Major Vault Protein Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection in CRL2843CD163 Cell Lines and Primary Porcine Alveolar Macrophages
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Cultures, Viruses and Chemicals
2.2. Overexpression of MVP and PRRSV Infection
2.3. Knockdown of MVP and PRRSV Infection
2.4. Quantitative Reverse Transcription-PCR (qRT-PCR)
2.5. Western Blot Analysis
2.6. Virus Titration
2.7. Statistical Analysis
3. Results
3.1. PRRSV Infection Inhibits MVP Expression in PAMs
3.2. Overexpression of MVP Inhibits PRRSV Replication In Vitro
3.3. Knockdown of MVP Promotes PRRSV Replication In Vitro
3.4. MVP Knockdown Partially Reverses the Inhibitory Effect of MVP Overexpression on PRRSV Replication
3.5. MVP Induces the Expression of Type Ⅰ IFNs in PRRSV-Infected PAMs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dokland, T. The structural biology of PRRSV. Virus Res. 2010, 154, 86–97. [Google Scholar] [CrossRef]
- Tian, K.; Yu, X.; Zhao, T.; Feng, Y.; Cao, Z.; Wang, C.; Hu, Y.; Chen, X.; Hu, D.; Tian, X.; et al. Emergence of fatal PRRSV variants: Unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS ONE 2007, 2, e526. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, G.W.; Van Alstine, W.G.; Kanitz, C.L.; Keffaber, K.K. Endemic porcine reproductive and respiratory syndrome virus infection of nursery pigs in two swine herds without current reproductive failure. J. Vet. Diagn. Investig. 1993, 5, 432–434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Christianson, W.T.; Collins, J.E.; Benfield, D.A.; Harris, L.; Gorcyca, D.E.; Chladek, D.W.; Morrison, R.B.; Joo, H.S. Experimental reproduction of swine infertility and respiratory syndrome in pregnant sows. Am. J. Vet. Res. 1992, 53, 485–488. [Google Scholar] [PubMed]
- Huang, C.; Zhang, Q.; Feng, W.H. Regulation and evasion of antiviral immune responses by porcine reproductive and respiratory syndrome virus. Virus Res. 2015, 202, 101–111. [Google Scholar] [CrossRef]
- Huang, C.; Zhang, Q.; Guo, X.K.; Yu, Z.B.; Xu, A.T.; Tang, J.; Feng, W.H. Porcine reproductive and respiratory syndrome virus nonstructural protein 4 antagonizes beta interferon expression by targeting the NF-kappaB essential modulator. J. Virol. 2014, 88, 10934–10945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Flores-Mendoza, L.; Silva-Campa, E.; Resendiz, M.; Osorio, F.A.; Hernandez, J. Porcine reproductive and respiratory syndrome virus infects mature porcine dendritic cells and up-regulates interleukin-10 production. Clin. Vaccine Immunol. 2008, 15, 720–725. [Google Scholar] [CrossRef] [Green Version]
- Wang, G.; Song, T.; Yu, Y.; Liu, Y.; Shi, W.; Wang, S.; Rong, F.; Dong, J.; Liu, H.; Cai, X.; et al. Immune responses in piglets infected with highly pathogenic porcine reproductive and respiratory syndrome virus. Vet. Immunol. Immunopathol. 2011, 142, 170–178. [Google Scholar] [CrossRef]
- Gomez-Laguna, J.; Salguero, F.J.; Pallares, F.J.; Fernandez de Marco, M.; Barranco, I.; Ceron, J.J.; Martinez-Subiela, S.; Van Reeth, K.; Carrasco, L. Acute phase response in porcine reproductive and respiratory syndrome virus infection. Comp. Immunol. Microbiol. Infect. Dis. 2010, 33, e51–e58. [Google Scholar] [CrossRef]
- Hou, J.; Wang, L.; He, W.; Zhang, H.; Feng, W.H. Highly pathogenic porcine reproductive and respiratory syndrome virus impairs LPS- and poly(I:C)-stimulated tumor necrosis factor-alpha release by inhibiting ERK signaling pathway. Virus Res. 2012, 167, 106–111. [Google Scholar] [CrossRef]
- Costers, S.; Lefebvre, D.J.; Delputte, P.L.; Nauwynck, H.J. Porcine reproductive and respiratory syndrome virus modulates apoptosis during replication in alveolar macrophages. Arch. Virol. 2008, 153, 1453–1465. [Google Scholar] [CrossRef]
- Wang, G.; He, Y.; Tu, Y.; Liu, Y.; Zhou, E.M.; Han, Z.; Jiang, C.; Wang, S.; Shi, W.; Cai, X. Comparative analysis of apoptotic changes in peripheral immune organs and lungs following experimental infection of piglets with highly pathogenic and classical porcine reproductive and respiratory syndrome virus. Virol. J. 2014, 11, 2. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.; Cao, L.; Xu, Z.; Fang, L.; Zhong, Y.; Chen, Q.; Luo, R.; Chen, H.; Li, K.; Xiao, S. MiR-125b reduces porcine reproductive and respiratory syndrome virus replication by negatively regulating the NF-kappaB pathway. PLoS ONE 2013, 8, e55838. [Google Scholar]
- Zhang, Q.; Guo, X.K.; Gao, L.; Huang, C.; Li, N.; Jia, X.; Liu, W.; Feng, W.H. MicroRNA-23 inhibits PRRSV replication by directly targeting PRRSV RNA and possibly by upregulating type I interferons. Virology 2014, 450–451, 182–195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodriguez-Gomez, I.M.; Gomez-Laguna, J.; Carrasco, L. Impact of PRRSV on activation and viability of antigen presenting cells. World J. Virol. 2013, 2, 146–151. [Google Scholar] [CrossRef] [PubMed]
- Weesendorp, E.; Stockhofe-Zurwieden, N.; Popma-De Graaf, D.J.; Fijten, H.; Rebel, J.M. Phenotypic modulation and cytokine profiles of antigen presenting cells by European subtype 1 and 3 porcine reproductive and respiratory syndrome virus strains in vitro and in vivo. Vet. Microbiol. 2013, 167, 638–650. [Google Scholar] [CrossRef]
- Xiao, Z.G.; Batista, L.; Dee, S.; Halbur, P.; Murtaugh, M.P. The level of virus-specific T-cell and macrophage recruitment in porcine reproductive and respiratory syndrome virus infection in pigs is independent of virus load. J. Virol. 2004, 78, 5923–5933. [Google Scholar] [CrossRef] [Green Version]
- Silva-Campa, E.; Mata-Haro, V.; Mateu, E.; Hernandez, J. Porcine reproductive and respiratory syndrome virus induces CD4+CD8+CD25+Foxp3+ regulatory T cells (Tregs). Virology 2012, 430, 73–80. [Google Scholar] [CrossRef] [Green Version]
- Halstead, S.B.; Mahalingam, S.; Marovich, M.A.; Ubol, S.; Mosser, D.M. Intrinsic antibody-dependent enhancement of microbial infection in macrophages: Disease regulation by immune complexes. Lancet Infect. Dis. 2010, 10, 712–722. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Zhou, Y.; Yang, Q.; Mu, C.; Duan, E.; Chen, J.; Yang, M.; Xia, P.; Cui, B. Ligation of Fc gamma receptor IIB enhances levels of antiviral cytokine in response to PRRSV infection in vitro. Vet. Microbiol. 2012, 160, 473–480. [Google Scholar] [CrossRef]
- Stephen, A.G.; Raval-Fernandes, S.; Huynh, T.; Torres, M.; Kickhoefer, V.A.; Rome, L.H. Assembly of vault-like particles in insect cells expressing only the major vault protein. J. Biol. Chem. 2001, 276, 23217–23220. [Google Scholar] [CrossRef] [Green Version]
- Slesina, M.; Inman, E.M.; Rome, L.H.; Volknandt, W. Nuclear localization of the major vault protein in U373 cells. Cell Tissue Res. 2005, 321, 97–104. [Google Scholar] [CrossRef]
- Vollmar, F.; Hacker, C.; Zahedi, R.P.; Sickmann, A.; Ewald, A.; Scheer, U.; Dabauvalle, M.C. Assembly of nuclear pore complexes mediated by major vault protein. J. Cell Sci. 2009, 122 Pt 6, 780–786. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Xiong, L.; Wang, P.; Wang, F.; Ma, Q. Major vault protein plays important roles in viral infection. IUBMB Life 2020, 72, 624–631. [Google Scholar] [CrossRef]
- Steiner, E.; Holzmann, K.; Elbling, L.; Micksche, M.; Berger, W. Cellular functions of vaults and their involvement in multidrug resistance. Curr. Drug Targets 2006, 7, 923–934. [Google Scholar] [CrossRef]
- Park, K. The role of major vault protein (MVP) in drug resistance. J. Control Release 2012, 163, 266. [Google Scholar] [CrossRef] [PubMed]
- Chung, J.H.; Ginn-Pease, M.E.; Eng, C. Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) has nuclear localization signal-like sequences for nuclear import mediated by major vault protein. Cancer Res. 2005, 65, 4108–4116. [Google Scholar] [CrossRef] [Green Version]
- Kim, E.; Lee, S.; Mian, M.F.; Yun, S.U.; Song, M.; Yi, K.S.; Ryu, S.H.; Suh, P.G. Crosstalk between Src and major vault protein in epidermal growth factor-dependent cell signalling. FEBS J. 2006, 273, 793–804. [Google Scholar] [CrossRef] [PubMed]
- Kolli, S.; Zito, C.I.; Mossink, M.H.; Wiemer, E.A.; Bennett, A.M. The major vault protein is a novel substrate for the tyrosine phosphatase SHP-2 and scaffold protein in epidermal growth factor signaling. J. Biol. Chem. 2004, 279, 29374–29385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yi, C.; Li, S.; Chen, X.; Wiemer, E.A.; Wang, J.; Wei, N.; Deng, X.W. Major vault protein, in concert with constitutively photomorphogenic 1, negatively regulates c-Jun-mediated activator protein 1 transcription in mammalian cells. Cancer Res. 2005, 65, 5835–5840. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schroeijers, A.B.; Reurs, A.W.; Scheffer, G.L.; Stam, A.G.; de Jong, M.C.; Rustemeyer, T.; Wiemer, E.A.; de Gruijl, T.D.; Scheper, R.J. Up-regulation of drug resistance-related vaults during dendritic cell development. J. Immunol. 2002, 168, 1572–1578. [Google Scholar] [CrossRef] [Green Version]
- Stewart, P.L.; Makabi, M.; Lang, J.; Dickey-Sims, C.; Robertson, A.J.; Coffman, J.A.; Suprenant, K.A. Sea urchin vault structure, composition, and differential localization during development. BMC Dev. Biol. 2005, 5, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sutovsky, P.; Manandhar, G.; Laurincik, J.; Letko, J.; Caamano, J.N.; Day, B.N.; Lai, L.X.; Prather, R.S.; Sharpe-Timms, K.L.; Zimmer, R.; et al. Expression and proteasomal degradation of the major vault protein (MVP) in mammalian oocytes and zygotes. Reproduction 2005, 129, 269–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meijer, G.A.; Schroeijers, A.B.; Flens, M.J.; Meuwissen, S.G.; van der Valk, P.; Baak, J.P.; Scheper, R.J. Increased expression of multidrug resistance related proteins Pgp, MRP1, and LRP/MVP occurs early in colorectal carcinogenesis. J. Clin. Pathol. 1999, 52, 450–454. [Google Scholar] [CrossRef] [Green Version]
- Teng, Y.; Ren, Y.; Hu, X.; Mu, J.; Samykutty, A.; Zhuang, X.; Deng, Z.; Kumar, A.; Zhang, L.; Merchant, M.L.; et al. MVP-mediated exosomal sorting of miR-193a promotes colon cancer progression. Nat. Commun. 2017, 8, 14448. [Google Scholar] [CrossRef] [PubMed]
- Dortet, L.; Mostowy, S.; Samba-Louaka, A.; Gouin, E.; Nahori, M.A.; Wiemer, E.A.; Dussurget, O.; Cossart, P. Recruitment of the major vault protein by InlK: A Listeria monocytogenes strategy to avoid autophagy. PLoS Pathog. 2011, 7, e1002168. [Google Scholar] [CrossRef]
- Ryu, S.J.; An, H.J.; Oh, Y.S.; Choi, H.R.; Ha, M.K.; Park, S.C. On the role of major vault protein in the resistance of senescent human diploid fibroblasts to apoptosis. Cell Death Differ. 2008, 15, 1673–1680. [Google Scholar] [CrossRef] [Green Version]
- Steiner, E.; Holzmann, K.; Pirker, C.; Elbling, L.; Micksche, M.; Sutterluty, H.; Berger, W. The major vault protein is responsive to and interferes with interferon-gamma-mediated STAT1 signals. J. Cell Sci. 2006, 119 Pt 3, 459–469. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.; Peng, N.; Xie, J.; Hao, Q.; Zhang, M.; Zhang, Y.; Xia, Z.; Xu, G.; Zhao, F.; Wang, Q.; et al. Human hepatitis B virus surface and e antigens inhibit major vault protein signaling in interferon induction pathways. J. Hepatol. 2015, 62, 1015–1023. [Google Scholar] [CrossRef]
- Liu, S.; Hao, Q.; Peng, N.F.; Yue, X.; Wang, Y.; Chen, Y.N.; Wu, J.G.; Zhu, Y. Major vault protein: A virus-induced host factor against viral replication through the induction of type-I interferon. Hepatology 2012, 56, 57–66. [Google Scholar] [CrossRef]
- Rivera-Rivera, L.; Perez-Laspiur, J.; Colon, K.; Melendez, L.M. Inhibition of interferon response by cystatin B: Implication in HIV replication of macrophage reservoirs. J. Neurovirol. 2012, 18, 20–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, S.Q.; Zhang, A.K.; Zhang, C.; Ni, H.B.; Gao, J.M.; Wang, C.B.; Zhao, Q.; Wang, X.P.; Wang, X.; Ma, C.; et al. Heme oxygenase-1 acts as an antiviral factor for porcine reproductive and respiratory syndrome virus infection and over-expression inhibits virus replication in vitro. Antivir. Res. 2014, 110, 60–69. [Google Scholar] [CrossRef]
- Li, L.; Xue, B.; Sun, W.; Gu, G.; Hou, G.; Zhang, L.; Wu, C.; Zhao, Q.; Zhang, Y.; Zhang, G.; et al. Recombinant MYH9 protein C-terminal domain blocks porcine reproductive and respiratory syndrome virus internalization by direct interaction with viral glycoprotein 5. Antivir. Res. 2018, 156, 10–20. [Google Scholar] [CrossRef] [PubMed]
- Febvre-James, M.; Lecureur, V.; Augagneur, Y.; Mayati, A.; Fardel, O. Repression of interferon beta-regulated cytokines by the JAK1/2 inhibitor ruxolitinib in inflammatory human macrophages. Int. Immunopharmacol. 2018, 54, 354–365. [Google Scholar] [CrossRef]
- Xiao, S.; Wang, Q.; Gao, J.; Wang, L.; He, Z.; Mo, D.; Liu, X.; Chen, Y. Inhibition of highly pathogenic PRRSV replication in MARC-145 cells by artificial microRNAs. Virol. J. 2011, 8, 491. [Google Scholar] [CrossRef] [Green Version]
- Seitz, C.; Frensing, T.; Hoper, D.; Kochs, G.; Reichl, U. High yields of influenza A virus in Madin-Darby canine kidney cells are promoted by an insufficient interferon-induced antiviral state. J. Gen. Virol. 2010, 91 Pt 7, 1754–1763. [Google Scholar] [CrossRef]
- Albina, E.; Carrat, C.; Charley, B. Interferon-alpha response to swine arterivirus (PoAV), the porcine reproductive and respiratory syndrome virus. J. Interferon Cytokine Res. 1998, 18, 485–490. [Google Scholar] [CrossRef]
- Wang, R.; Zhang, Y.J. Antagonizing interferon-mediated immune response by porcine reproductive and respiratory syndrome virus. BioMed Res. Int. 2014, 2014, 315470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.Z.; Yoo, D.W. PRRS virus receptors and their role for pathogenesis. Vet. Microbiol. 2015, 177, 229–241. [Google Scholar] [CrossRef]
- Gao, J.; Xiao, S.; Xiao, Y.; Wang, X.; Zhang, C.; Zhao, Q.; Nan, Y.; Huang, B.; Liu, H.; Liu, N.; et al. MYH9 is an Essential Factor for Porcine Reproductive and Respiratory Syndrome Virus Infection. Sci. Rep. 2016, 6, 25120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, Z.; Chen, X.X.; Li, R.; Qiao, S.; Zhang, G. The prevalent status and genetic diversity of porcine reproductive and respiratory syndrome virus in China: A molecular epidemiological perspective. Virol. J. 2018, 15, 2. [Google Scholar] [CrossRef] [Green Version]
- Yang, L.; Zhang, Y.J. Antagonizing cytokine-mediated JAK-STAT signaling by porcine reproductive and respiratory syndrome virus. Vet. Microbiol. 2017, 209, 57–65. [Google Scholar] [CrossRef] [PubMed]
- McNab, F.; Mayer-Barber, K.; Sher, A.; Wack, A.; O’Garra, A. Type I interferons in infectious disease. Nat. Rev. Immunol. 2015, 15, 87–103. [Google Scholar] [CrossRef]
- Sang, Y.; Rowland, R.R.; Hesse, R.A.; Blecha, F. Differential expression and activity of the porcine type I interferon family. Physiol. Genom. 2010, 42, 248–258. [Google Scholar] [CrossRef] [Green Version]
- Zhu, L.; Zhou, Y.; Tong, G. Mechanisms of suppression of interferon production by porcine reproductive and respiratory syndrome virus. Acta Virol. 2012, 56, 3–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, R.; Nan, Y.; Yu, Y.; Zhang, Y.J. Porcine reproductive and respiratory syndrome virus Nsp1beta inhibits interferon-activated JAK/STAT signal transduction by inducing karyopherin-alpha1 degradation. J. Virol. 2013, 87, 5219–5228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brockmeier, S.L.; Lager, K.M.; Grubman, M.J.; Brough, D.E.; Ettyreddy, D.; Sacco, R.E.; Gauger, P.C.; Loving, C.L.; Vorwald, A.C.; Kehrli, M.E., Jr.; et al. Adenovirus-mediated expression of interferon-alpha delays viral replication and reduces disease signs in swine challenged with porcine reproductive and respiratory syndrome virus. Viral Immunol. 2009, 22, 173–180. [Google Scholar] [CrossRef]
- Shi, X.; Zhang, X.; Wang, L.; Li, W.; Jiang, B.; Deng, R.; Wang, A.; Zhang, G. Recombinant beta interferon could clear the low-dose infected porcine reproductive and respiratory syndrome virus (PRRSV) in MARC-145 cells. Acta Virol. 2016, 60, 290–297. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer | Sequence (5′→3′) |
---|---|---|
MVP | Forward primer | ACACTTCTGGATACAGGTGAGC |
Reverse primer | AGTCTTCGGTCCAACCTCCA | |
PRRSV ORF7 | Forward primer | AAACCAGTCCAGAGGCAAGG |
Reverse primer | GCAAACTAAACTCCACAGTGTAA | |
IFN-α | Forward primer | GCCTCCTGCACCAGTTCTACA |
Reverse primer | TGCATGACACAGGCTTCCA | |
IFN-β | Forward primer | TGCAACCACCACAATTCC |
Reverse primer | CTGAGAATGCCGAAGATCTG | |
ISG15 | Forward primer | TCCTGGGCTCTAGGAGCTTT |
Reverse primer | ATGCCATCATGCAGTCCCTC | |
GAPDH | Forward primer | CCTTCCGTGTCCCTACTGCCAAC |
Reverse primer | GACGCCTGCTTCACCACCTTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, X.; Fang, J.; Huang, Q.; Chen, X.; Guo, Z.; Tian, L.; Zhou, E.; Chen, J.; Mu, Y.; Du, T. Major Vault Protein Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection in CRL2843CD163 Cell Lines and Primary Porcine Alveolar Macrophages. Viruses 2021, 13, 2267. https://doi.org/10.3390/v13112267
Wu X, Fang J, Huang Q, Chen X, Guo Z, Tian L, Zhou E, Chen J, Mu Y, Du T. Major Vault Protein Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection in CRL2843CD163 Cell Lines and Primary Porcine Alveolar Macrophages. Viruses. 2021; 13(11):2267. https://doi.org/10.3390/v13112267
Chicago/Turabian StyleWu, Xiaoping, Junyang Fang, Qiuping Huang, Xu Chen, Zhongyi Guo, Lingyujia Tian, Enmin Zhou, Jianxin Chen, Yang Mu, and Taofeng Du. 2021. "Major Vault Protein Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection in CRL2843CD163 Cell Lines and Primary Porcine Alveolar Macrophages" Viruses 13, no. 11: 2267. https://doi.org/10.3390/v13112267
APA StyleWu, X., Fang, J., Huang, Q., Chen, X., Guo, Z., Tian, L., Zhou, E., Chen, J., Mu, Y., & Du, T. (2021). Major Vault Protein Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection in CRL2843CD163 Cell Lines and Primary Porcine Alveolar Macrophages. Viruses, 13(11), 2267. https://doi.org/10.3390/v13112267