Encapsidated Host Factors in Alphavirus Particles Influence Midgut Infection of Aedes aegypti
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. Virus Preparation and Purification
2.3. Virus Particle Quantification
2.4. Analysis of Viral Glycoproteins
2.5. Mosquito Infections
2.6. Quantitative Analysis of Mosquito Transcripts
2.7. Statistical Analysis
3. Results
3.1. Alphaviruses Produce Distinct Infectious Populations
3.2. Per Os Infections with Viral Subpopulations
3.3. Bypassing the Midgut Barriers
3.4. Determining the Midgut Immune Response
4. Discussion
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Enserink, M. Infectious diseases. Chikungunya: No longer a third world disease. Science 2007, 318, 1860–1861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farnon, E.C.; Sejvar, J.J.; Staples, J.E. Severe disease manifestations associated with acute chikungunya virus infection. Crit. Care Med. 2008, 36, 2682–2683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johansson, M.A.; Powers, A.M.; Pesik, N.; Cohen, N.J.; Staples, J.E. Nowcasting the spread of chikungunya virus in the americas. PLoS ONE 2014, 9, e104915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ligon, B.L. Reemergence of an unusual disease: The chikungunya epidemic. Semin. Pediatr. Infect. Dis. 2006, 17, 99–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Staples, J.E.; Breiman, R.F.; Powers, A.M. Chikungunya fever: An epidemiological review of a re-emerging infectious disease. Clin. Infect. Dis. 2009, 49, 942–948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blair, C.D.; Adelman, Z.N.; Olson, K.E. Molecular strategies for interrupting arthropod-borne virus transmission by mosquitoes. Clin. Microbiol. Rev. 2000, 13, 651–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khoo, C.C.; Piper, J.; Sanchez-Vargas, I.; Olson, K.E.; Franz, A.W. The RNA interference pathway affects midgut infection- and escape barriers for Sindbis virus in Aedes aegypti. BMC Microbiol. 2010, 10, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hardy, J.L.; Houk, E.J.; Kramer, L.D.; Reeves, W.C. Intrinsic factors affecting vector competence of mosquitoes for arboviruses. Annu. Rev. Entomol. 1983, 28, 229–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Houk, E.J.; Arcus, Y.M.; Hardy, J.L.; Kramer, L.D. Binding of western equine encephalomyelitis virus to brush border fragments isolated from mesenteronal epithelial cells of mosquitoes. Virus Res. 1990, 17, 105–117. [Google Scholar] [CrossRef] [Scilit]
- Houk, E.J.; Kramer, L.D.; Hardy, J.L.; Presser, S.B. An interspecific mosquito model for the mesenteronal infection barrier to western equine encephalomyelitis virus (Culex tarsalis and Culex pipiens). Am. J. Trop. Med. Hyg. 1986, 35, 632–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, D.R.; Arrigo, N.C.; Leal, G.; Muehlberger, L.E.; Weaver, S.C. Infection and dissemination of venezuelan equine encephalitis virus in the epidemic mosquito vector, Aedes taeniorhynchus. Am. J. Trop. Med. Hyg. 2007, 77, 176–187. [Google Scholar] [PubMed]
- Myles, K.M.; Pierro, D.J.; Olson, K.E. Comparison of the transmission potential of two genetically distinct sindbis viruses after oral infection of Aedes aegypti (diptera: Culicidae). J. Med. Entomol. 2004, 41, 95–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woodring, J.; Higgs, S.; Beaty, B. Natural cycles of vector-borne pathogens. In The Biology of Disease Vectors; Marquardt, W.C., Beaty, B.J., Eds.; University Press of Colorado: Boulder, CO, USA, 1996; pp. 51–72. [Google Scholar]
- Pierro, D.J.; Powers, E.L.; Olson, K.E. Genetic determinants of sindbis virus strain TR339 affecting midgut infection in the mosquito Aedes aegypti. J. Gen. Virol. 2007, 88, 1545–1554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsetsarkin, K.A.; Vanlandingham, D.L.; McGee, C.E.; Higgs, S. A single mutation in chikungunya virus affects vector specificity and epidemic potential. PLoS Pathog. 2007, 3, e201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saxton-Shaw, K.D.; Ledermann, J.P.; Borland, E.M.; Stovall, J.L.; Mossel, E.C.; Singh, A.J.; Wilusz, J.; Powers, A.M. O’nyong nyong virus molecular determinants of unique vector specificity reside in non-structural protein 3. PLoS Negl. Trop. Dis. 2013, 7, e1931. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xi, Z.; Ramirez, J.L.; Dimopoulos, G. The Aedes aegypti toll pathway controls dengue virus infection. PLoS Pathog. 2008, 4, e1000098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moreira, L.A.; Iturbe-Ormaetxe, I.; Jeffery, J.A.; Lu, G.; Pyke, A.T.; Hedges, L.M.; Rocha, B.C.; Hall-Mendelin, S.; Day, A.; Riegler, M.; et al. A wolbachia symbiont in Aedes aegypti limits infection with dengue, chikungunya, and plasmodium. Cell 2009, 139, 1268–1278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van den Hurk, A.F.; Hall-Mendelin, S.; Pyke, A.T.; Frentiu, F.D.; McElroy, K.; Day, A.; Higgs, S.; O’Neill, S.L. Impact of wolbachia on infection with chikungunya and yellow fever viruses in the mosquito vector Aedes aegypti. PLoS Negl. Trop. Dis. 2012, 6, e1892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perrone, J.B.; Spielman, A. Time and site of assembly of the peritrophic membrane of the mosquito Aedes aegypti. Cell Tissue Res. 1988, 252, 473–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grimstad, P.R.; Walker, E.D. Aedes triseriatus (diptera: Culicidae) and la crosse virus. IV. Nutritional deprivation of larvae affects the adult barriers to infection and transmission. J. Med. Entomol. 1991, 28, 378–386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, R.E.; Wu, W.K.; Verleye, D.; Rai, K.S. Midgut basal lamina thickness and dengue-1 virus dissemination rates in laboratory strains of Aedes albopictus (diptera: Culicidae). J. Med. Entomol. 1993, 30, 326–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sefton, B.M.; Keegstra, K. Glycoproteins of sindbis virus: Priliminary characterization of the oligosaccharides. J. Virol. 1974, 14, 522–530. [Google Scholar] [PubMed]
- Hsieh, P.; Rosner, M.R.; Robbins, P.W. Host-dependent variation of asparagine-linked oligosaccharides at individual glycosylation sites of sindbis virus glycoproteins. J. Biol. Chem. 1983, 258, 2548–2554. [Google Scholar] [PubMed]
- Hsieh, P.; Robbins, P.W. Regulation of asparagine-linked oligosaccharide processing. Oligosaccharide processing in Aedes albopictus mosquito cells. J. Biol. Chem. 1984, 259, 2375–2382. [Google Scholar] [PubMed]
- Knight, R.L.; Schultz, K.L.; Kent, R.J.; Venkatesan, M.; Griffin, D.E. Role of N-linked glycosylation for sindbis virus infection and replication in vertebrate and invertebrate systems. J. Virol. 2009, 83, 5640–5647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sokoloski, K.J.; Snyder, A.J.; Liu, N.H.; Hayes, C.A.; Mukhopadhyay, S.; Hardy, R.W. Encapsidation of host-derived factors correlates with enhanced infectivity of sindbis virus. J. Virol. 2013, 87, 12216–12226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sokoloski, K.J.; Hayes, C.A.; Dunn, M.P.; Balke, J.L.; Hardy, R.W.; Mukhopadhyay, S. Sindbis virus infectivity improves during the course of infection in both mammalian and mosquito cells. Virus Res. 2012, 167, 26–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levitt, N.H.; Ramsburg, H.H.; Hasty, S.E.; Repik, P.M.; Cole, F.E., Jr.; Lupton, H.W. Development of an attenuated strain of chikungunya virus for use in vaccine production. Vaccine 1986, 4, 157–162. [Google Scholar] [CrossRef] [Scilit]
- Harley, D.; Sleigh, A.; Ritchie, S. Ross river virus transmission, infection, and disease: A cross-disciplinary review. Clin. Microbiol. Rev. 2001, 14, 909–932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Z.; Kingsolver, M.B.; Avadhanula, V.; Hardy, R.W. An antiviral role for antimicrobial peptides during the arthropod response to alphavirus replication. J. Virol. 2013, 87, 4272–4280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pierro, D.J.; Myles, K.M.; Foy, B.D.; Beaty, B.J.; Olson, K.E. Development of an orally infectious sindbis virus transducing system that efficiently disseminates and expresses green fluorescent protein in Aedes aegypti. Insect. Mol. Biol. 2003, 12, 107–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crispin, M.; Harvey, D.J.; Bitto, D.; Bonomelli, C.; Edgeworth, M.; Scrivens, J.H.; Huiskonen, J.T.; Bowden, T.A. Structural plasticity of the Semliki Forest virus glycome upon interspecies transmission. J. Proteome Res. 2014, 13, 1702–1712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mackenzie-Liu, D. (Indiana University, Bloomington, IN, USA). Personal communication, 2017.
- Sanders, H.R.; Foy, B.D.; Evans, A.M.; Ross, L.S.; Beaty, B.J.; Olson, K.E.; Gill, S.S. Sindbis virus induces transport processes and alters expression of innate immunity pathway genes in the midgut of the disease vector, Aedes aegypti. Insect Biochem. Mol. Biol. 2005, 35, 1293–1307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luplertlop, N.; Surasombatpattana, P.; Patramool, S.; Dumas, E.; Wasinpiyamongkol, L.; Saune, L.; Hamel, R.; Bernard, E.; Sereno, D.; Thomas, F.; et al. Induction of a peptide with activity against a broad spectrum of pathogens in the Aedes aegypti salivary gland, following infection with dengue virus. PLoS Pathog. 2011, 7, e1001252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souza-Neto, J.A.; Sim, S.; Dimopoulos, G. An evolutionary conserved function of the jak-stat pathway in anti-dengue defense. Proc. Natl. Acad. Sci. USA 2009, 106, 17841–17846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campbell, C.L.; Keene, K.M.; Brackney, D.E.; Olson, K.E.; Blair, C.D.; Wilusz, J.; Foy, B.D. Aedes aegypti uses RNA interference in defense against Sindbis virus infection. BMC Microbiol. 2008, 8, 47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ocampo, C.B.; Caicedo, P.A.; Jaramillo, G.; Ursic Bedoya, R.; Baron, O.; Serrato, I.M.; Cooper, D.M.; Lowenberger, C. Differential expression of apoptosis related genes in selected strains of Aedes aegypti with different susceptibilities to dengue virus. PLoS ONE 2013, 8, e61187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Gort, T.; Boyle, D.L.; Clem, R.J. Effects of manipulating apoptosis on sindbis virus infection of Aedes aegypti mosquitoes. J. Virol. 2012, 86, 6546–6554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sokoloski, K.J.; Haist, K.C.; Morrison, T.E.; Mukhopadhyay, S.; Hardy, R.W. Noncapped alphavirus genomic RNAs and their role during infection. J. Virol. 2015, 89, 6080–6092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Myong, S.; Cui, S.; Cornish, P.V.; Kirchhofer, A.; Gack, M.U.; Jung, J.U.; Hopfner, K.-P.; Ha, T. Cytosolic viral sensor RIG-I is a 5′-triphosphate–dependent translocase on double-stranded RNA. Science (New York) 2009, 323, 1070–1074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pichlmair, A.; Schulz, O.; Tan, C.P.; Näslund, T.I.; Liljeström, P.; Weber, F.; e Sousa, C.R. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science (New York) 2006, 314, 997–1001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hornung, V.; Ellegast, J.; Kim, S.; Brzózka, K.; Jung, A.; Kato, H.; Poeck, H.; Akira, S.; Conzelmann, K.-K.; Schlee, M. 5′-triphosphate rna is the ligand for RIG-I. Science (New York) 2006, 314, 994–997. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Primer | Sequence |
|---|---|
| 18s F | CGAAAGTTAGAGGTTCGAAGGCGA |
| 18s R | CCGTGTTGAGTCAAATTAAGCCGC |
| nsP1 F | AAGGATCTCCGGACCGTA |
| nsP1 R | AACATGAACTGGGTGTCGAAG |
| AeDif F | ACAAACGTCTCCCTACAATG |
| AeDif R | ACTGATTCTGGAACTGTTGG |
| Rel2 F | CAAGAACAGGAAGAGAAC |
| Rel2 R | CCTCCACTCTATTACAGC |
| AeDronc F | AAAGAACTGAAGCAGTCCAG |
| AeDronc R | CGTATAGGACGGAATTATCG |
| Ago2 F | ACCGAATATCACCTTCATTG |
| Ago2 R | TAACGGTCAACGATAGTTCC |
| AeSTAT F | GTTTCGATCATTTCAGAAGC |
| AeSTAT R | CTTCGTGGTTTCGTTGTACT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mackenzie-Liu, D.; Sokoloski, K.J.; Purdy, S.; Hardy, R.W. Encapsidated Host Factors in Alphavirus Particles Influence Midgut Infection of Aedes aegypti. Viruses 2018, 10, 263. https://doi.org/10.3390/v10050263
Mackenzie-Liu D, Sokoloski KJ, Purdy S, Hardy RW. Encapsidated Host Factors in Alphavirus Particles Influence Midgut Infection of Aedes aegypti. Viruses. 2018; 10(5):263. https://doi.org/10.3390/v10050263
Chicago/Turabian StyleMackenzie-Liu, David, Kevin J. Sokoloski, Sarah Purdy, and Richard W. Hardy. 2018. "Encapsidated Host Factors in Alphavirus Particles Influence Midgut Infection of Aedes aegypti" Viruses 10, no. 5: 263. https://doi.org/10.3390/v10050263
APA StyleMackenzie-Liu, D., Sokoloski, K. J., Purdy, S., & Hardy, R. W. (2018). Encapsidated Host Factors in Alphavirus Particles Influence Midgut Infection of Aedes aegypti. Viruses, 10(5), 263. https://doi.org/10.3390/v10050263

