Chloroplast Markers for Detecting Chinese Tallow (Triadica sebifera) DNA in Environmental Samples
Abstract
1. Introduction
2. Materials and Methods
2.1. Genetic Markers Design
2.2. Verification Samples
2.3. Preparation and DNA Extraction
2.4. PCR Amplification Using Tallow-Related and Tallow-Specific Primers
2.5. DNA Sequencing
3. Results
3.1. Chloroplast Markers
3.2. Markers Verification
3.3. Phylogenetic Comparison
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moser, W.K.; Barnard, E.L.; Billings, R.F.; Crocker, S.J.; Dix, M.E.; Gray, A.N.; Ice, G.G.; Kim, M.-S.; Reid, R.; Rodman, S.U.; et al. Impacts of nonnative invasive species on US forests and recommendations for policy and management. J. For. 2009, 107, 320–327. [Google Scholar] [CrossRef]
- Folke, C.; Carpenter, S.; Walker, B.; Scheffer, M.; Elmqvist, T.; Gunderson, L.; Holling, C.S. Regime shifts, resilience, and biodiversity in ecosystem management. Annu. Rev. Ecol. Evol. Syst. 2004, 35, 557–581. [Google Scholar] [CrossRef]
- Sladonja, B.; Sušek, M.; Guillermic, J. Review on invasive tree of heaven (Ailanthus altissima (Mill.) Swingle) conflicting values: Assessment of its ecosystem services and potential biological threat. Environ. Manag. 2015, 56, 1009–1034. [Google Scholar] [CrossRef]
- Knapp, P.A. Cheatgrass (Bromus tectorum L.) dominance in the Great Basin Desert: History, persistence, and influences to human activities. Glob. Environ. Change 1996, 6, 37–52. [Google Scholar] [CrossRef]
- MacDonald, G.E. Cogongrass (Imperata cylindrica)—Biology, ecology, and management. Crit. Rev. Plant Sci. 2004, 23, 367–380. [Google Scholar] [CrossRef]
- Saenz, D.; Fucik, E.M.; Kwiatkowski, M.A. Synergistic effects of the invasive Chinese tallow (Triadica sebifera) and climate change on aquatic amphibian survival. Ecol. Evol. 2013, 3, 4828–4840. [Google Scholar] [CrossRef]
- Pile, L.S.; Wang, G.G.; Stovall, J.P.; Siemann, E.; Wheeler, G.S.; Gabler, C.A. Mechanisms of Chinese tallow (Triadica sebifera) invasion and their management implications—A review. For. Ecol. Manag. 2017, 404, 1–13. [Google Scholar] [CrossRef]
- Thomsen, P.F.; Willerslev, E. Environmental DNA—An emerging tool in conservation for monitoring past and present biodiversity. Biol. Conserv. 2015, 183, 4–18. [Google Scholar] [CrossRef]
- Bruce, K.A.; Cameron, G.N.; Harcombe, P.A.; Jubinsky, G. Introduction, Impact on Native Habitats, and Management of a Woody Invader, the Chinese Tallow Tree, Sapium sebiferum (L.) Roxb. Nat. Areas J. 1997, 17, 255–260. [Google Scholar]
- Freeland, J.R. The importance of molecular markers and primer design when characterizing biodiversity from environmental DNA. Genome 2017, 60, 358–374. [Google Scholar] [CrossRef]
- Pawlowski, J.; Apothéloz-Perret-Gentil, L.; Altermatt, F. Environmental DNA: What’s behind the term? Clarifying the terminology and recommendations for its future use in biomonitoring. Mol. Ecol. 2020, 29, 4258–4264. [Google Scholar] [CrossRef] [PubMed]
- Wallinger, C.; Juen, A.; Staudacher, K.; Schallhart, N.; Mitterrutzner, E.; Steiner, E.-M.; Thalinger, B.; Traugott, M. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA. PLoS ONE 2012, 7, e29473. [Google Scholar] [CrossRef] [PubMed]
- Pathiraja, D.; Cho, J.; Kim, J.; Choi, I.-G. Metabarcoding of eDNA for tracking the floral and geographical origins of bee honey. Food Res. Int. 2023, 164, 112413. [Google Scholar] [CrossRef] [PubMed]
- Schnell, I.B.; Fraser, M.; Willerslev, E.; Gilbert, M.T.P. Characterisation of insect and plant origins using DNA extracted from small volumes of bee honey. Arthropod-Plant Interact. 2010, 4, 107–116. [Google Scholar] [CrossRef]
- DeWalt, S.; Siemann, E.; Rogers, W. Microsatellite markers for an invasive tetraploid tree, Chinese tallow (Triadica sebifera). Mol. Ecol. Notes 2006, 6, 505–507. [Google Scholar] [CrossRef]
- Zhuang, Y.; Wang, Z.; Wu, L. New set of microsatellites for Chinese tallow tree, Triadica sebifera. Genet. Mol. Res. 2017, 16, gmr16029624. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Zhou, Q.; Dong, F.; Shen, X.; Li, Y. Study on the genetic variation of Triadica sebifera (Linnaeus) Small populations based on SSR markers. Forests 2022, 13, 1330. [Google Scholar] [CrossRef]
- DeWalt, S.J.; Siemann, E.; Rogers, W.E. Geographic distribution of genetic variation among native and introduced populations of Chinese tallow tree, Triadica sebifera (Euphorbiaceae). Am. J. Bot. 2011, 98, 1128–1138. [Google Scholar] [CrossRef] [PubMed]
- Wagner, D.B. Nuclear, chloroplast, and mitochondrial DNA polymorphisms as biochemical markers in population genetic analyses of forest trees. New For. 1992, 6, 373–390. [Google Scholar] [CrossRef]
- Dong, W.; Liu, J.; Yu, J.; Wang, L.; Zhou, S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS ONE 2012, 7, e35071. [Google Scholar] [CrossRef]
- Jamieson, G.; McKinney, R. Stillingia oil. Oil Soap 1938, 15, 295–296. [Google Scholar] [CrossRef]
- Vogt, J.T.; Olatinwo, R.; Ulyshen, M.D.; Lucardi, R.D.; Saenz, D.; McKenney, J.L. An overview of Triadica sebifera (Chinese tallowtree) in the Southern United States, emphasizing pollinator impacts and classical biological control. Southeast. Nat. 2021, 20, 536–559. [Google Scholar] [CrossRef]
- Pattison, R.R.; Mack, R.N. Potential distribution of the invasive tree Triadica sebifera (Euphorbiaceae) in the United States: Evaluating climex predictions with field trials. Glob. Change Biol. 2008, 14, 813–826. [Google Scholar] [CrossRef]
- Oswalt, S.N. Chinese Tallow (Triadica sebifera (L.) Small) Population Expansion in Louisiana, East Texas, and Mississippi; U.S. Department of Agriculture, Forest Service, Southern Research Station: Asheville, NC, USA, 2010; p. 5.
- Bataineh, M.M.; Fraser, J.S.; Pile Knapp, L.S. Characterization of Chinese tallow invasion in the Southern United States. Forests 2024, 15, 202. [Google Scholar] [CrossRef]
- Parker, A.J.; Tran, J.L.; Ison, J.L.; Bai, J.D.K.; Weis, A.E.; Thomson, J.D. Pollen packing affects the function of pollen on corbiculate bees but not non-corbiculate bees. Arthropod-Plant Interact. 2015, 9, 197–203. [Google Scholar] [CrossRef]
- Topitzhofer, E.; Lucas, H.; Carlson, E.; Chakrabarti, P.; Sagili, R. Collection and identification of pollen from honey bee colonies. J. Vis. Exp. 2021, 167, e62064. [Google Scholar] [CrossRef]
- Lau, P.; Bryant, V.; Rangel, J. Determining the minimum number of pollen grains needed for accurate honey bee (Apis mellifera) colony pollen pellet analysis. Palynology 2018, 42, 36–42. [Google Scholar] [CrossRef]
- Santander, R.D.; Meredith, C.L.; Aćimović, S.G. Development of a viability digital PCR protocol for the selective detection and quantification of live Erwinia amylovora cells in cankers. Sci. Rep. 2019, 9, 11530. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol. Biol. Evol. 1992, 9, 678–687. [Google Scholar] [PubMed]
- Dittfurth, L. Vice President’s report. Tex. Beekeep. Assoc. J. 2018, 18, 4. [Google Scholar]
- Moore, C. Vice President’s report. Tex. Beekeep. Assoc. J. 2018, 18, 3. [Google Scholar]
- Payne, S. Louisiana Beekeepers Oppose Introduction of Beetle to Control Tallow Trees. Louisiana Farm Bureau News. 2018. Available online: https://lafarmbureaunews.com/news/2018/1/15/louisiana-beekeepers-oppose-introduction-of-beetle-to-control-tallow-trees (accessed on 31 January 2025).
- Lieux, M.H. Dominant pollen types recovered from commercial Louisiana honeys. Econ. Bot. 1975, 29, 87–96. [Google Scholar] [CrossRef]
- Renne, I.J.; Barrow, W.C.; Johnson Randall, L.A.; Bridges, W.C. Generalized avian dispersal syndrome contributes to Chinese tallow tree (Sapium sebiferum, Euphorbiaceae) invasiveness. Divers. Distrib. 2002, 8, 285–295. [Google Scholar] [CrossRef]
- Renne, I.J.; Gauthreaux Jr, S.A.; Gresham, C.A. Seed dispersal of the Chinese tallow tree (Sapium sebiferum (L.) Roxb.) by birds in coastal South Carolina. Am. Midl. Nat. 2000, 144, 202–215. [Google Scholar] [CrossRef]
- Pile, L.S.; Vickers, L.; Stambaugh, M.; Norman, C.; Wang, G.G. The tortoise and the hare: A race between native tree species and the invasive Chinese tallow. For. Ecol. Manag. 2019, 445, 110–121. [Google Scholar] [CrossRef]
- Clark, J.W.; Howard, J.J. Pollination mechanisms in Triadica sebifera (Euphorbiaceae) in the southeastern United States. J. Torrey Bot. Soc. 2019, 146, 18–26. [Google Scholar] [CrossRef]
- Guo, L.-Y.; Zhang, X.-F.; Zhu, Z.-X.; Wang, H.-F. Complete plastome sequence of Balakata baccata (Roxb.) Esser (Euphorbiaceae). Mitochondrial DNA Part B 2021, 6, 1387–1388. [Google Scholar] [CrossRef]






| Number | Name | County/Parish | GenBank Accession | Material Code |
|---|---|---|---|---|
| 1 | Tallow tree seed | Rapides, LA | PQ074089 | LASeed |
| 2 | Honey | Jackson/Harrison, MS | PQ074090 | A |
| 3 | Honey | Jackson/Harrison, MS | PQ074091 | B |
| 4 | Pollen pellet | Houston, AL | PQ074092 | AL1 |
| 5 | Pollen pellet | Houston, AL | PQ074093 | AL2 |
| 6 | Pollen pellet | Houston, AL | PQ074094 | AL3 |
| 7 | Pollen pellet | Houston, AL | PQ074095 | AL4 |
| 8 | Pollen pellet | Baldwin, AL | PQ074096 | AL5 |
| 9 | Pollen pellet | Baldwin, AL | PQ074097 | AL6 |
| 10 | Pollen pellet | Baldwin, AL | PQ074098 | AL7 |
| 11 | Pollen pellet | Houston, AL | PQ074099 | AL8 |
| 12 | Pollen pellet | Houston, AL | PQ074100 | AL9 |
| 13 | Pollen pellet | Houston, AL | PQ074101 | AL10 |
| 14 | Ditrysinia fruticosa | Rapides, LA | PQ664904 | DF |
| 15 | Stillingia sylvatica | Rapides, LA | PQ664905 | SS |
| Reference Seq. Accession # | Name | PCR Primer Sequence, 5′-3′ | SNP Target * | Marker Position |
|---|---|---|---|---|
| NC_060661.1 | Tallow_specific_F | Forward—CCATTCCCATTTTGTTTTGG | (TTTTG)2 | 102223 to 102232 |
| Tallow_specific_R | Reverse—GGCAGGCAGGCCTATATTTC | |||
| NC_060661.1 | Tallow_related_F | Forward—TGCTGATGCTGAAACATGAA | (TGCTGA)2 | 100677 to 100689 |
| Tallow_related_R | Reverse—CCGGTCAACTGGAATGTGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Olatinwo, R.O.; Bataineh, M.; Standley, J.M.; Abbate, A.P.; Williams, G.R.; Lau, P.W. Chloroplast Markers for Detecting Chinese Tallow (Triadica sebifera) DNA in Environmental Samples. Forests 2025, 16, 437. https://doi.org/10.3390/f16030437
Olatinwo RO, Bataineh M, Standley JM, Abbate AP, Williams GR, Lau PW. Chloroplast Markers for Detecting Chinese Tallow (Triadica sebifera) DNA in Environmental Samples. Forests. 2025; 16(3):437. https://doi.org/10.3390/f16030437
Chicago/Turabian StyleOlatinwo, Rabiu O., Mohammad Bataineh, Jennifer M. Standley, Anthony P. Abbate, Geoffrey R. Williams, and Pierre W. Lau. 2025. "Chloroplast Markers for Detecting Chinese Tallow (Triadica sebifera) DNA in Environmental Samples" Forests 16, no. 3: 437. https://doi.org/10.3390/f16030437
APA StyleOlatinwo, R. O., Bataineh, M., Standley, J. M., Abbate, A. P., Williams, G. R., & Lau, P. W. (2025). Chloroplast Markers for Detecting Chinese Tallow (Triadica sebifera) DNA in Environmental Samples. Forests, 16(3), 437. https://doi.org/10.3390/f16030437

