Identification of miRNAs Associated with Graft Union Development in Pecan [Carya illinoinensis (Wangenh.) K. Koch]
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. RNA Extraction and Deep Sequencing of Small RNA
2.3. Sequence Analysis and Target Prediction of Pecan miRNA
2.4. Analysis of Differentially Expressed miRNAs
2.5. Quantitative Real-Time PCR (qRT-PCR)
3. Results
3.1. Analysis of Small RNA Sequencing
3.2. Identification of Conserved miRNAs in Pecan
3.3. Identification of Novel miRNAs in Pecan
3.4. Prediction and Functional Annotation of Target Genes of miRNAs
3.5. Differential Expressed miRNAs during the Graft Process of Pecan
3.6. Differential Expressed miRNAs during the Graft Process of Pecan
3.7. Expression Patterns of miRNAs and Their Targets in Different Tissues of Pecan
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Mudge, K.; Janick, J.; Scofield, S.; Goldschmidt, E.E. A history of grafting. Hortic. Rev. 2009, 437–493. [Google Scholar]
- Pina, A.; Errea, P. A review of new advances in mechanism of graft compatibility–incompatibility. Sci. Hortic. 2005, 106, 1–11. [Google Scholar] [CrossRef]
- Aloni, B.; Karni, L.; Deventurero, G.; Levin, Z.; Cohen, R.; Katzir, N.; Lotan-Pompan, M.; Edelstein, M.; Aktas, H.; Turhan, E. Physiological and biochemical changes at the rootstock-scion interface in graft combinations between cucurbita rootstocks and a melon scion. J. Hortic. Sci. Biotechnol. 2008, 83, 777–783. [Google Scholar] [CrossRef]
- Fernández-García, N.; Carvajal, M.; Olmos, E. Graft union formation in tomato plants: Peroxidase and catalase involvement. Ann. Bot. 2004, 93, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Asahina, M.; Iwai, H.; Kikuchi, A.; Yamaguchi, S.; Kamiya, Y.; Kamada, H.; Satoh, S. Gibberellin produced in the cotyledon is required for cell division during tissue reunion in the cortex of cut cucumber and tomato hypocotyls. Plant Physiol. 2002, 129, 201–210. [Google Scholar] [CrossRef] [PubMed]
- Melnyk, C.W.; Schuster, C.; Leyser, O.; Meyerowitz, E.M. A developmental framework for graft formation and vascular reconnection in arabidopsis thaliana. Curr. Biol. 2015, 25, 1306–1318. [Google Scholar] [CrossRef] [PubMed]
- Zheng, B.S.; Chu, H.L.; Jin, S.H.; Huang, Y.J.; Wang, Z.J.; Chen, M.; Huang, J.Q. Cdna-aflp analysis of gene expression in hickory (carya cathayensis) during graft process. Tree Physiol. 2009, 30, 297–303. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Yan, B.; Sun, J.; Jia, P.; Zhang, Z.; Yan, X.; Chai, J.; Ren, Z.; Zheng, G.; Liu, H. Graft-union development: A delicate process that involves cell–cell communication between scion and stock for local auxin accumulation. J. Exp. Bot. 2012, 63, 4219–4232. [Google Scholar] [CrossRef] [PubMed]
- Cookson, S.J.; Moreno, M.J.C.; Hevin, C.; Mendome, L.Z.N.; Delrot, S.; Trossatmagnin, C.; Ollat, N. Graft union formation in grapevine induces transcriptional changes related to cell wall modification, wounding, hormone signalling, and secondary metabolism. J. Exp. Bot. 2013, 64, 2997–3008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Z.; Zhao, J.; Hu, F.; Qin, Y.; Wang, X.; Hu, G. Transcriptome changes between compatible and incompatible graft combination of litchi chinensis by digital gene expression profile. Sci. Rep. 2017, 7, 3954. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. Micrornas: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Mallory, A.C.; Vaucheret, H. Erratum: Functions of micrornas and related small rnas in plants. Nat. Genet. 2006, 38, S31. [Google Scholar] [CrossRef]
- Millar, A.A.; Waterhouse, P.M. Plant and animal micrornas: Similarities and differences. Funct. Integr. Genom. 2005, 5, 129–135. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Jiang, Y.; Wang, N.; Xia, B.; Jiang, Y.; Li, X.; Zhang, Z.; Li, Y.; Wang, R. Identification and differential regulation of micrornas in response to methyl jasmonate treatment in lycoris aurea by deep sequencing. BMC Genom. 2016, 17, 789. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Wang, W.; Sun, X.; Liang, Z.; Wang, F. Conserved and novel heat stress-responsive micro rnas were identified by deep sequencing in s accharina japonica (l aminariales, p haeophyta). Plant Cell Environ. 2015, 38, 1357–1367. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, T.H.; Gentile, A.; Vilela, R.D.; Costa, G.G.; Dias, L.I.; Endres, L.; Menossi, M. Micrornas associated with drought response in the bioenergy crop sugarcane (Saccharum spp.). PLoS ONE 2012, 7, e46703. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Hu, T.; Amombo, E.; Fu, J. Genome-wide identification of heat stress-responsive small rnas in tall fescue (Festuca arundinacea) by high-throughput sequencing. J. Plant Physiol. 2017, 213, 157–165. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Jiang, D.; Zhang, C.; Tan, H.; Li, Y.; Lv, S.; Hou, X.; Cui, X. Genome-wide identification of turnip mosaic virus -responsive micrornas in non-heading chinese cabbage by high-throughput sequencing. Gene 2015, 571, 178–187. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Ma, L.; Geng, Y.; Hao, C.; Chen, X.; Zhang, X. Small rna and degradome sequencing reveal complex roles of mirnas and their targets in developing wheat grains. PLoS ONE 2015, 10, e0139658. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Qiu, Y.; Zhang, X.; Chen, X.; Shen, D.; Wang, H.; Li, X. Genome-wide identification of micrornas associated with taproot development in radish (Raphanus sativus L.). Gene 2015, 569, 118–126. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Han, S.; Li, W.; Zhou, J.; Li, X.; Qi, L. Mirna regulation in fast- and slow-growing hybrid larix trees. Trees 2012, 26, 1597–1604. [Google Scholar] [CrossRef]
- Liu, N.; Yang, J.; Guo, S.; Xu, Y.; Zhang, M. Genome-wide identification and comparative analysis of conserved and novel micrornas in grafted watermelon by high-throughput sequencing. PLoS ONE 2013, 8, e57359. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Li, Y.; Bai, L.; Zhang, T.; He, C.; Yan, Y.; Yu, X. Grafting-responsive mirnas in cucumber and pumpkin seedlings identified by high-throughput sequencing at whole genome level. Physiol. Plant. 2014, 151, 406–422. [Google Scholar] [CrossRef] [PubMed]
- Khaldun, A.; Huang, W.; Lv, H.; Liao, S.; Zeng, S.; Wang, Y. Comparative profiling of mirnas and target gene identification in distant-grafting between tomato and lycium (goji berry). Front. Plant Sci. 2016, 7, 1475. [Google Scholar] [CrossRef] [PubMed]
- Sima, X.; Jiang, B.; Fang, J.; He, Y.; Fang, Z.; Saravana Kumar, K.M.; Ren, W.; Qiu, L.; Chen, X.; Zheng, B. Identification by deep sequencing and profiling of conserved and novel hickory micrornas involved in the graft process. Plant Biotechnol. Rep. 2015, 9, 115–124. [Google Scholar] [CrossRef]
- Nesbitt, M.L. Effect of scionwood packing moisture and cut-end scaling on pecan graft success. Horttechnology 2002, 12, 257–260. [Google Scholar]
- Mo, Z.; Feng, G.; Su, W.; Liu, Z.; Peng, F. Transcriptomic analysis provides insights into grafting union development in pecan (Carya illinoinensis). Genes 2018, 9, 71. [Google Scholar] [CrossRef] [PubMed]
- Mo, Z.; He, H.; Su, W.; Peng, F. Analysis of differentially accumulated proteins associated with graft union formation in pecan (Carya illinoensis). Sci. Hortic. 2017, 224, 126–134. [Google Scholar] [CrossRef]
- Meyers, B.C.; Axtell, M.J.; Bartel, B.; Bartel, D.P.; Baulcombe, D.; Bowman, J.L.; Cao, X.; Carrington, J.C.; Chen, X.; Green, P.J. Criteria for annotation of plant micrornas. Plant Cell 2008, 20, 3186–3190. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Huang, J.; Huang, Y.; Li, Z.; Zheng, B. Discovery and profiling of novel and conserved micrornas during flower development in carya cathayensis via deep sequencing. Planta 2012, 236, 613–621. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Huang, R.; Sun, Z.; Zhang, T.; Huang, J. Identification and profiling of conserved and novel micrornas involved in oil and oleic acid production during embryogenesis in carya cathayensis sarg. Funct. Integr. Genom. 2017, 17, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Zhang, Y.; Ren, Y.; Xu, J.; Zhang, Z.; Wang, Y. Genome-wide identification of cold-responsive and new micrornas in populus tomentosa by high-throughput sequencing. Biochem. Biophys. Res. Commun. 2012, 417, 892–896. [Google Scholar] [CrossRef] [PubMed]
- Jonesrhoades, M.W.; Bartel, D.P.; Bartel, B. Micrornas and their regulatory roles in plants. Annu. Rev. Plant Biol. 2006, 57, 19–53. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Xin, Z.; Wang, Z.; Yang, Q.; Guo, S.; Guo, X.; Cao, L.; Lin, T. Identification and comparative analysis of differentially expressed mirnas in leaves of two wheat (Triticum aestivum L.) genotypes during dehydration stress. BMC Plant Biol. 2015, 15, 21. [Google Scholar] [CrossRef] [PubMed]
- Rajagopalan, R.; Vaucheret, H.; Trejo, J.; Bartel, D. A diverse and evolutionarily fluid set of micrornas in arabidopsis thaliana. Genes Dev. 2006, 20, 3407–3425. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.G.; Zhou, J.; Han, S.Y.; Yang, W.H.; Li, W.F.; Wei, H.L.; Li, X.M.; Qi, L.W. Four abiotic stress-induced mirna families differentially regulated in the embryogenic and non-embryogenic callus tissues of Larix leptolepis. Biochem. Biophys. Res. Commun. 2010, 398, 355–360. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, R.E.; Mecchia, M.A.; Debernardi, J.M.; Schommer, C.; Weigel, D.; Palatnik, J.F. Control of cell proliferation in arabidopsis thaliana by microrna mir396. Development 2010, 137, 103–112. [Google Scholar] [CrossRef] [PubMed]
- Ong, S.S.; Wickneswari, R. Characterization of micrornas expressed during secondary wall biosynthesis in Acacia mangium. PLoS ONE 2012, 7, e49662. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Jung, J.H.; Reyes, J.L.; Kim, Y.S.; Kim, S.Y.; Chung, K.S.; Kim, J.A.; Lee, M.; Lee, Y.; Narry Kim, V. Microrna-directed cleavage of athb15 mrna regulates vascular development in arabidopsis inflorescence stems. Plant J. 2005, 42, 84–94. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.B.; Zhang, Z.L.; Liu, D.M.; Zhang, K.; Li, A.L.; Mao, L. Squamosa promoter-binding protein-like transcription factors: Star players for plant growth and development. J. Integr. Plant Biol. 2010, 52, 946–951. [Google Scholar] [CrossRef] [PubMed]
- Milhinhos, A.; Miguel, C.M. Hormone interactions in xylem development: A matter of signals. Plant Cell Rep. 2013, 32, 867–883. [Google Scholar] [CrossRef] [PubMed]
- Pitaksaringkarn, W.; Ishiguro, S.; Asahina, M.; Satoh, S. Arf6 and arf8 contribute to tissue reunion in incised arabidopsis inflorescence stems. Plant Biotechnol. 2014, 31, 49–53. [Google Scholar] [CrossRef]
- Li, S.; Xie, Z.; Hu, C.; Zhang, J. A review of auxin response factors (arfs) in plants. Front. Plant Sci. 2016, 7, 47. [Google Scholar] [CrossRef] [PubMed]
- Hardtke, C.S.; Berleth, T. The arabidopsis gene monopteros encodes a transcription factor mediating embryo axis formation and vascular development. EMBO J. 1998, 17, 1405–1411. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.S.; Xie, Q.; Fei, J.F.; Chua, N.H. Microrna directs mrna cleavage of the transcription factor nac1 to downregulate auxin signals for arabidopsis lateral root development. Plant Cell 2005, 17, 1376–1386. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.; Chen, L.; Wang, T.; Tian, Q.; Zhang, W. Identification of drought-responsive micrornas in medicago truncatula by genome-wide high-throughput sequencing. BMC Genom. 2011, 12, 367. [Google Scholar]
- Zhong, R.; Lee, C.; Zhou, J.; McCarthy, R.L.; Ye, Z.-H. A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in arabidopsis. Plant Cell 2008, 20, 2763–2782. [Google Scholar] [CrossRef] [PubMed]
- Xie, Q.; Frugis, G.; Colgan, D.; Chua, N. Arabidopsis nac1 transduces auxin signal downstream of tir1 to promote lateral root development. Genes Dev. 2000, 14, 3024–3036. [Google Scholar] [CrossRef] [PubMed]
- Ye, Z.; Zhong, R. Molecular control of wood formation in trees. J. Exp. Bot. 2015, 66, 4119–4131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manavella, P.A.; Dezar, C.A.; Bonaventure, G.; Baldwin, I.T.; Chan, R.L. Hahb4, a sunflower hd-zip protein, integrates signals from the jasmonic acid and ethylene pathways during wounding and biotic stress responses. Plant J. 2008, 56, 376–388. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Ma, Q.; Jin, X.; Peng, X.; Liu, J.; Deng, L.; Yan, H.; Sheng, L.; Jiang, H.; Cheng, B. A novel maize homeodomain–leucine zipper (hd-zip) i gene, zmhdz10, positively regulates drought and salt tolerance in both rice and arabidopsis. Plant Cell Physiol. 2014, 55, 1142–1156. [Google Scholar] [CrossRef] [PubMed]
- Baima, S.; Possenti, M.; Matteucci, A.E.; Altamura, M.M.; Ruberti, I. The arabidopsis athb-8 hd-zip protein acts as a differentiation-promotingtranscription factor of the vascular meristems. Plant Physiol. 2001, 126, 643–655. [Google Scholar] [CrossRef] [PubMed]
- Schrader, J.; Sandberg, G. A high-resolution transcript profile across the wood-forming meristem of poplar identifies potential regulators of cambial stem cell identity. Plant Cell 2004, 16, 2278–2292. [Google Scholar] [CrossRef] [PubMed]
- Ilegems, M.; Douet, V.; Meylanbettex, M.; Uyttewaal, M.; Brand, L.; Bowman, J.L.; Stieger, P.A. Interplay of auxin, kanadi and class iii hd-zip transcription factors in vascular tissue formation. Development 2010, 137, 975–984. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robischon, M.; Du, J.; Miura, E.; Groover, A. The populus class iii hd zip, poprevoluta, influences cambium initiation and patterning of woody stems. Plant Physiol. 2011, 155, 1214–1225. [Google Scholar] [CrossRef] [PubMed]
- Leple, J.; Dauwe, R.; Morreel, K.; Storme, V.; Lapierre, C.; Pollet, B.; Naumann, A.; Kang, K.; Kim, H.; Ruel, K. Downregulation of cinnamoyl-coenzyme a reductase in poplar: Multiple-level phenotyping reveals effects on cell wall polymer metabolism and structure. Plant Cell 2007, 19, 3669–3691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ikeuchi, M.; Sugimoto, K.; Iwase, A. Plant callus: Mechanisms of induction and repression. Plant Cell 2013, 25, 3159–3173. [Google Scholar] [CrossRef] [PubMed]
- Fehér, A.; Magyar, Z. Coordination of cell division and differentiation in plants in comparison to animals. Acta Biol. Szeged. 2015, 59, 275–289. [Google Scholar]
- Kono, A.; Ohno, R.; Umeda-Hara, C.; Uchimiya, H.; Umeda, M. A distinct type of cyclin d, cycd4;2, involved in the activation of cell division in arabidopsis. Plant Cell Rep. 2006, 25, 540–545. [Google Scholar] [CrossRef] [PubMed]
Libraries | Day 0 | Day 8 | Day 15 | Day 30 |
---|---|---|---|---|
Raw reads | 20,691,228 | 21,849,708 | 22,850,876 | 34,439,863 |
Clean reads | 17,060,180 | 19,032,782 | 19,780,849 | 28,632,161 |
Unique reads | 6,579,996 | 6,865,905 | 6,935,788 | 7,815,688 |
rRNA | 7,103,064 | 6,569,083 | 8,616,736 | 12,273,558 |
snRNA | 0 | 1 | 1 | 54 |
snoRNA | 4481 | 32,307 | 6889 | 6924 |
tRNA | 278,816 | 217,321 | 280,911 | 279,464 |
Repbase | 19,799 | 31,233 | 19,735 | 24,141 |
Unannotated reads | 9,654,020 | 12,182,837 | 10,856,577 | 16,048,020 |
Mapped reads | 1,506,852 | 2,537,261 | 1,759,479 | 2,290,283 |
miRNA | Mature_Sequence (5′→3′) | TPM | Log2 Fold Change (Treatment vs. Control) | Putative Target | |||||
---|---|---|---|---|---|---|---|---|---|
Day 0 | Day 8 | Day 15 | Day 30 | Day 8/Day 0 | Day 15/Day 0 | Day 30/Day 0 | |||
cil-miR156 | uugacagaagauagagagcac | 1053.64 | 738.88 | 2066.88 | 496.77 | −0.51 | 0.97 | −1.08 | SPL |
cil-miR160a | ugccuggcucccuguaugcc | 174.90 | 94.66 | 118.25 | 51.99 | −0.89 | −0.56 | −1.75 | ARF |
cil-miR160b | ugccuggcucccugaaugcc | 191.96 | 103.34 | 185.09 | 66.43 | −0.89 | −0.05 | −1.53 | ARF |
cil-miR164a | caugugcucuagcucuccagc | 25.59 | 21.04 | 87.41 | 20.22 | −0.28 | 1.77 | −0.34 | NAC |
cil-miR164b | uggagaagcagggcacgugca | 2337.62 | 1761.75 | 2154.29 | 768.26 | −0.41 | −0.12 | −1.61 | NAC |
cil-miR166b | ucggaccaggcuucauucccc | 79,283.01 | 33,244.46 | 39,632.89 | 105,566.42 | −1.25 | −1.00 | 0.41 | Class III HD-ZIP |
cil-miR171b | agguauugauguggcucaauu | 473.50 | 270.84 | 143.96 | 147.30 | −0.81 | −1.72 | −1.68 | |
cil-miR390 | aagcucaggagggauagcgcc | 1612.45 | 1354.18 | 1933.20 | 704.72 | −0.25 | 0.26 | −1.19 | |
cil-miR394 | uuggcauucuguccaccucc | 695.32 | 320.80 | 719.81 | 207.95 | −1.12 | 0.05 | −1.74 | F-box only protein 6-like |
cil-miR396b | guucaauaaagcugugggaug | 38,707.31 | 95,055.53 | 110,470.14 | 30,583.10 | 1.30 | 1.51 | −0.34 | Serine carboxypeptidase-like |
cil-miR399 | agggcuucucuccuuuggcagg | 76.78 | 18.41 | 66.84 | 25.99 | −2.06 | −0.20 | −1.56 | |
cil-miR482a | ggaaugggcuguuugggauga | 30,943.67 | 36,341.98 | 39,209.03 | 6830.58 | 0.23 | 0.34 | −2.18 | |
cil-miR482b | aaugggaagauaggaaagaac | 4146.30 | 3168.52 | 3578.48 | 1614.50 | −0.39 | −0.21 | −1.36 | |
cil-miR482c | uggacaugggugaauugguaag | 16,060.51 | 11,832.64 | 35,229.52 | 6726.61 | −0.44 | 1.13 | −1.26 | |
cil-miR818 | cacgacgucgguuuauuuaacagg | 25.59 | 12.76 | 41.13 | 92.42 | −1.00 | 0.68 | 1.85 | |
cil-miR860a | cauaucuuugacuauguacugau | 29.86 | 103.34 | 174.81 | 118.42 | 1.79 | 2.55 | 1.99 | |
cil-miRS2 | uuuuguaagaucucuguguag | 452.17 | 707.33 | 1007.73 | 872.23 | 0.65 | 1.16 | 0.95 | Syntaxin-131 |
cil-miRS6 | caaggaaaauaggcuuuugug | 221.82 | 68.37 | 10.28 | 57.76 | −1.70 | −4.43 | −1.94 | ATP synthase gamma chain |
cil-miRS7 | caucaguuugugggauuacuuu | 46.92 | 44.70 | 174.81 | 69.32 | −0.07 | 1.90 | 0.56 | |
cil-miRS8 | aguguggucgggaacccggaacu | 81.05 | 52.59 | 359.90 | 31.77 | −0.62 | 2.15 | −1.35 | |
cil-miRS9a | ugacagaagagagagagcac | 34.13 | 23.67 | 25.71 | 0.00 | −0.53 | −0.41 | −6.64 | SPL |
cil-miRS9b | ugacagaagagagagagcac | 34.13 | 23.67 | 25.71 | 0.00 | −0.53 | −0.41 | −6.64 | SPL |
cil-miRS10 | ugacagaagagagugagcac | 1847.06 | 2987.08 | 3928.10 | 557.42 | 0.69 | 1.09 | −1.73 | Cinnamoyl-CoA reductase 1 |
cil-miRS18 | caaaaugacuagucaaugau | 81.05 | 42.07 | 97.69 | 28.88 | −0.95 | 0.27 | −1.49 | Esterase-like isoform X1 |
cil-miRS23 | uguuacuaguuuggcuuugauacu | 46.92 | 2.63 | 5.14 | 0.00 | −4.16 | −3.19 | −6.64 | |
cil-miRS26 | uuuucguugcuauaaauuggu | 34.13 | 16.38 | 138.82 | 86.65 | −1.06 | 2.02 | 1.34 | cyclin-D1-1 isoform X1 |
cil-miRS29 | gguggcuggauugaaucc | 230.35 | 199.84 | 534.72 | 5.78 | −0.20 | 1.21 | −5.32 | WD-40 repeat family protein |
cil-miRS33 | caaaagugauuguauguaacauu | 3911.68 | 3512.98 | 3583.62 | 10,232.88 | −0.16 | −0.13 | 1.39 | Cell division control protein |
cil-miRS38 | uggcugccaugcaucgucuagc | 4850.14 | 13,539.17 | 7979.60 | 8863.87 | 1.48 | 0.72 | 0.87 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mo, Z.; Feng, G.; Su, W.; Liu, Z.; Peng, F. Identification of miRNAs Associated with Graft Union Development in Pecan [Carya illinoinensis (Wangenh.) K. Koch]. Forests 2018, 9, 472. https://doi.org/10.3390/f9080472
Mo Z, Feng G, Su W, Liu Z, Peng F. Identification of miRNAs Associated with Graft Union Development in Pecan [Carya illinoinensis (Wangenh.) K. Koch]. Forests. 2018; 9(8):472. https://doi.org/10.3390/f9080472
Chicago/Turabian StyleMo, Zhenghai, Gang Feng, Wenchuan Su, Zhuangzhuang Liu, and Fangren Peng. 2018. "Identification of miRNAs Associated with Graft Union Development in Pecan [Carya illinoinensis (Wangenh.) K. Koch]" Forests 9, no. 8: 472. https://doi.org/10.3390/f9080472