High Throughput Screening of FDA-Approved Drug Library Reveals the Compounds that Promote IRF3-Mediated Pro-Apoptotic Pathway Inhibit Virus Replication
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells, Plasmids, and Reagents
2.2. High-Throughput SCREENING of FDA-Approved Drug Library to Isolate RIPA Activators
2.3. RIPA Stimulation and Drug Treatments
2.4. Generation of CRISPR/Cas9-Mediated IRF3 Knockout Cells
2.5. Virus Infection and Quantification
2.6. Cell Lysis, Immunoblot, and Ubiquitination Assay
2.7. RNA Isolation and qRT-PCR Analyses
- IFIT1-fwd: TCTCAGAGGAGCCTGGCTAAG,
- IFIT1-rev: GTCACCAGACTCCTCACATTTGC,
- IFIT3-fwd: GAACATGCTGACCAAGCAGA,
- IFIT3-rev: CAGTTGTGTCCACCCTTCCT,
- IFNB1-fwd: CGCCGCATTGACCATCTA,
- IFNB1-rev: GACATTAGCCAGGAGGTTCT,
- 18S-fwd: ATTGACGGAAGGGCACCACCAG,
- 18S-rev: CAAATCGCTCCACCAACTAAGAACG.
2.8. Confocal Microscopy
2.9. Caspase Activity
2.10. Cell Viability Assays
2.11. Statistical Analyses
3. Results
3.1. High Throughput Screen to Identify Small Molecule Activators of the Antiviral RIPA Branch of IRF3
3.2. The RIPA-Promoting Agent Doxorubicin Inhibits Vesicular Stomatitis Virus (VSV) Replication in an IRF3-Dependent Manner
3.3. Doxorubicin Inhibits the Transcriptional Activity of IRF3
3.4. Doxorubicin Is a Newly Identified Activator of the RIPA Branch of IRF3
3.5. Doxorubicin Promotes RIPA by Activating the ERK Signaling Pathway
3.6. Doxorubicin Inhibits Flavivirus and Herpesvirus Replication
3.7. Pyrvinium Pamoate, Another RIPA-Promoting Compound Inhibits Virus Replication without Affecting the Transcriptional Activity of IRF3
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fensterl, V.; Chattopadhyay, S.; Sen, G.C. No Love Lost Between Viruses and Interferons. Annu. Rev. Virol. 2015, 2, 549–572. [Google Scholar] [CrossRef] [PubMed]
- Ikushima, H.; Negishi, H.; Taniguchi, T. The IRF family transcription factors at the interface of innate and adaptive immune responses. Cold Spring Harb. Symp. Quant. Biol. 2013, 78, 105–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jefferies, C.A. Regulating IRFs in IFN Driven Disease. Front. Immunol. 2019, 10, 325. [Google Scholar] [CrossRef] [Green Version]
- Hiscott, J. Convergence of the NF-kappaB and IRF pathways in the regulation of the innate antiviral response. Cytokine Growth Factor Rev. 2007, 18, 483–490. [Google Scholar] [CrossRef]
- Schoggins, J.W.; Rice, C.M. Interferon-stimulated genes and their antiviral effector functions. Curr. Opin. Virol. 2011, 1, 519–525. [Google Scholar] [CrossRef]
- Chattopadhyay, S.; Fensterl, V.; Zhang, Y.; Veleeparambil, M.; Wetzel, J.L.; Sen, G.C. Inhibition of viral pathogenesis and promotion of the septic shock response to bacterial infection by IRF-3 are regulated by the acetylation and phosphorylation of its coactivators. MBio 2013, 4, e00636. [Google Scholar] [CrossRef] [Green Version]
- Chattopadhyay, S.; Kuzmanovic, T.; Zhang, Y.; Wetzel, J.L.; Sen, G.C. Ubiquitination of the Transcription Factor IRF-3 Activates RIPA, the Apoptotic Pathway that Protects Mice from Viral Pathogenesis. Immunity 2016, 44, 1151–1161. [Google Scholar] [CrossRef] [Green Version]
- Chattopadhyay, S.; Fensterl, V.; Zhang, Y.; Veleeparambil, M.; Yamashita, M.; Sen, G.C. Role of interferon regulatory factor 3-mediated apoptosis in the establishment and maintenance of persistent infection by Sendai virus. J. Virol. 2013, 87, 16–24. [Google Scholar] [CrossRef] [Green Version]
- Chattopadhyay, S.; Marques, J.T.; Yamashita, M.; Peters, K.L.; Smith, K.; Desai, A.; Williams, B.R.; Sen, G.C. Viral apoptosis is induced by IRF-3-mediated activation of Bax. EMBO J. 2010, 29, 1762–1773. [Google Scholar] [CrossRef] [Green Version]
- Chattopadhyay, S.; Sen, G.C. IRF-3 and Bax: A deadly affair. Cell Cycle 2010, 9, 2479–2480. [Google Scholar] [CrossRef] [Green Version]
- Chattopadhyay, S.; Sen, G.C. dsRNA-activation of TLR3 and RLR signaling: Gene induction-dependent and independent effects. J. Interferon Cytokine Res. 2014, 34, 427–436. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chattopadhyay, S.; Sen, G.C. RIG-I-like receptor-induced IRF3 mediated pathway of apoptosis (RIPA): A new antiviral pathway. Protein Cell 2017, 8, 165–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chattopadhyay, S.; Yamashita, M.; Zhang, Y.; Sen, G.C. The IRF-3/Bax-mediated apoptotic pathway, activated by viral cytoplasmic RNA and DNA, inhibits virus replication. J. Virol. 2011, 85, 3708–3716. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peters, K.; Chattopadhyay, S.; Sen, G.C. IRF-3 activation by Sendai virus infection is required for cellular apoptosis and avoidance of persistence. J. Virol. 2008, 82, 3500–3508. [Google Scholar] [CrossRef] [Green Version]
- White, C.L.; Chattopadhyay, S.; Sen, G.C. Phosphatidylinositol 3-kinase signaling delays sendai virus-induced apoptosis by preventing XIAP degradation. J. Virol. 2011, 85, 5224–5227. [Google Scholar] [CrossRef] [Green Version]
- Sze, A.; Belgnaoui, S.M.; Olagnier, D.; Lin, R.; Hiscott, J.; van Grevenynghe, J. Host restriction factor SAMHD1 limits human T cell leukemia virus type 1 infection of monocytes via STING-mediated apoptosis. Cell Host Microbe 2013, 14, 422–434. [Google Scholar] [CrossRef] [Green Version]
- Petrasek, J.; Iracheta-Vellve, A.; Csak, T.; Satishchandran, A.; Kodys, K.; Kurt-Jones, E.A.; Fitzgerald, K.A.; Szabo, G. STING-IRF3 pathway links endoplasmic reticulum stress with hepatocyte apoptosis in early alcoholic liver disease. Proc. Natl. Acad. Sci. USA 2013, 110, 16544–16549. [Google Scholar] [CrossRef] [Green Version]
- Sanz-Garcia, C.; Poulsen, K.L.; Bellos, D.; Wang, H.; McMullen, M.R.; Li, X.; Chattopadhyay, S.; Sen, G.; Nagy, L.E. The non-transcriptional activity of IRF3 modulates hepatic immune cell populations in acute on chronic ethanol administration in mice. J. Hepatol. 2019, 70, 974–984. [Google Scholar] [CrossRef]
- Sanz-Garcia, C.; McMullen, M.R.; Chattopadhyay, S.; Roychowdhury, S.; Sen, G.; Nagy, L.E. Nontranscriptional Activity of Interferon Regulatory Factor 3 Protects Mice From High-Fat Diet-Induced Liver Injury. Hepatol. Commun. 2019, 3, 1626–1641. [Google Scholar] [CrossRef]
- Wang, X.; Majumdar, T.; Kessler, P.; Ozhegov, E.; Zhang, Y.; Chattopadhyay, S.; Barik, S.; Sen, G.C. STING Requires the Adaptor TRIF to Trigger Innate Immune Responses to Microbial Infection. Cell Host Microbe 2016, 20, 329–341. [Google Scholar] [CrossRef] [Green Version]
- Lefrancois, L.; Lyles, D.S. The interaction of antibody with the major surface glycoprotein of vesicular stomatitis virus. I. Analysis of neutralizing epitopes with monoclonal antibodies. Virology 1982, 121, 157–167. [Google Scholar] [CrossRef]
- Presloid, J.B.; Mohammad, T.F.; Lauring, A.S.; Novella, I.S. Antigenic diversification is correlated with increased thermostability in a mammalian virus. Virology 2016, 496, 203–214. [Google Scholar] [CrossRef] [PubMed]
- Youseff, B.H.; Brewer, T.G.; McNally, K.L.; Izuogu, A.O.; Lubick, K.J.; Presloid, J.B.; Alqahtani, S.; Chattopadhyay, S.; Best, S.M.; Hu, X.; et al. TRAF6 Plays a Proviral Role in Tick-Borne Flavivirus Infection through Interaction with the NS3 Protease. iScience 2019, 15, 489–501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, H.; Thakur, C.S.; Chattopadhyay, S.; Silverman, R.H.; Gudkov, A.; Banerjee, A.K. Inhibition of human parainfluenza virus type 3 infection by novel small molecules. Antivir. Res. 2008, 77, 83–94. [Google Scholar] [CrossRef] [Green Version]
- Martin, C.; Leyton, L.; Hott, M.; Arancibia, Y.; Spichiger, C.; McNiven, M.A.; Court, F.A.; Concha, M.I.; Burgos, P.V.; Otth, C. Herpes Simplex Virus Type 1 Neuronal Infection Perturbs Golgi Apparatus Integrity through Activation of Src Tyrosine Kinase and Dyn-2 GTPase. Front. Cell. Infect. Microbiol. 2017, 7, 371. [Google Scholar] [CrossRef] [Green Version]
- Subramanian, G.; Kuzmanovic, T.; Zhang, Y.; Peter, C.B.; Veleeparambil, M.; Chakravarti, R.; Sen, G.C.; Chattopadhyay, S. A new mechanism of interferon’s antiviral action: Induction of autophagy, essential for paramyxovirus replication, is inhibited by the interferon stimulated gene, TDRD7. PLoS Pathog. 2018, 14, e1006877. [Google Scholar] [CrossRef] [Green Version]
- Mizumoto, N.; Gao, J.; Matsushima, H.; Ogawa, Y.; Tanaka, H.; Takashima, A. Discovery of novel immunostimulants by dendritic-cell-based functional screening. Blood 2005, 106, 3082–3089. [Google Scholar] [CrossRef] [Green Version]
- Kim, T.; Kim, T.Y.; Song, Y.H.; Min, I.M.; Yim, J.; Kim, T.K. Activation of interferon regulatory factor 3 in response to DNA-damaging agents. J. Biol. Chem. 1999, 274, 30686–30689. [Google Scholar] [CrossRef] [Green Version]
- Tewey, K.M.; Rowe, T.C.; Yang, L.; Halligan, B.D.; Liu, L.F. Adriamycin-induced DNA damage mediated by mammalian DNA topoisomerase II. Science 1984, 226, 466–468. [Google Scholar] [CrossRef]
- Zhang, S.; Liu, X.; Bawa-Khalfe, T.; Lu, L.S.; Lyu, Y.L.; Liu, L.F.; Yeh, E.T. Identification of the molecular basis of doxorubicin-induced cardiotoxicity. Nat. Med. 2012, 18, 1639–1642. [Google Scholar] [CrossRef]
- Marques, J.T.; Rebouillat, D.; Ramana, C.V.; Murakami, J.; Hill, J.E.; Gudkov, A.; Silverman, R.H.; Stark, G.R.; Williams, B.R. Down-regulation of p53 by double-stranded RNA modulates the antiviral response. J. Virol. 2005, 79, 11105–11114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, R.; Ye, J.; Zhu, B.; Song, Y.; Chen, H.; Cao, S. Roles of TLR3 and RIG-I in mediating the inflammatory response in mouse microglia following Japanese encephalitis virus infection. J. Immunol. Res. 2014, 2014, 787023. [Google Scholar] [CrossRef] [PubMed]
- Nacken, W.; Anhlan, D.; Hrincius, E.R.; Mostafa, A.; Wolff, T.; Sadewasser, A.; Pleschka, S.; Ehrhardt, C.; Ludwig, S. Activation of c-jun N-terminal kinase upon influenza A virus (IAV) infection is independent of pathogen-related receptors but dependent on amino acid sequence variations of IAV NS1. J. Virol. 2014, 88, 8843–8852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melchjorsen, J.; Rintahaka, J.; Soby, S.; Horan, K.A.; Poltajainen, A.; Ostergaard, L.; Paludan, S.R.; Matikainen, S. Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVS-dependent and MDA5/MAVS/RNA polymerase III-independent pathways. J. Virol. 2010, 84, 11350–11358. [Google Scholar] [CrossRef] [Green Version]
- Fredericksen, B.L.; Keller, B.C.; Fornek, J.; Katze, M.G.; Gale, M., Jr. Establishment and maintenance of the innate antiviral response to West Nile Virus involves both RIG-I and MDA5 signaling through IPS-1. J. Virol. 2008, 82, 609–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chazal, M.; Beauclair, G.; Gracias, S.; Najburg, V.; Simon-Loriere, E.; Tangy, F.; Komarova, A.V.; Jouvenet, N. RIG-I Recognizes the 5′ Region of Dengue and Zika Virus Genomes. Cell Rep. 2018, 24, 320–328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fensterl, V.; Sen, G.C. Interferons and viral infections. Biofactors 2009, 35, 14–20. [Google Scholar] [CrossRef]
- Hiscott, J. Triggering the innate antiviral response through IRF-3 activation. J. Biol. Chem. 2007, 282, 15325–15329. [Google Scholar] [CrossRef] [Green Version]
- Zhu, J.; Smith, K.; Hsieh, P.N.; Mburu, Y.K.; Chattopadhyay, S.; Sen, G.C.; Sarkar, S.N. High-throughput screening for TLR3-IFN regulatory factor 3 signaling pathway modulators identifies several antipsychotic drugs as TLR inhibitors. J. Immunol. 2010, 184, 5768–5776. [Google Scholar] [CrossRef]
- Gall, B.; Pryke, K.; Abraham, J.; Mizuno, N.; Botto, S.; Sali, T.M.; Broeckel, R.; Haese, N.; Nilsen, A.; Placzek, A.; et al. Emerging Alphaviruses Are Sensitive to Cellular States Induced by a Novel Small-Molecule Agonist of the STING Pathway. J. Virol. 2018, 92. [Google Scholar] [CrossRef] [Green Version]
- Gage, Z.O.; Vasou, A.; Gray, D.W.; Randall, R.E.; Adamson, C.S. Identification of Novel Inhibitors of the Type I Interferon Induction Pathway Using Cell-Based High-Throughput Screening. J. Biomol. Screen. 2016, 21, 978–988. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Probst, P.; Grigg, J.B.; Wang, M.; Munoz, E.; Loo, Y.M.; Ireton, R.C.; Gale, M., Jr.; Iadonato, S.P.; Bedard, K.M. A small-molecule IRF3 agonist functions as an influenza vaccine adjuvant by modulating the antiviral immune response. Vaccine 2017, 35, 1964–1971. [Google Scholar] [CrossRef] [PubMed]
- Sali, T.M.; Pryke, K.M.; Abraham, J.; Liu, A.; Archer, I.; Broeckel, R.; Staverosky, J.A.; Smith, J.L.; Al-Shammari, A.; Amsler, L.; et al. Characterization of a Novel Human-Specific STING Agonist that Elicits Antiviral Activity Against Emerging Alphaviruses. PLoS Pathog. 2015, 11, e1005324. [Google Scholar] [CrossRef] [PubMed]
- Pang, B.; Qiao, X.; Janssen, L.; Velds, A.; Groothuis, T.; Kerkhoven, R.; Nieuwland, M.; Ovaa, H.; Rottenberg, S.; van Tellingen, O.; et al. Drug-induced histone eviction from open chromatin contributes to the chemotherapeutic effects of doxorubicin. Nat. Commun. 2013, 4, 1908. [Google Scholar] [CrossRef] [Green Version]
- Taylor, K.E.; Mossman, K.L. Recent advances in understanding viral evasion of type I interferon. Immunology 2013, 138, 190–197. [Google Scholar] [CrossRef] [Green Version]
- Luthra, P.; Aguirre, S.; Yen, B.C.; Pietzsch, C.A.; Sanchez-Aparicio, M.T.; Tigabu, B.; Morlock, L.K.; Garcia-Sastre, A.; Leung, D.W.; Williams, N.S.; et al. Topoisomerase II Inhibitors Induce DNA Damage-Dependent Interferon Responses Circumventing Ebola Virus Immune Evasion. mBio 2017, 8, e00368-17. [Google Scholar] [CrossRef] [Green Version]
- Pepin, G.; Nejad, C.; Ferrand, J.; Thomas, B.J.; Stunden, H.J.; Sanij, E.; Foo, C.H.; Stewart, C.R.; Cain, J.E.; Bardin, P.G.; et al. Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses. mBio 2017, 8, e01611-17. [Google Scholar] [CrossRef] [Green Version]
- Zierhut, C.; Yamaguchi, N.; Paredes, M.; Luo, J.D.; Carroll, T.; Funabiki, H. The Cytoplasmic DNA Sensor cGAS Promotes Mitotic Cell Death. Cell 2019, 178, 302–315 e23. [Google Scholar] [CrossRef]
- Wang, T.; Yu, N.; Qian, M.; Feng, J.; Cao, S.; Yin, J.; Zhang, Q. ERK-mediated autophagy promotes inactivated Sendai virus (HVJ-E)-induced apoptosis in HeLa cells in an Atg3-dependent manner. Cancer Cell Int. 2018, 18, 200. [Google Scholar] [CrossRef]
- Wang, F.; Ma, Y.; Barrett, J.W.; Gao, X.; Loh, J.; Barton, E.; Virgin, H.W.; McFadden, G. Disruption of Erk-dependent type I interferon induction breaks the myxoma virus species barrier. Nat. Immunol. 2004, 5, 1266–1274. [Google Scholar] [CrossRef]
- Kaptein, S.J.; De Burghgraeve, T.; Froeyen, M.; Pastorino, B.; Alen, M.M.; Mondotte, J.A.; Herdewijn, P.; Jacobs, M.; de Lamballerie, X.; Schols, D.; et al. A derivate of the antibiotic doxorubicin is a selective inhibitor of dengue and yellow fever virus replication in vitro. Antimicrob. Agents Chemother. 2010, 54, 5269–5280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ash, R.J.; Diekema, K.A. Inhibition of herpes simplex virus replication by anthracycline compounds. Antivir. Res. 1987, 8, 71–83. [Google Scholar] [CrossRef]
- Shen, L.; Niu, J.; Wang, C.; Huang, B.; Wang, W.; Zhu, N.; Deng, Y.; Wang, H.; Ye, F.; Cen, S.; et al. High-Throughput Screening and Identification of Potent Broad-Spectrum Inhibitors of Coronaviruses. J. Virol. 2019, 93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Glanz, A.; Chawla, K.; Fabry, S.; Subramanian, G.; Garcia, J.; Jay, B.; Ciricillo, J.; Chakravarti, R.; Taylor, R.T.; Chattopadhyay, S. High Throughput Screening of FDA-Approved Drug Library Reveals the Compounds that Promote IRF3-Mediated Pro-Apoptotic Pathway Inhibit Virus Replication. Viruses 2020, 12, 442. https://doi.org/10.3390/v12040442
Glanz A, Chawla K, Fabry S, Subramanian G, Garcia J, Jay B, Ciricillo J, Chakravarti R, Taylor RT, Chattopadhyay S. High Throughput Screening of FDA-Approved Drug Library Reveals the Compounds that Promote IRF3-Mediated Pro-Apoptotic Pathway Inhibit Virus Replication. Viruses. 2020; 12(4):442. https://doi.org/10.3390/v12040442
Chicago/Turabian StyleGlanz, Anna, Karan Chawla, Stephanie Fabry, Gayatri Subramanian, Julie Garcia, Bryanna Jay, Jacob Ciricillo, Ritu Chakravarti, R. Travis Taylor, and Saurabh Chattopadhyay. 2020. "High Throughput Screening of FDA-Approved Drug Library Reveals the Compounds that Promote IRF3-Mediated Pro-Apoptotic Pathway Inhibit Virus Replication" Viruses 12, no. 4: 442. https://doi.org/10.3390/v12040442