Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. The Source of SSR Polymorphism Primers
2.3. DNA Extraction, PCR Amplification, and Sequencing
2.4. Data Analysis
3. Results
3.1. Genetic Diversity at the Locus Level
3.2. The Genetic Diversity in Different Groups
3.3. Analysis of Molecular Variance (AMOVA)
3.4. Genetic Distance and Genetic Identity Among Groups
3.5. Structure Analysis
3.6. UPGMA Cluster Analysis
3.7. Principal Coordinate Analysis
4. Discussion
4.1. Genetic Diversity and Heterozygote Excess
4.2. The Applicability of SSR Polymorphism Primers for M. glyptostroboide
4.3. Genetic Differentiation and Structure
4.4. Conservation Implications
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Liu, Y.J.; Arens, N.C.; Li, C.S. Range change in Metasequoia: Relationship to paleoclimate. Bot. J. Linn. Soc. 2007, 154, 115–127. [Google Scholar] [CrossRef]
- Zhang, X.; Wei, H.; Zhang, X.; Liu, J.; Zhang, Q.; Gu, W. Non-pessimistic predictions of the distributions and suitability of Metasequoia glyptostroboides under climate change using a random forest model. Forests 2020, 11, 62. [Google Scholar] [CrossRef]
- Wu, M.L.; Yao, L.; Ai, X.R.; Zhu, J.; Zhu, Q.; Wang, J.; Huang, X.; Hong, J.F. The reproductive characteristics of core germplasm in a native Metasequoia glyptostroboides population. Biodivers. Sci. 2020, 28, 303–313. [Google Scholar]
- Chen, J.; Hao, Z.; Xu, H.; Yang, L.; Liu, G.; Sheng, Y.; Zheng, C.; Zheng, W.; Cheng, T.; Shi, J. The complete chloroplast genome sequence of the relict woody plant Metasequoia glyptostroboides Hu et Cheng. Front. Plant Sci. 2015, 6, 447. [Google Scholar] [CrossRef] [PubMed]
- Fu, F.; Song, C.; Wen, C.; Yang, L.; Guo, Y.; Yang, X.; Shu, Z.; Li, X.; Feng, Y.; Liu, B.; et al. The Metasequoia genome and evolutionary relationships among redwoods. Plant Commun. 2023, 4, 100643. [Google Scholar] [CrossRef] [PubMed]
- Li, X.D.; Huang, H.W.; Li, J.Q. Genetic diversity of the relict plant Metasequoia glyptostroboides. Biodivers. Sci. 2003, 11, 100–108. [Google Scholar]
- Li, Y.Y.; Chen, X.Y.; Zhang, X.N.; Wu, T.Y.; Lu, H.P.; Cai, Y.W. Genetic differences between wild and artificial populations of Metasequoia glyptostroboides: Implications for species recovery. Conserv. Biol. 2005, 19, 224–231. [Google Scholar] [CrossRef]
- Kato-Noguchi, H.; Matsumoto, K.; Sakamoto, C.; Tojo, S.; Teruya, T. Allelopathy and allelopathic substances in the leaves of Metasequoia glyptostroboides from pruned branches for weed management. Agronomy 2023, 13, 1017. [Google Scholar] [CrossRef]
- Ma, J. A worldwide survey of cultivated Metasequoia glyptostroboides Hu & Cheng (Taxodiaceae: Cupressaceae) from 1947 to 2007. Bull. Peabody Mus. Nat. His. 2007, 48, 235–253. [Google Scholar]
- Barać, G.; Ognjanov, V.; Vidaković, D.O.; Dorić, D.; Ljubojević, M.; Dulić, J.; Miodragović, M.; Gašić, K. Genetic diversity and population structure of European ground cherry (Prunus fruticosa Pall.) using SSR markers. Sci. Hortic. 2017, 224, 374–383. [Google Scholar] [CrossRef]
- Zhou, Q.; Mu, K.; Ni, Z.; Liu, X.; Li, Y.; Xu, L.A. Analysis of genetic diversity of ancient Ginkgo populations using SSR markers. Ind. Crop. Prod. 2020, 145, 11942. [Google Scholar] [CrossRef]
- Bairu, M.W.; Amelework, A.B.; Coetzer, W.G. Genetic diversity and population structure of six South African Acacia mearnsii breeding populations based on SSR markers. J. Plant. Res. 2021, 134, 1243–1252. [Google Scholar] [CrossRef]
- Zhou, P.; Zhou, Q.; Dong, F.; Shen, X.; Li, Y. Study on the genetic variation of Triadica sebifera (Linnaeus) small populations based on SSR Markers. Forests 2022, 13, 1330. [Google Scholar] [CrossRef]
- Wang, J.W.; Xu, T.L.; Sereke, G.W.; Wang, R.; Li, Y.Y. Novel 28 microsatellite loci using high-throughput sequencing for an endangered species on Metasequoia glyptostroboides (Cupressaceae). Mol. Biol. Rep. 2020, 47, 2991–2996. [Google Scholar] [CrossRef] [PubMed]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
- Rousset, F. GENEPOP′007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef]
- Hammer, Ø.; Harper, D.A. Past: Paleontological statistics software package for educaton and data anlysis. Palaeontol. Electron. 2001, 4, 9. [Google Scholar]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [CrossRef]
- Zhu, H.; Liu, J.; Gao, M.; Yue, C.; Li, H. Population genetic assessment of Viburnum japonicum in China using ddRAD-seq. Front. Genet. 2023, 14, 1150437. [Google Scholar] [CrossRef]
- Balloux, F. Heterozygote excess in small populations and the heterozygote-excess effective population size. Evolution 2004, 58, 1891–1900. [Google Scholar]
- Cui, M.Y.; Yu, S.; Liu, M.; Li, Y.Y. Isolation and characterization of polymorphic microsatellite markers in Metasequoia glyptostroboides (Taxodiaceae). Conserv. Genet. Resour. 2010, 2, 19–21. [Google Scholar] [CrossRef]
- Wu, Q.; Zang, F.; Ma, Y.; Zheng, Y.; Zang, D. Analysis of genetic diversity and population structure in endangered Populus wulianensis based on 18 newly developed EST-SSR markers. Glob. Ecol. Conserv. 2020, 24, e01329. [Google Scholar] [CrossRef]
- Zhang, X.; Yang, L.; Liu, Y.H.; Zhou, X.L.; Zhang, L.Q.; Wang, Y.H.; Shen, S.K. Genetic diversity, genetic structure, and demographic history of Cinnamomum chago, a plant species with extremely small populations in China. Ecol. Conserv. 2021, 31, e01808. [Google Scholar] [CrossRef]




| Group | Sampling Location | Longitude (°E) | Latitude (°N) | Altitude (m) | n |
|---|---|---|---|---|---|
| AM | Ganzhuling forest area | 121.08 | 29.73 | 823 | 21 |
| AS | 18 | ||||
| LXM | Lingxi forest area | 121.12 | 29.76 | 727 | 9 |
| LXS | 8 | ||||
| SLGM | Shangliang forest area | 121.20 | 29.71 | 670 | 9 |
| SLGS | 41 |
| Locus | Primer sequences (5′→3′) | Repeat Motif | Annealing Temperature (°C) | Allele Size Range | Fluorescent Dye |
|---|---|---|---|---|---|
| MG80 | F: TCGAAATATACCTTGGGCGA | (AT)9 | 62 | 272~292 | FAM |
| R: CTTGCAGTGAAAGAAACACACA | |||||
| MG84 | F: AATGCCCCTATGATTCTCCA | (AAG)13 | 59 | 255~309 | HEX |
| R: CCATTCAAGCATCCATAGCC | |||||
| MG95 | F: ATGCATGTCCTTGAAAAGGC | (TTC)10 | 56 | 299~323 | TAMRA |
| R: TGAGGATGGAAGGAGAGCAG | |||||
| MG110 | F: CCTCCGAAAAGAAAAAGAGGA | (AAG)9 | 62 | 235~250 | FAM |
| R: AACTAGATGGGGTGGAAGCA | |||||
| MG111 | F: CCATAAACACAATCGGTACACA | (TA)10 | 63 | 257~301 | HEX |
| R: TGGTGAGGAAGTAGATGGGG | |||||
| MG117 | F: TTGGGAAAGTTTGACACAAGG | (AGA)10 | 61 | 431~461 | TAMRA |
| R: TTCTTCCATTGCCTTCATCC |
| Genetic Parameter | MG80 | MG84 | MG95 | MG110 | MG111 | MG117 |
|---|---|---|---|---|---|---|
| n | 106 | 106 | 106 | 106 | 106 | 106 |
| Na | 7 | 12 | 10 | 8 | 17 | 11 |
| Ne | 3.853 | 6.902 | 2.860 | 4.907 | 7.833 | 3.245 |
| I | 1.525 | 2.120 | 1.437 | 1.725 | 2.271 | 1.653 |
| Ho | 0.311 | 0.670 | 0.642 | 0.660 | 0.981 | 0.434 |
| He | 0.740 | 0.855 | 0.650 | 0.796 | 0.872 | 0.692 |
| uHe | 0.744 | 0.859 | 0.653 | 0.800 | 0.876 | 0.695 |
| F | 0.580 | 0.217 | 0.014 | 0.171 | −0.125 | 0.373 |
| Fis | 0.640 | 0.124 | −0.025 | 0.021 | −0.202 | 0.229 |
| Fit | 0.666 | 0.211 | 0.04 | 0.105 | −0.144 | 0.318 |
| Fst | 0.072 | 0.099 | 0.064 | 0.086 | 0.049 | 0.116 |
| Nm | 3.242 | 2.272 | 3.679 | 2.671 | 4.889 | 1.909 |
| Fna | 0.356 | 0.118 | 0.057 | 0.230 | 0.000 | 0.153 |
| GeneDiversity | 0.740 | 0.855 | 0.650 | 0.796 | 0.872 | 0.692 |
| PIC | 0.701 | 0.839 | 0.619 | 0.766 | 0.860 | 0.672 |
| HWE (p value) | 0.000 * | 0.000 * | 0.131 | 0.000 * | 0.008 * | 0.000 * |
| Genetic Parameter | AM | LXM | SLGM | AS | LXS | SLGS | Mean Value |
|---|---|---|---|---|---|---|---|
| n | 21 | 9 | 9 | 18 | 8 | 41 | 18 |
| Na (±SE) | 6.333 ± 0.558 | 3.667 ± 0.615 | 5.000 ± 0.577 | 4.167 ± 1.222 | 3.167 ± 0.307 | 9.500 ± 1.176 | 5.306 ± 0.474 |
| Ne (±SE) | 3.791 ± 0.534 | 2.621 ± 0.268 | 3.690 ± 0.549 | 2.733 ± 0.797 | 2.375 ± 0.211 | 5.434 ± 0.924 | 3.441 ± 1.731 |
| I (±SE) | 1.475 ± 0.110 | 1.052 ± 0.128 | 1.371 ± 0.152 | 0.951 ± 0.253 | 0.953 ± 0.095 | 1.811 ± 0.163 | 1.269 ± 0.080 |
| Ho (±SE) | 0.683 ± 0.104 | 0.574 ± 0.161 | 0.722 ± 0.151 | 0.417 ± 0.152 | 0.563 ± 0.128 | 0.667 ± 0.079 | 0.604 ± 0.053 |
| He (±SE) | 0.708 ± 0.040 | 0.595 ± 0.047 | 0.688 ± 0.057 | 0.508 ± 0.102 | 0.559 ± 0.046 | 0.782 ± 0.041 | 0.640 ± 0.166 |
| uHe (±SE) | 0.726 ± 0.041 | 0.630 ± 0.050 | 0.729 ± 0.061 | 0.523 ± 0.105 | 0.596 ± 0.049 | 0.792 ± 0.042 | 0.666 ± 0.028 |
| Fis (±SE) | 0.038 ± 0.132 | 0.049 ± 0.228 | −0.022 ± 0.181 | 0.346 ± 0.207 | −0.031 ± 0.211 | 0.151 ± 0.080 | 0.089 ± 0.072 |
| Group (Mean ± SE) | t | p Value | ||
|---|---|---|---|---|
| Mother Trees (n = 39) | Seedlings (n = 67) | |||
| Na | 5.000 ± 0.412 | 5.611 ± 0.864 | −0.639 | 0.529 |
| Ne | 3.367 ± 0.286 | 3.514 ± 0.510 | −0.250 | 0.804 |
| I | 1.299 ± 0.083 | 1.238 ± 0.139 | 0.375 | 0.710 |
| Ho | 0.660 ± 0.078 | 0.549 ± 0.071 | 1.050 | 0.301 |
| He | 0.663 ± 0.029 | 0.616 ± 0.040 | 0.855 | 0.399 |
| uHe | 0.695 ± 0.030 | 0.637 ± 0.040 | 1.030 | 0.310 |
| Fis | 0.022 ± 0.101 | 0.155 ± 0.103 | −0.929 | 0.359 |
| Source of Variation | df | Sum of Square, SS | Mean Square, MS | Variance Component, EST. Var. | Total Variance (%) | p Value |
|---|---|---|---|---|---|---|
| Between Groups | 5 | 55.617 | 11.123 | 0.279 | 12 | 0.001 |
| Within Groups | 206 | 432.647 | 2.100 | 2.100 | 88 | 0.001 |
| Total | 211 | 488.264 | 2.379 | 100 |
| Group | AM | AS | LXM | LXS | SLGM | SLGS |
|---|---|---|---|---|---|---|
| AM | — | 0.670 | 0.735 | 0.707 | 0.720 | 0.721 |
| AS | 0.401 | — | 0.705 | 0.677 | 0.584 | 0.531 |
| LXM | 0.308 | 0.349 | — | 0.944 | 0.676 | 0.713 |
| LXS | 0.346 | 0.390 | 0.058 | — | 0.624 | 0.642 |
| SLGM | 0.328 | 0.538 | 0.392 | 0.472 | — | 0.840 |
| SLGS | 0.327 | 0.633 | 0.338 | 0.444 | 0.174 | — |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, D.; Li, H.; Zhu, H. Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China. Forests 2025, 16, 78. https://doi.org/10.3390/f16010078
Li D, Li H, Zhu H. Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China. Forests. 2025; 16(1):78. https://doi.org/10.3390/f16010078
Chicago/Turabian StyleLi, Dongbin, Hepeng Li, and Hong Zhu. 2025. "Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China" Forests 16, no. 1: 78. https://doi.org/10.3390/f16010078
APA StyleLi, D., Li, H., & Zhu, H. (2025). Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China. Forests, 16(1), 78. https://doi.org/10.3390/f16010078

