Regulation of CD4 Receptor and HIV-1 Entry by MicroRNAs-221 and -222 during Differentiation of THP-1 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmid Constructs, MicroRNA Mimics and Antagomirs
2.2. Antibodies and Chemicals
2.3. Virus Production
2.4. Establishment of a THP-1-CD4R Cell Line Expressing CD4 that Is Resistant to MiR-221/222 Modulation
2.5. Monocytes, CD4+ T Cells and MDMs Isolation; MDM and THP-1 Transfection and HIV-1 Infection
2.6. RNA Extraction, Reverse-Transcription and qRT-PCR Analyses
2.7. Flow Cytometry
2.8. SDS-PAGE and Western Immuno-Blotting Analyses
2.9. Virus Encoding Luciferase Infection Assay
2.10. Analysis of HIV-1 Replication Kinetics
2.11. RNAseq of Primary Monocyte versus MDM MicroRNAs
2.12. Statistics
3. Results
3.1. MiR-221 and -222 Are Up-Regulated in Monocyte-To-Macrophage Differentiation
3.2. Establishment of a THP-1 Cell Line Expressing CD4 that Is Not Regulated by MiR-221 or MiR-222
3.3. Differentiated THP-1-CD4R Cells Are Efficiently Infected by HIV-1
4. Discussion
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Honeycutt, J.B.; Wahl, A.; Baker, C.; Spagnuolo, R.A.; Foster, J.; Zakharova, O.; Wietgrefe, S.; Caro-Vegas, C.; Madden, V.; Sharpe, G.; et al. Macrophages sustain HIV replication in vivo independently of T cells. J. Clin. Investig. 2016, 126, 1353–1366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevenson, M. HIV-1 pathogenesis. Nat. Med. 2003, 9, 8538–8560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sattentau, Q.J.; Stevenson, M. Macrophages and HIV-1: An unhealthy constellation. Cell Host Microbe 2016, 19, 304–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Josefsson, L.; King, M.S.; Makitalo, B.; Brannstrom, J.; Shao, W.; Maldarelli, F.; Kearney, M.F.; Hu, W.S.; Chen, J.; Gaines, H.; et al. Majority of CD4+ T cells from peripheral blood of HIV-1-infected individuals contain only one HIV DNA molecule. Proc. Nat. Acad. Sci. USA 2011, 108, 11199–11204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DiNapoli, S.R.; Hirsch, V.M.; Brenchley, J.M. Macrophages in progressive HIV/SIV infections. J. Virol. 2016, 90, 7596–7606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sonza, S.; Maerz, A.; Deacon, N.; Meanger, J.; Mills, J.; Crowe, S. Human immunodeficiency virus type 1 replication is blocked prior to reverse transcription and integration in freshly isolated peripheral blood monocytes. J. Virol. 1996, 70, 3863–3869. [Google Scholar] [PubMed]
- Di Marzio, P.; Tse, J.; Landau, N.R. Chemokine receptor regulation and HIV type 1 tropism in monocyte-macrophages. AIDS Res. Hum. Retrovir. 1998, 14, 129–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, B.; Sharron, M.; Montaner, L.J.; Weissman, D.; Doms, R.W. Quantification of CD4, CCR5 and CXCR4 levels on lymphocyte subsets, dendritic cells and differentially conditioned monocyte-derived macrophages. Proc. Nat. Acad. Sci. USA 1999, 96, 5215–5220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tuttle, D.L.; Harrison, J.K.; Anders, C.; Sleasman, J.W.; Goodenow, M.M. Expression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1. J. Virol. 1998, 72, 4962–4969. [Google Scholar] [PubMed]
- Cheng-Mayer, C.; Liu, R.; Landau, N.R.; Stamatatos, L. Macrophage tropism of human immunodeficiency virus type 1 and utilization of the CC-CKR5 coreceptor. J. Virol. 1997, 71, 1657–1661. [Google Scholar] [PubMed]
- Gorry, P.R.; Bristol, G.; Zack, J.A.; Ritola, K.; Swanstrom, R.; Birch, C.J.; Bell, J.E.; Bannert, N.; Crawford, K.; Wang, H.; et al. Macrophage tropism of human immunodeficiency virus type 1 isolates from brain and lymphoid tissues predicts neurotropism independent of coreceptor specificity. J. Virol. 2001, 75, 10073–10089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arrildt, K.T.; LaBranche, C.C.; Joseph, S.B.; Dukhovlinova, E.N.; Graham, W.D.; Ping, L.H.; Schnell, G.; Sturdevant, C.B.; Kincer, L.P.; Mallewa, M.; et al. Phenotypic correlates of HIV-1 macrophage tropism. J. Virol. 2015, 89, 11294–11311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joseph, S.B.; Arrildt, K.T.; Swanstrom, A.E.; Schnell, G.; Lee, B.; Hoxie, J.A.; Swanstrom, R. Quantification of entry phenotypes of macrophage-tropic HIV-1 across a wide range of CD4 densities. J. Virol. 2014, 88, 1858–1869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mefford, M.E.; Kunstman, K.; Wolinsky, S.M.; Gabuzda, D. Bioinformatic analysis of neurotropic HIV envelope sequences identifies polymorphisms in the gp120 bridging sheet that increase macrophage-tropism through enhanced interactions with CCR5. Virology 2015, 481, 2102–2122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sonza, S.; Maerz, A.; Uren, S.; Violo, A.; Hunter, S.; Boyle, W.; Crowe, S. Susceptibility of human monocytes to HIV type 1 infection in vitro is not dependent on their level of CD4 expression. AIDS Res. Hum. Retrovir. 1995, 11, 769–776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graziani-Bowering, G.M.; Filion, L.G. Down regulation of CD4 expression following isolation and culture of human monocytes. Clin. Diagn. Lab. Immunol. 2000, 7, 1821–1891. [Google Scholar] [CrossRef] [Scilit]
- Ellery, P.J.; Tippett, E.; Chiu, Y.L.; Paukovics, G.; Cameron, P.U.; Solomon, A.; Lewin, S.R.; Gorry, P.R.; Jaworowski, A.; Greene, W.C.; et al. The CD16+ monocyte subset is more permissive to infection and preferentially harbors HIV-1 in vivo. J. Immunol. 2007, 178, 6581–6589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, G.; Greenwell-Wild, T.; Nares, S.; Jin, W.; Lei, K.J.; Rangel, Z.G.; Munson, P.J.; Wahl, S.M. Myeloid differentiation and susceptibility to HIV-1 are linked to APOBEC3 expression. Blood 2007, 110, 393–400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hrecka, K.; Hao, C.; Gierszewska, M.; Swanson, S.K.; Kesik-Brodacka, M.; Srivastava, S.; Florens, L.; Washburn, M.P.; Skowronski, J. Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein. Nature 2011, 474, 658–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laguette, N.; Sobhian, B.; Casartelli, N.; Ringeard, M.; Chable-Bessia, C.; Segeral, E.; Yatim, A.; Emiliani, S.; Schwartz, O.; Benkirane, M. SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by vpx. Nature 2011, 474, 654–657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Ye, L.; Hou, W.; Zhou, Y.; Wang, Y.J.; Metzger, D.S.; Ho, W.Z. Cellular microRNA expression correlates with susceptibility of monocytes/macrophages to HIV-1 infection. Blood 2009, 113, 671–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swaminathan, G.; Navas-Martin, S.; Martin-Garcia, J. MicroRNAs and HIV-1 infection: Antiviral activities and beyond. J. Mol. Biol. 2014, 426, 1178–1197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sung, T.L.; Rice, A.P. MiR-198 inhibits HIV-1 gene expression and replication in monocytes and its mechanism of action appears to involve repression of cyclin T1. PLoS Pathog. 2009, 5, e1000263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, C.J.; Jia, Y.H.; Tian, R.R.; Ding, M.; Zhang, C.; Wang, J.H. Translation of Pur-α is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection. FASEB J. 2012, 26, 4755–4764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orecchini, E.; Doria, M.; Michienzi, A.; Giuliani, E.; Vassena, L.; Ciafre, S.A.; Farace, M.G.; Galardi, S. The HIV-1 tat protein modulates CD4 expression in human T cells through the induction of miR-222. RNA Biol. 2014, 11, 334–338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lodge, R.; Ferreira Barbosa, J.A.; Lombard-Vadnais, F.; Gilmore, J.C.; Deshiere, A.; Gosselin, A.; Wiche Salinas, T.R.; Bego, M.G.; Power, C.; Routy, J.P.; et al. Host microRNAs-221 and -222 inhibit HIV-1 entry in macrophages by targeting the CD4 viral receptor. Cell Rep. 2017, 21, 141–153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galardi, S.; Mercatelli, N.; Farace, M.G.; Ciafre, S.A. NF-κB and c-jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells. Nucleic Acids Res. 2011, 39, 3892–3902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lambeth, L.S.; Yao, Y.; Smith, L.P.; Zhao, Y.; Nair, V. MicroRNAs 221 and 222 target p27kip1 in Marek’s disease virus-transformed tumour cell line msb-1. J. Gen. Virol. 2009, 90, 1164–1171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eigsti, R.L.; Sudan, B.; Wilson, M.E.; Graff, J.W. Regulation of activation-associated microRNA accumulation rates during monocyte-to-macrophage differentiation. J. Biol. Chem. 2014, 289, 28433–28447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Sun, X.; Wang, M.; Hou, Y.; Zhan, Y.; Jiang, Y.; Liu, Z.; Cao, X.; Chen, P.; Liu, Z.; et al. A microRNA 221- and 222-mediated feedback loop maintains constitutive activation of NF-κB and stat3 in colorectal cancer cells. Gastroenterology 2014, 147, 847.e11–859.e11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adachi, A.; Gendelman, H.E.; Koenig, S.; Folks, T.; Willey, R.; Rabson, A.; Martin, M.A. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 1986, 59, 284–291. [Google Scholar] [PubMed]
- Connor, R.I.; Chen, B.K.; Choe, S.; Landau, N.R. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 1995, 206, 935–944. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lodge, R.; Lalonde, J.P.; Lemay, G.; Cohen, E.A. The membrane-proximal intracytoplasmic tyrosine residue of HIV-1 envelope glycoprotein is critical for basolateral targeting of viral budding in MDCK cells. EMBO J. 1997, 16, 695–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sullivan, N.; Sun, Y.; Li, J.; Hofmann, W.; Sodroski, J. Replicative function and neutralization sensitivity of envelope glycoproteins from primary and T-cell line-passaged human immunodeficiency virus type 1 isolates. J. Virol. 1995, 69, 4413–4422. [Google Scholar] [PubMed]
- Dave, V.P.; Hajjar, F.; Dieng, M.M.; Haddad, E.; Cohen, E.A. Efficient BST-2 antagonism by vpu is critical for early HIV-1 dissemination in humanized mice. Retrovirology 2013, 10, 128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, G.B.; Gandhi, R.T.; Davis, D.M.; Mandelboim, O.; Chen, B.K.; Strominger, J.L.; Baltimore, D. The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. Immunity 1999, 10, 661–671. [Google Scholar] [CrossRef] [Scilit]
- Richard, J.; Sindhu, S.; Pham, T.N.; Belzile, J.P.; Cohen, E.A. HIV-1 vpr up-regulates expression of ligands for the activating NKG2d receptor and promotes NK cell-mediated killing. Blood 2010, 115, 1354–1363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Platt, E.J.; Wehrly, K.; Kuhmann, S.E.; Chesebro, B.; Kabat, D. Effects of CCR5 and CD4 cell surface concentrations on infections by macrophage-tropic isolates of human immunodeficiency virus type 1. J. Virol. 1998, 72, 2855–2864. [Google Scholar] [PubMed]
- Sugden, S.M.; Pham, T.N.; Cohen, E.A. HIV-1 vpu downmodulates ICAM-1 expression, resulting in decreased killing of infected CD4+ T cells by NK cells. J. Virol. 2017, 91, e02442-16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balcells, I.; Cirera, S.; Busk, P.K. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers. BMC Biotechnol. 2011, 11, 70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Konopka, K.; Duzgunes, N. Expression of CD4 controls the susceptibility of THP-1 cells to infection by R5 and X4 HIV type 1 isolates. AIDS Res. Hum. Retrovir. 2002, 18, 123–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hargett, D.; Shenk, T.E. Experimental human cytomegalovirus latency in CD14+ monocytes. Proc. Nat. Acad. Sci. USA 2010, 107, 20039–20044. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subbramanian, R.A.; Kessous-Elbaz, A.; Lodge, R.; Forget, J.; Yao, X.J.; Bergeron, D.; Cohen, E.A. Human immunodeficiency virus type 1 vpr is a positive regulator of viral transcription and infectivity in primary human macrophages. J. Exp. Med. 1998, 187, 1103–1111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mashiba, M.; Collins, D.R.; Terry, V.H.; Collins, K.L. Vpr overcomes macrophage-specific restriction of HIV-1 env expression and virion production. Cell Host Microbe 2014, 16, 722–735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dedera, D.; Hu, W.; Vander Heyden, N.; Ratner, L. Viral protein R of human immunodeficiency virus types 1 and 2 is dispensable for replication and cytopathogenicity in lymphoid cells. J. Virol. 1989, 63, 3205–3208. [Google Scholar] [PubMed]
- Cassol, E.; Alfano, M.; Biswas, P.; Poli, G. Monocyte-derived macrophages and myeloid cell lines as targets of HIV-1 replication and persistence. J. Leukoc. Biol. 2006, 80, 1018–1030. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hrecka, K.; Hao, C.; Shun, M.C.; Kaur, S.; Swanson, S.K.; Florens, L.; Washburn, M.P.; Skowronski, J. HIV-1 and HIV-2 exhibit divergent interactions with HLTF and UNG-2 DNA repair proteins. Proc. Nat. Acad. Sci. USA 2016, 113, E3921–E3930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonifati, S.; Daly, M.B.; St Gelais, C.; Kim, S.H.; Hollenbaugh, J.A.; Shepard, C.; Kennedy, E.M.; Kim, D.H.; Schinazi, R.F.; Kim, B.; et al. SAMHD1 controls cell cycle status, apoptosis and HIV-1 infection in monocytic THP-1 cells. Virology 2016, 495, 92–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goujon, C.; Schaller, T.; Galao, R.P.; Amie, S.M.; Kim, B.; Olivieri, K.; Neil, S.J.; Malim, M.H. Evidence for IFNα-induced, SAMHD1-independent inhibitors of early HIV-1 infection. Retrovirology 2013, 10, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cribier, A.; Descours, B.; Valadao, A.L.; Laguette, N.; Benkirane, M. Phosphorylation of SAMHD1 by cyclin a2/cdk1 regulates its restriction activity toward HIV-1. Cell Rep. 2013, 3, 1036–1043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, M.Y.; Huang, D.Y.; Ho, F.M.; Huang, K.C.; Lin, W.W. PKC-dependent human monocyte adhesion requires ampk and syk activation. PLoS ONE 2012, 7, e40999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goujon, C.; Malim, M.H. Characterization of the alpha interferon-induced postentry block to HIV-1 infection in primary human macrophages and T cells. J. Virol. 2010, 84, 9254–9266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.; Wang, F.; Argyris, E.; Chen, K.; Liang, Z.; Tian, H.; Huang, W.; Squires, K.; Verlinghieri, G.; Zhang, H. Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat. Med. 2007, 13, 1241–1247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cobos Jimenez, V.; Booiman, T.; de Taeye, S.W.; van Dort, K.A.; Rits, M.A.; Hamann, J.; Kootstra, N.A. Differential expression of HIV-1 interfering factors in monocyte-derived macrophages stimulated with polarizing cytokines or interferons. Sci. Rep. 2012, 2, 763. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swaminathan, G.; Rossi, F.; Sierra, L.J.; Gupta, A.; Navas-Martin, S.; Martin-Garcia, J. A role for microRNA-155 modulation in the anti-HIV-1 effects of toll-like receptor 3 stimulation in macrophages. PLoS Pathog. 2012, 8, e1002937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rom, S.; Rom, I.; Passiatore, G.; Pacifici, M.; Radhakrishnan, S.; del Valle, L.; Pina-Oviedo, S.; Khalili, K.; Eletto, D.; Peruzzi, F. Ccl8/mcp-2 is a target for miR-146a in HIV-1-infected human microglial cells. FASEB J. 2010, 24, 2292–2300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cobos Jimenez, V.; Bradley, E.J.; Willemsen, A.M.; van Kampen, A.H.; Baas, F.; Kootstra, N.A. Next-generation sequencing of microRNAs uncovers expression signatures in polarized macrophages. Physiol. Genom 2014, 46, 91–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forrest, A.R.; Kanamori-Katayama, M.; Tomaru, Y.; Lassmann, T.; Ninomiya, N.; Takahashi, Y.; de Hoon, M.J.; Kubosaki, A.; Kaiho, A.; Suzuki, M.; et al. Induction of microRNAs, miR-155, miR-222, miR-424 and miR-503, promotes monocytic differentiation through combinatorial regulation. Leukemia 2010, 24, 460–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhen, A.; Krutzik, S.R.; Levin, B.R.; Kasparian, S.; Zack, J.A.; Kitchen, S.G. CD4 ligation on human blood monocytes triggers macrophage differentiation and enhances HIV infection. J. Virol. 2014, 88, 9934–9946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peters, P.J.; Bhattacharya, J.; Hibbitts, S.; Dittmar, M.T.; Simmons, G.; Bell, J.; Simmonds, P.; Clapham, P.R. Biological analysis of human immunodeficiency virus type 1 R5 envelopes amplified from brain and lymph node tissues of AIDS patients with neuropathology reveals two distinct tropism phenotypes and identifies envelopes in the brain that confer an enhanced tropism and fusigenicity for macrophages. J. Virol. 2004, 78, 6915–6926. [Google Scholar] [PubMed]
- Chauveau, L.; Donahue, D.A.; Monel, B.; Porrot, F.; Bruel, T.; Richard, L.; Casartelli, N.; Schwartz, O. HIV fusion in dendritic cells occurs mainly at the surface and is limited by low CD4 levels. J. Virol. 2017, 91, e01248-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neagu, M.R.; Ziegler, P.; Pertel, T.; Strambio-De-Castillia, C.; Grutter, C.; Martinetti, G.; Mazzucchelli, L.; Grutter, M.; Manz, M.G.; Luban, J. Potent inhibition of HIV-1 by TRIM5-cyclophilin fusion proteins engineered from human components. J. Clin. Investig. 2009, 119, 3035–3047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmokel, J.; Li, H.; Bailes, E.; Schindler, M.; Silvestri, G.; Hahn, B.H.; Apetrei, C.; Kirchhoff, F. Conservation of nef function across highly diverse lineages of SIVsmm. Retrovirology 2009, 6, 36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Silva, S.; Planelles, V.; Wu, L. Differential effects of vpr on single-cycle and spreading HIV-1 infections in CD4+ T-cells and dendritic cells. PLoS ONE 2012, 7, e35385. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Primer Name | Sequence | Use |
|---|---|---|
| CD4 F-seq | 5′GCAGAACCAGAAGAAGGTG3′ | CD4 forward sequencing |
| CD4 F | 5′ATGAACCGGGGAGTCC3′ | 1st, 2nd, 3rd CD4 PCRs forward primer |
| CD4 R | 5′AATGGGGCTACATGTCTTC3′ | 1st CD4 PCR reverse primer |
| Linker 6GLY R | 5′TCCTCCTCCACCACCACCAATGGGGCTACATG3′ | 2nd CD4 PCR reverse primer |
| Linker V5 R | 5′CGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTCCTCCTCCACCA3′ | 3rd CD4 PCR reverse primer |
| BamHI F | 5′CATCTGGATCCGCCACCATGAACCGGGGAG3′ | 4th CD4 PCR forward primer |
| EcoRI R | 5′CACATGAATTCTTACGTAGAATCGAGAC3′ | 4th CD4 PCR reverse primer |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lodge, R.; Gilmore, J.C.; Ferreira Barbosa, J.A.; Lombard-Vadnais, F.; Cohen, É.A. Regulation of CD4 Receptor and HIV-1 Entry by MicroRNAs-221 and -222 during Differentiation of THP-1 Cells. Viruses 2018, 10, 13. https://doi.org/10.3390/v10010013
Lodge R, Gilmore JC, Ferreira Barbosa JA, Lombard-Vadnais F, Cohen ÉA. Regulation of CD4 Receptor and HIV-1 Entry by MicroRNAs-221 and -222 during Differentiation of THP-1 Cells. Viruses. 2018; 10(1):13. https://doi.org/10.3390/v10010013
Chicago/Turabian StyleLodge, Robert, Julian C. Gilmore, Jérémy A. Ferreira Barbosa, Félix Lombard-Vadnais, and Éric A. Cohen. 2018. "Regulation of CD4 Receptor and HIV-1 Entry by MicroRNAs-221 and -222 during Differentiation of THP-1 Cells" Viruses 10, no. 1: 13. https://doi.org/10.3390/v10010013
APA StyleLodge, R., Gilmore, J. C., Ferreira Barbosa, J. A., Lombard-Vadnais, F., & Cohen, É. A. (2018). Regulation of CD4 Receptor and HIV-1 Entry by MicroRNAs-221 and -222 during Differentiation of THP-1 Cells. Viruses, 10(1), 13. https://doi.org/10.3390/v10010013

