessment of negative-strand, replicative intermediate forms of AnBV-1 genome segments at each designated dpi; AnBV-1 RNA 1 and AnBV-1 RNA 2. Data were analyzed using R Studio and p-values were calculated using a pairwise Wilcoxon Rank Sums test with no multiple comparisons correction, and sample sizes per time point ranged from 2 to 6 samples. Relative quantity of the housekeeping gene Amrpl8 was consistent across all samples at all time points.
Figure 5. AnBV-1 replicates in honey bee pupal cells. To examine the ability of AnBV-1 to replicate in primary honey bee cells, cultures of pupal cells were incubated with AnBV-1-negative lysate (mock) or AnBV-1-positive lysate (AnBV-1). Total RNA was isolated from each cell culture well at 0, 1, 4, 5, or 7 days post-infection (dpi) and virus replication was assessed via strand-specific reverse transcription followed by qPCR. (A). Quantification of positive-strand, including both genome copies and transcripts, of AnBV-1 RNA 1 and AnBV-1 RNA 2 at each designated dpi. For RNA 1, 3.6 × 107 +/−2.9 × 106 copies per 24 ng RNA at 4 dpi vs. 1.4 × 107 +/−1.5 × 106 copies per 24 ng RNA at 0 dpi. For RNA 2, 5 × 107 +/−2.5 × 106 copies per 24 ng at 7 dpi vs. 1.2 × 107 +/−3.4 × 106 copies per 24 ng RNA at 0 dpi. (B). Quantitative assessment of negative-strand, replicative intermediate forms of AnBV-1 genome segments at each designated dpi; AnBV-1 RNA 1 and AnBV-1 RNA 2. Data were analyzed using R Studio and p-values were calculated using a pairwise Wilcoxon Rank Sums test with no multiple comparisons correction, and sample sizes per time point ranged from 2 to 6 samples. Relative quantity of the housekeeping gene Amrpl8 was consistent across all samples at all time points.
Viruses 13 00291 g005
Figure 6. The probability of AnBV-1 infection in honey bees is greater in habitats with low floral diversity. (A). Patterns of bee resource use in high floral diversity sites (green) and low floral diversity sites (red), including the diversity of floral resources utilized by honey bees (horizontal axis) and the abundance of flower species that were shared between honey bees and mining bees (vertical axis); values scaled by 10,000–1 floral units. (B). Best statistical model for the roles of AnBV-1-infected mining bees and floral diversity on the probability of AnBV-1 infection in honey bees. All models are logistic generalized linear mixed models (GLMMs) for the probability of AnBV-1 presence in honey bees, with 143 observations. Scheme 2. The best model was contrasted with a null model containing only the random effect of site. (C). Best model fit to data, describing the relationship between AnBV-1 prevalence in honey bees (vertical axis) and three habitat characteristics: (i) the density of AnBV-1-infected mining bees, (ii) the diversity of floral resources utilized by honey bees (red curves = mean of low diversity sites, green curves = mean of high diversity sites), and (iii) the abundance of flower species that are shared between honey bees and mining bees (solid = maximal abundance observed in the habitat type, dotted = minimal abundance observed in the habitat type, dashed = mean abundance observed in the habitat type). For high-diversity habitats (in green), the three curves for different floral abundances overlap.
Figure 6. The probability of AnBV-1 infection in honey bees is greater in habitats with low floral diversity. (A). Patterns of bee resource use in high floral diversity sites (green) and low floral diversity sites (red), including the diversity of floral resources utilized by honey bees (horizontal axis) and the abundance of flower species that were shared between honey bees and mining bees (vertical axis); values scaled by 10,000–1 floral units. (B). Best statistical model for the roles of AnBV-1-infected mining bees and floral diversity on the probability of AnBV-1 infection in honey bees. All models are logistic generalized linear mixed models (GLMMs) for the probability of AnBV-1 presence in honey bees, with 143 observations. Scheme 2. The best model was contrasted with a null model containing only the random effect of site. (C). Best model fit to data, describing the relationship between AnBV-1 prevalence in honey bees (vertical axis) and three habitat characteristics: (i) the density of AnBV-1-infected mining bees, (ii) the diversity of floral resources utilized by honey bees (red curves = mean of low diversity sites, green curves = mean of high diversity sites), and (iii) the abundance of flower species that are shared between honey bees and mining bees (solid = maximal abundance observed in the habitat type, dotted = minimal abundance observed in the habitat type, dashed = mean abundance observed in the habitat type). For high-diversity habitats (in green), the three curves for different floral abundances overlap.
Viruses 13 00291 g006
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Daughenbaugh, K.F.; Kahnonitch, I.; Carey, C.C.; McMenamin, A.J.; Wiegand, T.; Erez, T.; Arkin, N.; Ross, B.; Wiedenheft, B.; Sadeh, A.; et al. Metatranscriptome Analysis of Sympatric Bee Species Identifies Bee Virus Variants and a New Virus, Andrena-Associated Bee Virus-1. Viruses 2021, 13, 291. https://doi.org/10.3390/v13020291

AMA Style

Daughenbaugh KF, Kahnonitch I, Carey CC, McMenamin AJ, Wiegand T, Erez T, Arkin N, Ross B, Wiedenheft B, Sadeh A, et al. Metatranscriptome Analysis of Sympatric Bee Species Identifies Bee Virus Variants and a New Virus, Andrena-Associated Bee Virus-1. Viruses. 2021; 13(2):291. https://doi.org/10.3390/v13020291

Chicago/Turabian Style

Daughenbaugh, Katie F., Idan Kahnonitch, Charles C. Carey, Alexander J. McMenamin, Tanner Wiegand, Tal Erez, Naama Arkin, Brian Ross, Blake Wiedenheft, Asaf Sadeh, and et al. 2021. "Metatranscriptome Analysis of Sympatric Bee Species Identifies Bee Virus Variants and a New Virus, Andrena-Associated Bee Virus-1" Viruses 13, no. 2: 291. https://doi.org/10.3390/v13020291

APA Style

Daughenbaugh, K. F., Kahnonitch, I., Carey, C. C., McMenamin, A. J., Wiegand, T., Erez, T., Arkin, N., Ross, B., Wiedenheft, B., Sadeh, A., Chejanovsky, N., Mandelik, Y., & Flenniken, M. L. (2021). Metatranscriptome Analysis of Sympatric Bee Species Identifies Bee Virus Variants and a New Virus, Andrena-Associated Bee Virus-1. Viruses, 13(2), 291. https://doi.org/10.3390/v13020291

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop