Association of Hepatitis C Virus Replication with the Catecholamine Biosynthetic Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Viruses and Plasmid Constructs
2.3. In Vitro Transcription
2.4. Transfection Assays
2.5. Preparation and Titration of Virus Stocks and Infection Assays
2.6. Gel Electrophoresis and Western Blot Analysis
2.7. Luciferase Assay
2.8. Measurement of Intracellular ATP Levels
2.9. RNA Quantification by Reverse Transcription-Quantitative PCR (RT-qPCR)
2.10. Indirect Immunofluorescence
2.11. ELISA Assay
2.12. Chemicals
2.13. Statistical Analysis
2.14. Ethics Statement
3. Results
3.1. Silencing of L-Dopa Decarboxylase (DDC) Increases HCV Replication and Suppresses the Antiviral Effect of DDC Substrates
3.2. Exogenous Application of the DDC Protein Products Dopamine and Serotonin Decreases HCV Replication
3.3. HCV Replication Is Enhanced by the Use of an Inhibitor of the Monoamine Transporter VMAT2
3.4. The Role of DBH, the Enzyme Catalyzing the Conversion of Dopamine to Norepinephrine, for HCV Replication
3.5. Inhibition of MAO Monoamine Degradation Enzymes Reduces HCV Replication
3.6. Induction of the Catecholamine and Serotonin Biosynthetic/Metabolic Pathway Down-Regulates HCV Replication
3.7. Association of Catecholamine-Mediated HCV Regulation with Cellular Redox Homeostasis
3.8. HCV Regulates the Expression of Catecholamine Biosynthesis Pathway-Related Enzymes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Hepatitis C. 2021. Available online: http://www.who.int/en/news-room/fact-sheets/detail/hepatitis-c (accessed on 27 July 2021).
- Botheju, W.S.P.; Zghyer, F.; Mahmud, S.; Terlikbayeva, A.; El-Bassel, N.; Abu-Raddad, L.J. The epidemiology of Hepatitis C virus in Central Asia: Systematic review, meta-analyses, and meta-regression analyses. Sci. Rep. 2019, 9, 2090. [Google Scholar] [CrossRef] [PubMed]
- Stasi, C.; Silvestri, C.; Voller, F. Update on Hepatitis C epidemiology: Unaware and untreated infected population could be the key to elimination. SN Compr. Clin. Med. 2020, 2, 2808–2815. [Google Scholar] [CrossRef] [PubMed]
- Bartenschlager, R.; Lohmann, V.; Penin, F. The molecular and structural basis of advanced antiviral therapy for Hepatitis C virus infection. Nat. Rev. Microbiol. 2013, 11, 482–496. [Google Scholar] [CrossRef]
- Moradpour, D.; Penin, F.; Rice, C.M. Replication of Hepatitis C virus. Nat. Rev. Microbiol. 2007, 5, 453–463. [Google Scholar] [CrossRef]
- Neufeldt, C.J.; Cortese, M.; Acosta, E.G.; Bartenschlager, R. Rewiring cellular networks by members of the Flaviviridae family. Nat. Rev. Microbiol. 2018, 16, 125–142. [Google Scholar] [CrossRef]
- Frakolaki, E.; Kalliampakou, K.I.; Kaimou, P.; Moraiti, M.; Kolaitis, N.; Boleti, H.; Koskinas, J.; Vassilacopoulou, D.; Vassilaki, N. Emerging role of l-Dopa decarboxylase in flaviviridae virus infections. Cells 2019, 8, 837. [Google Scholar] [CrossRef]
- Bertoldi, M. Mammalian Dopa decarboxylase: Structure, catalytic activity and inhibition. Arch. Biochem. Biophys. 2014, 546, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Florou, D.; Scorilas, A.; Vassilacopoulou, D.; Fragoulis, E.G. DDC (dopa decarboxylase (aromatic L-amino acid decarboxylase)). Atlas Genet. Cytogenet. Oncol. Haematol. 2010, 14, 942–950. [Google Scholar] [CrossRef][Green Version]
- Chalatsa, I.; Arvanitis, N.; Arvanitis, D.; Tsakou, A.C.; Kalantzis, E.D.; Vassiliou, A.G.; Sideris, D.C.; Frakolaki, E.; Vassilaki, N.; Vassilacopoulou, D. Human L-Dopa decarboxylase interaction with annexin V and expression during apoptosis. Biochimie 2020, 177, 78–86. [Google Scholar] [CrossRef] [PubMed]
- Vassiliou, A.G.; Siaterli, M.Z.; Frakolaki, E.; Gkogkosi, P.; Paspaltsis, I.; Sklaviadis, T.; Vassilacopoulou, D.; Vassilaki, N. L-Dopa decarboxylase interaction with the major signaling regulator RhoIota3Kappa in tissues and cells of neural and peripheral origin. Biochimie 2019, 160, 76–87. [Google Scholar] [CrossRef]
- Nagatsu, T. The catecholamine system in health and disease -Relation to tyrosine 3-monooxygenase and other catecholamine-synthesizing enzymes. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2007, 82, 388–415. [Google Scholar] [CrossRef]
- Segura-Aguilar, J.; Paris, I. Mechanisms of Dopamine Oxidation and Parkinson’s Disease; Springer: New York, NY, USA, 2014; pp. 865–883. [Google Scholar] [CrossRef]
- Guillot, T.S.; Miller, G.W. Protective actions of the vesicular monoamine transporter 2 (VMAT2) in monoaminergic neurons. Mol. Neurobiol. 2009, 39, 149–170. [Google Scholar] [CrossRef] [PubMed]
- Vazquez, P.; Robles, A.M.; de Pablo, F.; Hernandez-Sanchez, C. Non-neural tyrosine hydroxylase, via modulation of endocrine pancreatic precursors, is required for normal development of beta cells in the mouse pancreas. Diabetologia 2014, 57, 2339–2347. [Google Scholar] [CrossRef] [PubMed]
- Bergman, J.; Botling, J.; Fagerberg, L.; Hallstrom, B.M.; Djureinovic, D.; Uhlen, M.; Ponten, F. The human adrenal gland proteome defined by transcriptomics and antibody-based profiling. Endocrinology 2017, 158, 239–251. [Google Scholar] [CrossRef]
- Kennedy, B.; Bigby, T.D.; Ziegler, M.G. Nonadrenal epinephrine-forming enzymes in humans. Characteristics, distribution, regulation, and relationship to epinephrine levels. J. Clin. Investig. 1995, 95, 2896–2902. [Google Scholar] [CrossRef] [PubMed]
- Schafer, M.K.H.; Weihe, E.; Eiden, L.E. Localization and expression of VMAT2 aross mammalian species: A translational guide for its visualization and targeting in health and disease. Adv. Pharm. 2013, 68, 319–334. [Google Scholar] [CrossRef]
- The Human Protein Atlas—VMAT2. Available online: https://www.proteinatlas.org/ENSG00000165646-SLC18A2 (accessed on 26 January 2021).
- Yeung, A.W.K.; Georgieva, M.G.; Atanasov, A.G.; Tzvetkov, N.T. Monoamine Oxidases (MAOs) as privileged molecular targets in neuroscience: Research literature analysis. Front. Mol. Neurosci. 2019, 12, 143. [Google Scholar] [CrossRef]
- Shih, J.C.; Chen, K.; Ridd, M.J. Monoamine oxidase: From genes to behavior. Annu. Rev. Neurosci. 1999, 22, 197–217. [Google Scholar] [CrossRef]
- Sivasubramaniam, S.D.; Finch, C.C.; Rodriguez, M.J.; Mahy, N.; Billett, E.E. A comparative study of the expression of monoamine oxidase-A and -B mRNA and protein in non-CNS human tissues. Cell Tissue Res. 2003, 313, 291–300. [Google Scholar] [CrossRef] [PubMed]
- Li, L.L.; Li, K.; Liu, Y.H.; Xu, H.R.; Yu, X.Q. Red emission fluorescent probes for visualization of monoamine oxidase in living cells. Sci. Rep. 2016, 6, 31217. [Google Scholar] [CrossRef]
- Tabata, Y.; Shidoji, Y. Hepatic monoamine oxidase B is involved in endogenous geranylgeranoic acid synthesis in mammalian liver cells. J. Lipid Res. 2020, 61, 778–789. [Google Scholar] [CrossRef]
- Boxberger, K.H.; Hagenbuch, B.; Lampe, J.N. Common drugs inhibit human organic cation transporter 1 (OCT1)-mediated neurotransmitter uptake. Drug Metab. Dispos. Biol. Fate Chem. 2014, 42, 990–995. [Google Scholar] [CrossRef] [PubMed]
- Breidert, T.; Spitzenberger, F.; Grundemann, D.; Schomig, E. Catecholamine transport by the organic cation transporter type 1 (OCT1). Br. J. Pharm. 1998, 125, 218–224. [Google Scholar] [CrossRef] [PubMed]
- Eisenhofer, G. The role of neuronal and extraneuronal plasma membrane transporters in the inactivation of peripheral catecholamines. Pharmacol. Ther. 2001, 91, 35–62. [Google Scholar] [CrossRef]
- Zou, J.; Li, H.; Huang, Q.; Liu, X.; Qi, X.; Wang, Y.; Lu, L.; Liu, Z. Dopamine-induced SULT1A3/4 promotes EMT and cancer stemness in hepatocellular carcinoma. Tumour Biol. J. Int. Soc. Oncodev. Biol. Med. 2017, 39, 1010428317719272. [Google Scholar] [CrossRef]
- Yan, Y.; Pan, J.; Chen, Y.; Xing, W.; Li, Q.; Wang, D.; Zhou, X.; Xie, J.; Miao, C.; Yuan, Y.; et al. Increased dopamine and its receptor dopamine receptor D1 promote tumor growth in human hepatocellular carcinoma. Cancer Commun. 2020, 40, 694–710. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Yang, X.M.; Wang, Y.H.; Feng, M.X.; Liu, X.J.; Zhang, Y.L.; Huang, S.; Wu, Z.; Xue, F.; Qin, W.X.; et al. Monoamine oxidase A suppresses hepatocellular carcinoma metastasis by inhibiting the adrenergic system and its transactivation of EGFR signaling. J. Hepatol. 2014, 60, 1225–1234. [Google Scholar] [CrossRef]
- Exton, J.H. Mechanisms of hormonal regulation of hepatic glucose metabolism. Diabetes Metab. Rev. 1987, 3, 163–183. [Google Scholar] [CrossRef] [PubMed]
- Abu Rmilah, A.A.; Zhou, W.; Nyberg, S.L. Hormonal contribution to liver regeneration. Mayo Clin. Proc. Innov. Qual. Outcomes 2020, 4, 315–338. [Google Scholar] [CrossRef] [PubMed]
- Ohtake, Y.; Kobayashi, T.; Maruko, A.; Oh-Ishi, N.; Yamamoto, F.; Katoh, S.; Ohkubo, Y. Norepinephrine modulates the zonally different hepatocyte proliferation through the regulation of transglutaminase activity. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 299, G106–G114. [Google Scholar] [CrossRef]
- Peng, W.T.; Sun, W.Y.; Li, X.R.; Sun, J.C.; Du, J.J.; Wei, W. Emerging roles of g protein-coupled receptors in hepatocellular carcinoma. Int. J. Mol. Sci. 2018, 19, 1366. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Chen, W.; Zhi, X.; Ma, T.; Xia, X.; Liu, H.; Zhang, Q.; Hu, Q.; Zhang, Y.; Bai, X.; et al. Serotonin promotes the proliferation of serum-deprived hepatocellular carcinoma cells via upregulation of FOXO3a. Mol. Cancer 2013, 12, 14. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Li, C.; Zhang, G.; Tong, X.; Zhang, H.; Ding, J.; Ma, Y.; Cheng, R.; Hou, S.; An, S.; et al. Crucial roles of 5-HT and 5-HT2 receptor in diabetes-related lipid accumulation and pro-inflammatory cytokine generation in hepatocytes. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2018, 48, 2409–2428. [Google Scholar] [CrossRef]
- Mpekoulis, G.; Frakolaki, E.; Taka, S.; Ioannidis, A.; Vassiliou, A.G.; Kalliampakou, K.I.; Patas, K.; Karakasiliotis, I.; Aidinis, V.; Chatzipanagiotou, S.; et al. Alteration of L-Dopa decarboxylase expression in SARS-CoV-2 infection and its association with the interferon-inducible ACE2 isoform. PLoS ONE 2021, 16, e0253458. [Google Scholar] [CrossRef]
- Meulendyke, K.A.; Ubaida-Mohien, C.; Drewes, J.L.; Liao, Z.; Gama, L.; Witwer, K.W.; Graham, D.R.; Zink, M.C. Elevated brain monoamine oxidase activity in SIV- and HIV-associated neurological disease. J. Infect. Dis. 2014, 210, 904–912. [Google Scholar] [CrossRef]
- Bialowas, S.; Hagbom, M.; Nordgren, J.; Karlsson, T.; Sharma, S.; Magnusson, K.E.; Svensson, L. Rotavirus and serotonin cross-talk in diarrhoea. PLoS ONE 2016, 11, e0159660. [Google Scholar] [CrossRef]
- Masri, M.F.B.; Mantri, C.K.; Rathore, A.P.S.; John, A.L.S. Peripheral serotonin causes dengue virus-induced thrombocytopenia through 5HT2 receptors. Blood 2019, 133, 2325–2337. [Google Scholar] [CrossRef]
- Liao, Y.T.; Wang, S.M.; Wang, J.R.; Yu, C.K.; Liu, C.C. Norepinephrine and epinephrine enhanced the infectivity of enterovirus 71. PLoS ONE 2015, 10, e0135154. [Google Scholar] [CrossRef]
- Lycke, E.; Roos, B.E. Virus infections in infant mice causing persistent impairment of turnover of brain catecholamines. J. Neurol. Sci. 1975, 26, 49–60. [Google Scholar] [CrossRef]
- Simanjuntak, Y.; Liang, J.J.; Lee, Y.L.; Lin, Y.L. Repurposing of prochlorperazine for use against dengue virus infection. J. Infect. Dis. 2015, 211, 394–404. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.L.; Stein, D.A.; Shum, D.; Fischer, M.A.; Radu, C.; Bhinder, B.; Djaballah, H.; Nelson, J.A.; Fruh, K.; Hirsch, A.J. Inhibition of dengue virus replication by a class of small-molecule compounds that antagonize dopamine receptor d4 and downstream mitogen-activated protein kinase signaling. J. Virol. 2014, 88, 5533–5542. [Google Scholar] [CrossRef] [PubMed]
- Cao, L.; Chen, J.; Wang, Y.; Yang, Y.; Qing, J.; Rao, Z.; Chen, X.; Lou, Z. Identification of serotonin 2A receptor as a novel HCV entry factor by a chemical biology strategy. Protein Cell 2018, 10, 178–195. [Google Scholar] [CrossRef]
- Mainou, B.A.; Ashbrook, A.W.; Smith, E.C.; Dorset, D.C.; Denison, M.R.; Dermody, T.S. Serotonin Receptor agonist 5-nonyloxytryptamine alters the kinetics of reovirus cell entry. J. Virol. 2015, 89, 8701–8712. [Google Scholar] [CrossRef] [PubMed]
- Assetta, B.; Maginnis, M.S.; Gracia Ahufinger, I.; Haley, S.A.; Gee, G.V.; Nelson, C.D.; O’Hara, B.A.; Allen Ramdial, S.A.; Atwood, W.J. 5-HT2 receptors facilitate JC polyomavirus entry. J. Virol. 2013, 87, 13490–13498. [Google Scholar] [CrossRef] [PubMed]
- Gorres, K.; Hoffman, N. Inhibition of epstein-barr virus by serotonin-dopamine antagonists. FASEB J. 2020, 34, 1. [Google Scholar] [CrossRef]
- Blight, K.J.; McKeating, J.A.; Rice, C.M. Highly permissive cell lines for subgenomic and genomic Hepatitis C virus RNA replication. J. Virol. 2002, 76, 13001–13014. [Google Scholar] [CrossRef] [PubMed]
- Friebe, P.; Boudet, J.; Simorre, J.P.; Bartenschlager, R. Kissing-loop interaction in the 3’ end of the Hepatitis C virus genome essential for RNA replication. J. Virol. 2005, 79, 380–392. [Google Scholar] [CrossRef] [PubMed]
- Vrolijk, J.M.; Kaul, A.; Hansen, B.E.; Lohmann, V.; Haagmans, B.L.; Schalm, S.W.; Bartenschlager, R. A replicon-based bioassay for the measurement of interferons in patients with chronic hepatitis C. J. Virol. Methods 2003, 110, 201–209. [Google Scholar] [CrossRef]
- Reiss, S.; Rebhan, I.; Backes, P.; Romero-Brey, I.; Erfle, H.; Matula, P.; Kaderali, L.; Poenisch, M.; Blankenburg, H.; Hiet, M.S.; et al. Recruitment and activation of a lipid kinase by Hepatitis C virus NS5A is essential for integrity of the membranous replication compartment. Cell Host Microbe 2011, 9, 32–45. [Google Scholar] [CrossRef]
- Pietschmann, T.; Kaul, A.; Koutsoudakis, G.; Shavinskaya, A.; Kallis, S.; Steinmann, E.; Abid, K.; Negro, F.; Dreux, M.; Cosset, F.L.; et al. Construction and characterization of infectious intragenotypic and intergenotypic Hepatitis C virus chimeras. Proc. Natl. Acad. Sci. USA 2006, 103, 7408–7413. [Google Scholar] [CrossRef]
- Boleti, H.; Smirlis, D.; Dalagiorgou, G.; Meurs, E.F.; Christoforidis, S.; Mavromara, P. ER targeting and retention of the HCV NS4B protein relies on the concerted action of multiple structural features including its transmembrane domains. Mol. Membr. Biol. 2010, 27, 45–62. [Google Scholar] [CrossRef] [PubMed]
- Gawlik, K.; Baugh, J.; Chatterji, U.; Lim, P.J.; Bobardt, M.D.; Gallay, P.A. HCV core residues critical for infectivity are also involved in core-NS5A complex formation. PLoS ONE 2014, 9, e88866. [Google Scholar] [CrossRef]
- Kaul, A.; Woerz, I.; Meuleman, P.; Leroux-Roels, G.; Bartenschlager, R. Cell culture adaptation of Hepatitis C virus and in vivo viability of an adapted variant. J. Virol. 2007, 81, 13168–13179. [Google Scholar] [CrossRef]
- Van den Hoff, M.J.; Christoffels, V.M.; Labruyere, W.T.; Moorman, A.F.; Lamers, W.H. Electrotransfection with “intracellular” buffer. Methods Mol. Biol. 1995, 48, 185–197. [Google Scholar] [CrossRef] [PubMed]
- Vassilaki, N.; Friebe, P.; Meuleman, P.; Kallis, S.; Kaul, A.; Paranhos-Baccala, G.; Leroux-Roels, G.; Mavromara, P.; Bartenschlager, R. Role of the Hepatitis C virus core+1 open reading frame and core cis-acting RNA elements in viral RNA translation and replication. J. Virol. 2008, 82, 11503–11515. [Google Scholar] [CrossRef] [PubMed]
- Lindenbach, B.D.; Evans, M.J.; Syder, A.J.; Wolk, B.; Tellinghuisen, T.L.; Liu, C.C.; Maruyama, T.; Hynes, R.O.; Burton, D.R.; McKeating, J.A.; et al. Complete replication of Hepatitis C virus in cell culture. Science 2005, 309, 623–626. [Google Scholar] [CrossRef]
- Vassilaki, N.; Boleti, H.; Mavromara, P. Expression studies of the HCV-1a core+1 open reading frame in mammalian cells. Virus Res. 2008, 133, 123–135. [Google Scholar] [CrossRef] [PubMed]
- Dunn, K.W.; Kamocka, M.M.; McDonald, J.H. A practical guide to evaluating colocalization in biological microscopy. Am. J. Physiol. Cell Physiol. 2011, 300, C723–C742. [Google Scholar] [CrossRef]
- Icy, an Open Community Platform for Bioimaging. Available online: http://icy.bioimageanalysis.com (accessed on 25 April 2019).
- Zhang, Q.B.; Zhang, B.H.; Zhang, K.Z.; Meng, X.T.; Jia, Q.A.; Zhang, Q.B.; Bu, Y.; Zhu, X.D.; Ma, D.N.; Ye, B.G.; et al. Moderate swimming suppressed the growth and metastasis of the transplanted liver cancer in mice model: With reference to nervous system. Oncogene 2016, 35, 4122–4131. [Google Scholar] [CrossRef]
- Liu, X.F.; Long, H.J.; Miao, X.Y.; Liu, G.L.; Yao, H.L. Fisetin inhibits liver cancer growth in a mouse model: Relation to dopamine receptor. Oncol. Rep. 2017, 38, 53–62. [Google Scholar] [CrossRef]
- Harkitis, P.; Daskalopoulos, E.P.; Malliou, F.; Lang, M.A.; Marselos, M.; Fotopoulos, A.; Albucharali, G.; Konstandi, M. Dopamine D2-receptor antagonists down-regulate CYP1A1/2 and CYP1B1 in the rat liver. PLoS ONE 2015, 10, e0128708. [Google Scholar] [CrossRef]
- Metzger, R.R.; Brown, J.M.; Sandoval, V.; Rau, K.S.; Elwan, M.A.; Miller, G.W.; Hanson, G.R.; Fleckenstein, A.E. Inhibitory effect of reserpine on dopamine transporter function. Eur. J. Pharmacol. 2002, 456, 39–43. [Google Scholar] [CrossRef]
- Yamamoto, H.; Kamegaya, E.; Hagino, Y.; Imai, K.; Fujikawa, A.; Tamura, K.; Enokiya, T.; Yamamoto, T.; Takeshima, T.; Koga, H.; et al. Genetic deletion of vesicular monoamine transporter-2 (VMAT2) reduces dopamine transporter activity in mesencephalic neurons in primary culture. Neurochem. Int. 2007, 51, 237–244. [Google Scholar] [CrossRef] [PubMed]
- Egana, L.A.; Cuevas, R.A.; Baust, T.B.; Parra, L.A.; Leak, R.K.; Hochendoner, S.; Pena, K.; Quiroz, M.; Hong, W.C.; Dorostkar, M.M.; et al. Physical and functional interaction between the dopamine transporter and the synaptic vesicle protein synaptogyrin-3. J. Neurosci. Off. J. Soc. Neurosci. 2009, 29, 4592–4604. [Google Scholar] [CrossRef] [PubMed]
- Mandela, P.; Chandley, M.; Xu, Y.Y.; Zhu, M.Y.; Ordway, G.A. Reserpine-induced reduction in norepinephrine transporter function requires catecholamine storage vesicles. Neurochem. Int. 2010, 56, 760–767. [Google Scholar] [CrossRef]
- Kandel, E.R.; Schwartz, J.H.; Jessell, T.M. Disorders of mood: Depression, mania and anxiety disorders. In Principles of Neural Sciences, 3rd ed.; Elsevier: New York, NY, USA, 1991; pp. 869–889. [Google Scholar]
- Foye, W.O.; Lemke, T.L.; Williams, D.A. Medicinals of plant origin: Historical aspect. In Medicinal Chemistry, 1st ed.; B.I. Waverly Pvt. Ltd: New Delhi, India, 1995; pp. 7–11. [Google Scholar]
- Cubells, J.F.; Kim, K.S.; Baker, H.; Volpe, B.T.; Chung, Y.; Houpt, T.A.; Wessel, T.C.; Joh, T.H. Differential in vivo regulation of mRNA encoding the norepinephrine transporter and tyrosine hydroxylase in rat adrenal medulla and locus ceruleus. J. Neurochem. 1995, 65, 502–509. [Google Scholar] [CrossRef]
- Cui, R.; Kang, Y.; Wang, L.; Li, S.; Ji, X.; Yan, W.; Zhang, G.; Cui, H.; Shi, G. Testosterone propionate exacerbates the deficits of nigrostriatal dopaminergic system and downregulates Nrf2 expression in reserpine-treated aged male rats. Front. Aging Neurosci. 2017, 9, 172. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Z.D.; Wattiaux-de Coninck, S.; Wattiaux, R. Uptake of dopamine by rat hepatocytes in vitro. Zhongguo Yao Li Xue Bao Acta Pharmacol. Sin. 1994, 15, 289–294. [Google Scholar]
- Stanley, W.C.; Li, B.; Bonhaus, D.W.; Johnson, L.G.; Lee, K.; Porter, S.; Walker, K.; Martinez, G.; Eglen, R.M.; Whiting, R.L.; et al. Catecholamine modulatory effects of nepicastat (RS-25560-197), a novel, potent and selective inhibitor of dopamine-beta-hydroxylase. Br. J. Pharm. 1997, 121, 1803–1809. [Google Scholar] [CrossRef]
- Dienel, G.A.; Cruz, N.F. Aerobic glycolysis during brain activation: Adrenergic regulation and influence of norepinephrine on astrocytic metabolism. J. Neurochem. 2016, 138, 14–52. [Google Scholar] [CrossRef] [PubMed]
- Bolton, J.L.; Trush, M.A.; Penning, T.M.; Dryhurst, G.; Monks, T.J. Role of quinones in toxicology. Chem. Res. Toxicol. 2000, 13, 135–160. [Google Scholar] [CrossRef] [PubMed]
- Berry, M.D.; Juorio, A.V.; Li, X.M.; Boulton, A.A. Aromatic L-amino acid decarboxylase: A neglected and misunderstood enzyme. Neurochem. Res. 1996, 21, 1075–1087. [Google Scholar] [CrossRef] [PubMed]
- Wong, W.K.; Ou, X.M.; Chen, K.; Shih, J.C. Activation of human monoamine oxidase B gene expression by a protein kinase C MAPK signal transduction pathway involves c-Jun and Egr-1. J. Biol. Chem. 2002, 277, 22222–22230. [Google Scholar] [CrossRef] [PubMed]
- Graves, S.M.; Xie, Z.; Stout, K.A.; Zampese, E.; Burbulla, L.F.; Shih, J.C.; Kondapalli, J.; Patriarchi, T.; Tian, L.; Brichta, L.; et al. Dopamine metabolism by a monoamine oxidase mitochondrial shuttle activates the electron transport chain. Nat. Neurosci. 2020, 23, 15–20. [Google Scholar] [CrossRef]
- Huang, H.; Chen, Y.; Ye, J. Inhibition of Hepatitis C virus replication by peroxidation of arachidonate and restoration by vitamin E. Proc. Natl. Acad. Sci. USA 2007, 104, 18666–18670. [Google Scholar] [CrossRef]
- Choi, J.; Lee, K.J.; Zheng, Y.; Yamaga, A.K.; Lai, M.M.; Ou, J.H. Reactive oxygen species suppress Hepatitis C virus RNA replication in human hepatoma cells. Hepatology 2004, 39, 81–89. [Google Scholar] [CrossRef]
- Rios-Ocampo, W.A.; Navas, M.C.; Buist-Homan, M.; Faber, K.N.; Daemen, T.; Moshage, H. Hepatitis C virus proteins core and NS5A are highly sensitive to oxidative stress-induced degradation after eIF2alpha/ATF4 pathway activation. Viruses 2020, 12, 425. [Google Scholar] [CrossRef]
- Raghunath, A.; Sundarraj, K.; Nagarajan, R.; Arfuso, F.; Bian, J.; Kumar, A.P.; Sethi, G.; Perumal, E. Antioxidant response elements: Discovery, classes, regulation and potential applications. Redox Biol. 2018, 17, 297–314. [Google Scholar] [CrossRef]
- Kosmidou, I.; Xagorari, A.; Roussos, C.; Papapetropoulos, A. Reactive oxygen species stimulate VEGF production from C(2)C(12) skeletal myotubes through a PI3K/Akt pathway. Am. J. Physiol. Lung Cell. Mol. Physiol. 2001, 280, L585–L592. [Google Scholar] [CrossRef]
- Dichtl, S.; Haschka, D.; Nairz, M.; Seifert, M.; Volani, C.; Lutz, O.; Weiss, G. Dopamine promotes cellular iron accumulation and oxidative stress responses in macrophages. Biochem. Pharmacol. 2018, 148, 193–201. [Google Scholar] [CrossRef]
- Berger, S.P.; Hunger, M.; Yard, B.A.; Schnuelle, P.; Van Der Woude, F.J. Dopamine induces the expression of heme oxygenase-1 by human endothelial cells in vitro. Kidney Int. 2000, 58, 2314–2319. [Google Scholar] [CrossRef]
- Aydin, Y.; Kurt, R.; Song, K.; Lin, D.; Osman, H.; Youngquist, B.; Scott, J.W.; Shores, N.J.; Thevenot, P.; Cohen, A.; et al. Hepatic stress response in HCV infection promotes STAT3-mediated inhibition of HNF4A-miR-122 feedback loop in liver fibrosis and cancer progression. Cancers 2019, 11, 1407. [Google Scholar] [CrossRef] [PubMed]
- Nasimuzzaman, M.; Waris, G.; Mikolon, D.; Stupack, D.G.; Siddiqui, A. Hepatitis C virus stabilizes hypoxia-inducible factor 1alpha and stimulates the synthesis of vascular endothelial growth factor. J. Virol. 2007, 81, 10249–10257. [Google Scholar] [CrossRef] [PubMed]
- Lozano-Sepulveda, S.A.; Bryan-Marrugo, O.L.; Cordova-Fletes, C.; Gutierrez-Ruiz, M.C.; Rivas-Estilla, A.M. Oxidative stress modulation in Hepatitis C virus infected cells. World J. Hepatol. 2015, 7, 2880–2889. [Google Scholar] [CrossRef] [PubMed]
- Dash, S.; Aydin, Y.; Wu, T. Integrated stress response in hepatitis C promotes Nrf2-related chaperone-mediated autophagy: A novel mechanism for host-microbe survival and HCC development in liver cirrhosis. In Seminars in Cell & Developmental Biology; Academic Press: Cambridge, MA, USA, 2020; Volume 101, pp. 20–35. [Google Scholar] [CrossRef]
- Ighodaro, O.M.; Akinloye, O.A. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alex. J. Med. 2017, 54, 287–293. [Google Scholar] [CrossRef]
- Moradpour, D.; Penin, F. Hepatitis C virus proteins: From structure to function. Curr. Top. Microbiol. Immunol. 2013, 369, 113–142. [Google Scholar] [CrossRef] [PubMed]
- The Human Protein Atlas—VMAT1. Available online: https://www.proteinatlas.org/ENSG00000036565-SLC18A1 (accessed on 26 January 2021).
- Mathew, S.; Faheem, M.; Ibrahim, S.M.; Iqbal, W.; Rauff, B.; Fatima, K.; Qadri, I. Hepatitis C virus and neurological damage. World J. Hepatol. 2016, 8, 545–556. [Google Scholar] [CrossRef]
- Weissenborn, K.; Ennen, J.C.; Bokemeyer, M.; Ahl, B.; Wurster, U.; Tillmann, H.; Trebst, C.; Hecker, H.; Berding, G. Monoaminergic neurotransmission is altered in Hepatitis C virus infected patients with chronic fatigue and cognitive impairment. Gut 2006, 55, 1624–1630. [Google Scholar] [CrossRef] [PubMed]
- Becker, M.L.; Visser, L.E.; van Schaik, R.H.; Hofman, A.; Uitterlinden, A.G.; Stricker, B.H. OCT1 polymorphism is associated with response and survival time in anti-Parkinsonian drug users. Neurogenetics 2011, 12, 79–82. [Google Scholar] [CrossRef]
- Lepack, A.E.; Werner, C.T.; Stewart, A.F.; Fulton, S.L.; Zhong, P.; Farrelly, L.A.; Smith, A.C.W.; Ramakrishnan, A.; Lyu, Y.; Bastle, R.M.; et al. Dopaminylation of histone H3 in ventral tegmental area regulates cocaine seeking. Science 2020, 368, 197–201. [Google Scholar] [CrossRef]
- Farrelly, L.A.; Thompson, R.E.; Zhao, S.; Lepack, A.E.; Lyu, Y.; Bhanu, N.V.; Zhang, B.; Loh, Y.E.; Ramakrishnan, A.; Vadodaria, K.C.; et al. Histone serotonylation is a permissive modification that enhances TFIID binding to H3K4me3. Nature 2019, 567, 535–539. [Google Scholar] [CrossRef] [PubMed]
- Flatmark, T. Catecholamine biosynthesis and physiological regulation in neuroendocrine cells. Acta Physiol. Scand. 2000, 168, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Lopez, E.; Vrana, K.E. Dopamine beta-hydroxylase and its genetic variants in human health and disease. J. Neurochem. 2020, 152, 157–181. [Google Scholar] [CrossRef] [PubMed]
- Su, W.C.; Chao, T.C.; Huang, Y.L.; Weng, S.C.; Jeng, K.S.; Lai, M.M. Rab5 and class III phosphoinositide 3-kinase Vps34 are involved in Hepatitis C virus NS4B-induced autophagy. J. Virol. 2011, 85, 10561–10571. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.F.; He, B.; Li, N.P.; Ma, J.; Gong, G.Z.; Zhang, M. The oncogenic role of NS5A of Hepatitis C virus is mediated by up-regulation of survivin gene expression in the hepatocellular cell through p53 and NF-kappaB pathways. Cell Biol. Int. 2011, 35, 1225–1232. [Google Scholar] [CrossRef] [PubMed]
- Kuchay, S.; Saeed, M.; Giorgi, C.; Li, J.; Hoffmann, H.H.; Pinton, P.; Rice, C.M.; Pagano, M. NS5A promotes constitutive degradation of IP3R3 to counteract apoptosis induced by Hepatitis C virus. Cell Rep. 2018, 25, 833–840.e3. [Google Scholar] [CrossRef] [PubMed]









| Target | Orientation | Sequence (5′ - 3′) |
|---|---|---|
| JFH1-276-F | Forward | GGCCTTGTGGTACTGCCTGATA |
| JFH1-354-R | Reverse | GGATTTGTGCTCATGGTGCA |
| DDC | Forward | GAACAGACTTAACGGGAGCCTTT |
| Reverse | AATGCCGGTAGTCAGTGATAAGC | |
| TH | Forward | GGAAGGCCGTGCTAAACCT |
| Reverse | GGATTTTGGCTTCAAACGTCTC | |
| DBH | Forward | GCCTTCATCCTCACTGGCTACT |
| Reverse | CAGCACTGTGACCACCTTTCTC | |
| MAOA | Forward | GGGCTGCTACACGGCCTACT |
| Reverse | GACCTCCCTAGCTGCTCGTTCT | |
| MAOB | Forward | GGAGCCAGTGCATTATGAAGA |
| Reverse | GCCTGCAAAGTAAATCCTGTC | |
| VMAT2 | Forward | CGGATGTGGCATTTTGTATGG |
| Reverse | TTCTTCTTTGGCAGGTGGACTTC | |
| OCT1 | Forward | CACCCCCTTCATAGTCTTCAG |
| Reverse | GCCCAACACCGCAAACAAAAT | |
| NRF2 | Forward | TGAGCAAGTTTGGGAGGAGC |
| Reverse | GGCTTCTGGACTTGGAACCAT | |
| HO-1 | Forward | ATGACACCAAGGACCAGAGC |
| Reverse | GTGTAAGGACCCATCGGAGA | |
| VEGFA | Forward | CTTGCCTTGCTGCTCTAC |
| Reverse | TGGCTTGAAGATGTACTCG | |
| YWHAZ | Forward | GCTGGTGATGACAAGAAAGG |
| Reverse | GGATGTGTTGGTTGCATTTCCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mpekoulis, G.; Tsopela, V.; Panos, G.; Siozos, V.; Kalliampakou, K.I.; Frakolaki, E.; Sideris, C.D.; Vassiliou, A.G.; Sideris, D.C.; Vassilacopoulou, D.; et al. Association of Hepatitis C Virus Replication with the Catecholamine Biosynthetic Pathway. Viruses 2021, 13, 2139. https://doi.org/10.3390/v13112139
Mpekoulis G, Tsopela V, Panos G, Siozos V, Kalliampakou KI, Frakolaki E, Sideris CD, Vassiliou AG, Sideris DC, Vassilacopoulou D, et al. Association of Hepatitis C Virus Replication with the Catecholamine Biosynthetic Pathway. Viruses. 2021; 13(11):2139. https://doi.org/10.3390/v13112139
Chicago/Turabian StyleMpekoulis, George, Vassilina Tsopela, Georgios Panos, Vasileiοs Siozos, Katerina I. Kalliampakou, Efseveia Frakolaki, Constantinos D. Sideris, Alice G. Vassiliou, Diamantis C. Sideris, Dido Vassilacopoulou, and et al. 2021. "Association of Hepatitis C Virus Replication with the Catecholamine Biosynthetic Pathway" Viruses 13, no. 11: 2139. https://doi.org/10.3390/v13112139
APA StyleMpekoulis, G., Tsopela, V., Panos, G., Siozos, V., Kalliampakou, K. I., Frakolaki, E., Sideris, C. D., Vassiliou, A. G., Sideris, D. C., Vassilacopoulou, D., & Vassilaki, N. (2021). Association of Hepatitis C Virus Replication with the Catecholamine Biosynthetic Pathway. Viruses, 13(11), 2139. https://doi.org/10.3390/v13112139

