Brevinin-2GHk, a Peptide Derived from the Skin of Fejervarya limnocharis, Inhibits Zika Virus Infection by Disrupting Viral Integrity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Peptide Synthesis
2.3. Cytotoxicity Assay
2.4. Plaque Assay
2.5. Quantitative Real-Time PCR (qRT-PCR)
2.6. Western Blot Analysis
2.7. Time-of-Addition Assay
2.8. Fluorescence Microscopy
2.9. Cell-Based ZIKV Immunodetection Assay
2.10. Virucidal Assay
2.11. RNase Digestion Assay
2.12. Molecular Docking
2.13. Statistical Analysis
3. Results
3.1. BR2GK Inhibits ZIKV Infection In Vitro
3.2. BR2GK Inhibits the Early and Middle Stages of ZIKV Infection
3.3. BR2GK Directly Inactivates ZIKV
3.4. BR2GK Targets ZIKV Envelope Protein
3.5. BR2GK Inhibits ZIKV Infection in Human Cell Lines
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dick, G.W.A.; Kitchen, S.F.; Haddow, A.J. Zika Virus (I). Isolations and serological specificity. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 509–520. [Google Scholar] [CrossRef]
- Lai, Z.Z.; Ho, Y.J.; Lu, J.W. Cephalotaxine inhibits Zika infection by impeding viral replication and stability. Biochem. Biophys. Res. Commun. 2020, 522, 1052–1058. [Google Scholar] [CrossRef]
- Zou, M.; Liu, H.; Li, J.; Yao, X.; Chen, Y.; Ke, C.; Liu, S. Structure-activity relationship of flavonoid bifunctional inhibitors against Zika virus infection. Biochem. Pharmacol. 2020, 177, 113962. [Google Scholar] [CrossRef]
- Lazear, H.M.; Diamond, M.S. Zika Virus: New Clinical Syndromes and Its Emergence in the Western Hemisphere. J. Virol. 2016, 90, 4864–4875. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, S.; Zhang, C.; Huang, L.S.; Zhang, X.; Xu, Y.; Fang, X.; Zhou, J.; Wu, M.; Schooley, R.T.; Huang, Z.; et al. Discovery and Computational Analyses of Novel Small Molecule Zika Virus Inhibitors. Molecules 2019, 24, 1465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saiz, J.-C.; Martín-Acebes, M.A. The Race To Find Antivirals for Zika Virus. Antimicrob. Agents Chemother. 2017, 61, e00411-17. [Google Scholar] [CrossRef] [Green Version]
- Hasan, S.S.; Sevvana, M.; Kuhn, R.J.; Rossmann, M.G. Structural biology of Zika virus and other flaviviruses. Nat. Struct. Mol. Biol. 2018, 25, 13–20. [Google Scholar] [CrossRef]
- Yu, Y.; Deng, Y.; Zou, P.; Wang, Q.; Dai, Y.; Yu, F.; Du, L.; Zhang, N.; Tian, M.; Hao, J.; et al. A peptide-based viral inactivator inhibits Zika virus infection in pregnant mice and fetuses. Nat. Commun. 2017, 8, 15672. [Google Scholar] [CrossRef] [PubMed]
- Vilas Boas, L.C.P.; Campos, M.L.; Berlanda, R.L.A.; de Carvalho Neves, N.; Franco, O.L. Antiviral peptides as promising therapeutic drugs. Cell. Mol. Life Sci. 2019, 76, 3525–3542. [Google Scholar] [CrossRef] [PubMed]
- He, M.; Zhang, H.; Li, Y.; Wang, G.; Tang, B.; Zhao, J.; Huang, Y.; Zheng, J. Cathelicidin-derived antimicrobial peptides inhibit Zika virus through direct inactivation and interferon pathway. Front. Immunol. 2018, 9, 722. [Google Scholar] [CrossRef] [Green Version]
- Xing, M.; Ji, M.; Hu, J.; Zhu, T.; Chen, Y.; Bai, X.; Mwangi, J.; Mo, G.; Lai, R.; Jin, L. Snake Cathelicidin Derived Peptide Inhibits Zika Virus Infection. Front. Microbiol. 2020, 11, 1871. [Google Scholar] [CrossRef]
- Xu, X.; Lai, R. The Chemistry and Biological Activities of Peptides from Amphibian Skin Secretions. Chem. Rev. 2015, 115, 1760–1846. [Google Scholar] [CrossRef]
- Holthausen, D.J.; Lee, S.H.; Kumar, V.T.; Bouvier, N.M.; Krammer, F.; Ellebedy, A.H.; Wrammert, J.; Lowen, A.C.; George, S.; Pillai, M.R.; et al. An Amphibian Host Defense Peptide Is Virucidal for Human H1 Hemagglutinin-Bearing Influenza Viruses. Immunity 2017, 46, 587–595. [Google Scholar] [CrossRef] [Green Version]
- Marcocci, M.E.; Amatore, D.; Villa, S.; Casciaro, B.; Aimola, P.; Franci, G.; Grieco, P.; Galdiero, M.; Palamara, A.T.; Mangoni, M.L.; et al. The Amphibian Antimicrobial Peptide Temporin B Inhibits In Vitro Herpes Simplex Virus 1 Infection. Antimicrob. Agents Chemother. 2018, 62, e02367-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiong, W.; Zhou, C.; Yin, S.; Chai, J.; Zeng, B.; Wu, J.; Li, Y.; Li, L.; Xu, X. Fejerlectin, a Lectin-like Peptide from the Skin of Fejervarya limnocharis, Inhibits HIV-1 Entry by Targeting Gp41. ACS Omega 2021, 6, 6414–6423. [Google Scholar] [CrossRef]
- Rollins-Smith, L.A.; Smith, P.B.; Ledeczi, A.M.; Rowe, J.M.; Reinert, L.K. Caerin 1 Antimicrobial Peptides that Inhibit HIV and Neisseria May Spare Protective Lactobacilli. Antibiotics 2020, 9, 661. [Google Scholar] [CrossRef]
- Lee, S.H.; Kim, E.H.; O’neal, J.T.; Dale, G.; Holthausen, D.J.; Bowen, J.R.; Quicke, K.M.; Skountzou, I.; Gopal, S.; George, S.; et al. The amphibian peptide Yodha is virucidal for Zika and dengue viruses. Sci. Rep. 2021, 11, 602. [Google Scholar] [CrossRef]
- Wang, G.; Watson, K.M.; Peterkofsky, A.; Buckheit, R.W. Identification of Novel Human Immunodeficiency Virus Type 1-Inhibitory Peptides Based on the Antimicrobial Peptide Database. Antimicrob. Agents Chemother. 2010, 54, 1343–1346. [Google Scholar] [CrossRef] [Green Version]
- Yasin, B.; Pang, M.; Turner, J.S.; Cho, Y.; Dinh, N.-N.; Waring, A.J.; Lehrer, R.I.; Wagar, E.A. Evaluation of the Inactivation of Infectious Herpes Simplex Virus by Host-Defense Peptides. Eur. J. Clin. Microbiol. Infect. Dis. 2000, 19, 187–194. [Google Scholar] [CrossRef]
- Yu, J.; Liu, X.; Ke, C.; Wu, Q.; Lu, W.; Qin, Z.; He, X.; Liu, Y.; Deng, J.; Xu, S.; et al. Effective Suckling C57BL/6, Kunming, and BALB/c Mouse Models with Remarkable Neurological Manifestation for Zika Virus Infection. Viruses 2017, 9, 165. [Google Scholar] [CrossRef] [Green Version]
- Conzelmann, C.; Zou, M.; Groß, R.; Harms, M.; Röcker, A.; Riedel, C.U.; Münch, J.; Müller, J.A. Storage-Dependent Generation of Potent Anti-ZIKV Activity in Human Breast Milk. Viruses 2019, 11, 591. [Google Scholar] [CrossRef] [Green Version]
- Lok, S.-M.; Costin, J.M.; Hrobowski, Y.M.; Hoffmann, A.R.; Rowe, D.K.; Kukkaro, P.; Holdaway, H.; Chipman, P.; Fontaine, K.A.; Holbrook, M.R.; et al. Release of Dengue Virus Genome Induced by a Peptide Inhibitor. PLoS ONE 2012, 7, e50995. [Google Scholar] [CrossRef] [PubMed]
- Pierce, B.G.; Wiehe, K.; Hwang, H.; Kim, B.-H.; Vreven, T.; Weng, Z. ZDOCK server: Interactive docking prediction of protein-protein complexes and symmetric multimers. Bioinformatics 2014, 30, 1771–1773. [Google Scholar] [CrossRef]
- Sirohi, D.; Chen, Z.; Sun, L.; Klose, T.; Pierson, T.C.; Rossmann, M.G.; Kuhn, R.J. The 3.8 A resolution cryo-EM structure of Zika virus. Science 2016, 352, 467–470. [Google Scholar] [CrossRef] [Green Version]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamiyama, N.; Soma, R.; Hidano, S.; Watanabe, K.; Umekita, H.; Fukuda, C.; Noguchi, K.; Gendo, Y.; Ozaki, T.; Sonoda, A.; et al. Ribavirin inhibits Zika virus (ZIKV) replication in vitro and suppresses viremia in ZIKV-infected STAT1-deficient mice. Antivir. Res. 2017, 146, 1–11. [Google Scholar] [CrossRef]
- Mangoni, M.L.; Casciaro, B. Development of Antimicrobial Peptides from Amphibians. Antibiotics 2020, 9, 772. [Google Scholar] [CrossRef] [PubMed]
- Zeng, B.; Chai, J.; Deng, Z.; Ye, T.; Chen, W.; Li, D.; Chen, X.; Chen, M.; Xu, X. Functional Characterization of a Novel Lipopolysaccharide-Binding Antimicrobial and Anti-Inflammatory Peptide in Vitro and in Vivo. J. Med. Chem. 2018, 61, 10709–10723. [Google Scholar] [CrossRef] [PubMed]
- Deng, Z.; Chai, J.; Zeng, Q.; Zhang, B.; Ye, T.; Chen, X.; Xu, X. The anticancer properties and mechanism of action of tablysin-15, the RGD-containing disintegrin, in breast cancer cells. Int. J. Biol. Macromol. 2019, 129, 1155–1167. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.; Zeng, B.; Chai, J.; Wu, J.; Guo, R.; Gao, Y.; Han, X.; Yang, J.; Kotsyfakis, M.; Xu, X. Antioxidant properties and neuroprotective effects of Esc-1GN through the regulation of MAPK and AKT signaling. Life Sci. 2020, 254, 117753. [Google Scholar] [CrossRef] [PubMed]
- Chai, J.; Chen, X.; Ye, T.; Zeng, B.; Zeng, Q.; Wu, J.; Kascakova, B.; Martins, L.A.; Prudnikova, T.; Smatanova, I.K.; et al. Characterization and functional analysis of cathelicidin-MH, a novel frog-derived peptide with anti-septicemic properties. Elife 2021, 10, e64411. [Google Scholar] [CrossRef]
- Nguyen, T.; Chen, X.; Chai, J.; Li, R.; Han, X.; Chen, X.; Liu, S.; Chen, M.; Xu, X. Antipyretic, anti-inflammatory and analgesic activities of Periplaneta americana extract and underlying mechanisms. Biomed. Pharmacother. 2020, 123, 109753. [Google Scholar] [CrossRef]
- Liscano, Y.; Oñate-Garzón, J.; Ocampo-Ibáñez, I.D. In Silico Discovery of Antimicrobial Peptides as an Alternative to Control SARS-CoV-2. Molecules 2020, 25, 5535. [Google Scholar] [CrossRef]
- De Angelis, M.; Casciaro, B.; Genovese, A.; Brancaccio, D.; Marcocci, M.E.; Novellino, E.; Carotenuto, A.; Palamara, A.T.; Mangoni, M.L.; Nencioni, L. Temporin G, an amphibian antimicrobial peptide against influenza and parainfluenza respiratory viruses: Insights into biological activity and mechanism of action. FASEB J. 2021, 35, e21358. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Miao, Y.; Ma, C.; Zhou, M.; Shi, Z.; Chen, X.; Burrows, J.F.; Xi, X.; Chen, T.; Wang, L. Brevinin-2GHk from Sylvirana guentheri and the Design of Truncated Analogs Exhibiting the Enhancement of Antimicrobial Activity. Antibiotics 2020, 9, 85. [Google Scholar] [CrossRef] [Green Version]
- Christian, K.M.; Song, H.; Ming, G. Pathophysiology and Mechanisms of Zika Virus Infection in the Nervous System. Annu. Rev. Neurosci. 2019, 42, 249–269. [Google Scholar] [CrossRef] [PubMed]
- Pujhari, S.; Brustolin, M.; Macias, V.M.; Nissly, R.H.; Nomura, M.; Kuchipudi, S.V.; Rasgon, J.L. Heat shock protein 70 (Hsp70) mediates Zika virus entry, replication, and egress from host cells. Emerg. Microbes Infect. 2019, 8, 8–16. [Google Scholar] [CrossRef] [Green Version]
- Agrelli, A.; de Moura, R.R.; Crovella, S.; Brandão, L.A.C. ZIKA virus entry mechanisms in human cells. Infect. Genet. Evol. 2019, 69, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Carneiro, B.M.; Batista, M.N.; Braga, A.C.S.; Nogueira, M.L.; Rahal, P. The green tea molecule EGCG inhibits Zika virus entry. Virology 2016, 496, 215–218. [Google Scholar] [CrossRef] [PubMed]
- Kumar, D.; Sharma, N.; Aarthy, M.; Singh, S.K.; Giri, R. Mechanistic Insights into Zika Virus NS3 Helicase Inhibition by Epigallocatechin-3-Gallate. ACS Omega 2020, 5, 11217–11226. [Google Scholar] [CrossRef]
- Wang, L.; Liang, R.; Gao, Y.; Li, Y.; Deng, X.; Xiang, R.; Zhang, Y.; Ying, T.; Jiang, S.; Yu, F. Development of Small-Molecule Inhibitors Against Zika Virus Infection. Front. Microbiol. 2019, 10, 2725. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, L.; Gao, J.; Zhang, S.; Wu, S.; Xie, Z.; Ling, G.; Kuang, Y.Q.; Yang, Y.; Yu, H.; Wang, Y. Identification and characterization of the first cathelicidin from sea snakes with potent antimicrobial and antiinflammatory activity and special mechanism. J. Biol. Chem. 2015, 290, 16633–16652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pei, X.; Gong, Z.; Wu, Q.; Chen, X.; Wang, L.; Ma, C.; Xi, X.; Chen, T.; Shaw, C.; Zhou, M. Characterisation of a novel peptide, Brevinin-1H, from the skin secretion of Amolops hainanensis and rational design of several analogues. Chem. Biol. Drug Des. 2021, 97, 273–282. [Google Scholar] [CrossRef] [PubMed]





| Target | Gene Sequence |
|---|---|
| ZIKV | F: CVGACATGGCTTCGGACAGY |
| R: CCCARCCTCTGTCCACYAAYG | |
| ZIKV E protein | F: GGTGGGACTTGGGTTGATGT |
| R: ATGTCACCAGGCTCCCTTTG | |
| ZIKV NS1 | F: ACCAGAGAGGGCTACAGGAC |
| R: TTAGCCTGGAACGACAGTGG | |
| GAPDH | F: TTGCATCGCCAGCGCATC |
| R: TCGCCCCACTTGATTTTGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiong, W.; Li, J.; Feng, Y.; Chai, J.; Wu, J.; Hu, Y.; Tian, M.; Lu, W.; Xu, X.; Zou, M. Brevinin-2GHk, a Peptide Derived from the Skin of Fejervarya limnocharis, Inhibits Zika Virus Infection by Disrupting Viral Integrity. Viruses 2021, 13, 2382. https://doi.org/10.3390/v13122382
Xiong W, Li J, Feng Y, Chai J, Wu J, Hu Y, Tian M, Lu W, Xu X, Zou M. Brevinin-2GHk, a Peptide Derived from the Skin of Fejervarya limnocharis, Inhibits Zika Virus Infection by Disrupting Viral Integrity. Viruses. 2021; 13(12):2382. https://doi.org/10.3390/v13122382
Chicago/Turabian StyleXiong, Weichen, Jingyan Li, Yifei Feng, Jinwei Chai, Jiena Wu, Yunrui Hu, Maolin Tian, Wancheng Lu, Xueqing Xu, and Min Zou. 2021. "Brevinin-2GHk, a Peptide Derived from the Skin of Fejervarya limnocharis, Inhibits Zika Virus Infection by Disrupting Viral Integrity" Viruses 13, no. 12: 2382. https://doi.org/10.3390/v13122382
APA StyleXiong, W., Li, J., Feng, Y., Chai, J., Wu, J., Hu, Y., Tian, M., Lu, W., Xu, X., & Zou, M. (2021). Brevinin-2GHk, a Peptide Derived from the Skin of Fejervarya limnocharis, Inhibits Zika Virus Infection by Disrupting Viral Integrity. Viruses, 13(12), 2382. https://doi.org/10.3390/v13122382

