Mining and Expression Pattern Analysis of Genes Related to the Regulation of Flowering in Korean Pine (Pinus koraiensis)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Bioinformatics Analysis
2.3. Analysis of Gene Expression Patterns in Different Tissues
3. Results
3.1. Bioinformatics Analysis Results
3.1.1. Physical and Chemical Property Analysis Results
3.1.2. Protein Secondary Structure Prediction
3.1.3. Protein Tertiary Structure Prediction
3.2. Phylogenetic and Conserved Structural Domain Analyses
3.3. Analysis of the Expression Pattern of MADS Gene in Different Tissues and Organs of Korean Pine
3.3.1. Results of the Analysis of PkMADS1 Expression Pattern
3.3.2. Results of the Analysis of PkMADS3 Expression Pattern
3.3.3. Results of the Analysis of PkMADS4 Expression Pattern
3.3.4. Comparison of Gene Expression in Upper Buds and Leaves
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ren, Q.X.; Ren, S.X.; Li, W.Y. Problems and countermeasures in the development of Pinus koraiensis nut grove industry in Xing’an league. North. Fruits 2023, 6, 47–49. [Google Scholar]
- Wu, H.B. Photosynthetic Physiological Characteristics and Distribution of Photosynthate During Cone Growth of Pinus koraiensis. Doctor’s Thesis, Northeast Forestry University, Harbin, China, 2023. [Google Scholar]
- Farjon, A. Handbook of the World’s Conifers; Brill: Leiden, The Netherlands; Boston, MA, USA, 2010; Volume 1 & 2, p. 1112. [Google Scholar]
- Schwarz-Sommer, Z.; Huijser, P.; Nacken, W.; Saedler, H.; Sommer, H. Genetic Control of Flower Development by Homeotic Genes in Antirrhinum majus. Science 1990, 250, 931–936. [Google Scholar] [CrossRef] [PubMed]
- Mou, Y.; Yuan, C.; Sun, Q.; Yan, C.; Zhao, X.; Wang, J.; Wang, Q.; Shan, S.; Li, C. MIKC-type MADS-box transcription factor gene family in peanut: Genome-wide characterization and expression analysis under abiotic stress. Front. Plant Sci. 2022, 13, 980933. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.L.; Viswanath, K.K.; Tong, C.G.; An, H.R.; Jang, S.; Chen, F.C. Floral Induction and Flower Development of Orchids. Front. Plant Sci. 2019, 10, 1258. [Google Scholar] [CrossRef]
- Liu, C.; Teo, Z.W.; Bi, Y.; Song, S.; Xi, W.; Yang, X.; Yin, Z.; Yu, H. A conserved genetic pathway determines inflorescence architecture in Arabidopsis and rice. Dev. Cell 2013, 24, 612–622. [Google Scholar] [CrossRef]
- Yoshida, A.; Sasao, M.; Yasuno, N.; Takagi, K.; Daimon, Y.; Chen, R.; Yamazaki, R.; Tokunaga, H.; Kitaguchi, Y.; Sato, Y.; et al. TAWAWA1, a regulator of rice inflorescence architecture, functions through the suppression of meristem phase transition. Proc. Natl. Acad. Sci. USA 2013, 110, 767–772. [Google Scholar] [CrossRef]
- Zhang, X.H.; Shen, H.Y.; Wen, B.B. Molecular mechanism of PpCMB1 gene in peach MADS-box family regulating flower development. Plant Physiol. J. 2021, 57, 1211–1217. [Google Scholar]
- Liu, X.; Sun, Z.; Dong, W.; Wang, Z.; Zhang, L. Expansion and Functional Divergence of the SHORT VEGETATIVE PHASE (SVP) Genes in Eudicots. Genome Biol. Evol. 2018, 10, 3026–3037. [Google Scholar] [CrossRef]
- Liu, J.; Ren, M.; Chen, H.; Wu, S.; Yan, H.; Jalal, A.; Wang, C. Evolution of SHORT VEGETATIVE PHASE (SVP) genes in Rosaceae: Implications of lineage-specific gene duplication events and function diversifications with respect to their roles in processes other than bud dormancy. Plant Genome 2020, 13, e20053. [Google Scholar] [CrossRef]
- Lee, J.H.; Yoo, S.J.; Park, S.H.; Hwang, I.; Lee, J.S.; Ahn, J.H. Role of SVP in the control of flowering time by ambient temperature in Arabidopsis. Genes Dev. 2007, 21, 397–402. [Google Scholar] [CrossRef]
- Zhou, C.; Liu, H.; Wang, H.; Niu, S.; El-Kassaby, Y.A.; Li, W. Deciphering the Role of SVP-Like Genes and Their Key Regulation Networks During Reproductive Cone Development in Pinus tabuliformis. Plant Cell Environ 2025, 48, 365–386. [Google Scholar] [CrossRef] [PubMed]
- Coudert, E.; Gehant, S.; de Castro, E.; Pozzato, M.; Baratin, D.; Neto, T.; Sigrist, C.J.A.; Redaschi, N.; Bridge, A.; UniProt Consortium. Annotation of biologically relevant ligands in UniProtKB using ChEBI. Bioinformatics 2023, 39, btac793. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v6: Recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024, 52, W78–W82. [Google Scholar] [CrossRef]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A "one for all, all for one" bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
- Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar]
- King, R.D.; Sternberg, M.J. Identification and application of the concepts important for accurate and reliable protein secondary structure prediction. Protein Sci. 1996, 5, 2298–2310. [Google Scholar] [CrossRef]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
- Bannai, H.; Tamada, Y.; Maruyama, O.; Nakai, K.; Miyano, S. Extensive feature detection of N-terminal protein sorting signals. Bioinformatics 2002, 18, 298–305. [Google Scholar] [CrossRef]
- Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [PubMed]
- Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef] [PubMed]
- Juan, W. Primer Design with Primer Premier 5.0. Northwest Med. Educ. 2008, 4, 695–698. [Google Scholar]
- Li, Y.X. Physiological and Molecular Mechanisms of Pinuskoraiensis Seedlings in Response to Different Light Conditions Research. Doctor’s Thesis, Northeast Forestry University, Harbin, China, 2023. [Google Scholar]
- Castañón-Suárez, C.A.; Arrizubieta, M.; Castelán-Muñoz, N.; Sánchez-Rodríguez, D.B.; Caballero-Cordero, C.; Zluhan-Martínez, E.; Patiño-Olvera, S.C.; Arciniega-González, J.A.; García-Ponce, B.; Sánchez, M.P.; et al. The MADS-box genes SOC1 and AGL24 antagonize XAL2 functions in Arabidopsis thaliana root development. Front. Plant Sci. 2024, 15, 1331269. [Google Scholar] [CrossRef]
- Adhikari, P.B.; Kasahara, R.D. An overview on MADS box members in plants: A meta-review. Int. J. Mol. Sci. 2024, 25, 8233. [Google Scholar] [CrossRef]
- Huang, N.C.; Tien, H.C.; Yu, T.S. Arabidopsis leaf-expressed AGAMOUS-LIKE 24 mRNA systemically specifies floral meristem differentiation. New Phytol. 2024, 241, 504–515. [Google Scholar] [CrossRef]
- Zhang, R.; Zhang, J.; Xu, Y.X.; Sun, J.M.; Dai, S.J.; Shen, H.; Yan, Y.H. Dynamic evolution of MADS-box genes in extant ferns via large-scale phylogenomic analysis. Front. Plant Sci. 2024, 15, 1410554. [Google Scholar] [CrossRef]
- Alexandre, C.M.; Hennig, L. FLC or not FLC: The other side of vernalization. J. Exp. Bot. 2008, 59, 1127–1135. [Google Scholar] [CrossRef]
- Nielsen, M.; Menon, G.; Zhao, Y.; Mateo-Bonmati, E.; Wolff, P.; Zhou, S.; Howard, M.; Dean, C. COOLAIR and PRC2 function in parallel to silence FLC during vernalization. Proc. Natl. Acad. Sci. USA 2024, 121, e2311474121. [Google Scholar] [CrossRef]
- Hong, W.; Cao, J. The Function of FLC in Vernalization Process. Chin. Bull. Bot. 2002, 19, 406–411. [Google Scholar]
- Xu, S.; Chong, K. Remembering winter through vernalisation. Nat. Plants 2018, 4, 997–1009. [Google Scholar] [CrossRef] [PubMed]
- Babenko, V.N.; Rogozin, I.B.; Mekhedov, S.L.; Koonin, E.V. Prevalence of intron gain over intron loss in the evolution of paralogous gene families. Nucleic Acids Res. 2004, 32, 3724–3733. [Google Scholar] [CrossRef] [PubMed]
- Mo, X.; Luo, C.; Xia, L.; Mo, W.; Zhu, J.; Zhang, Y.; Hu, W.; Liu, Y.; Xie, F.; He, X. Overexpression of mango MiSVP3 and MiSVP4 delays flowering time in transgenic Arabidopsis. Sci. Hortic. 2023, 317, 112021. [Google Scholar] [CrossRef]
- Xu, D.; Hao, J.; Wang, C.; Zhang, L.; Zhang, H. Analysis of the Expression Patterns of 13 DREB Family GenesRelated to Cone-Setting Genes in Hybrid Larch (Larix kaempferi × Larix olgensis). Forests 2023, 14, 2300. [Google Scholar] [CrossRef]
- Li, D.; Liu, C.; Shen, L.; Wu, Y.; Chen, H.; Robertson, M.; Helliwell, C.A.; Ito, T.; Meyerowitz, E.; Yu, H. A repressor complex governs the integration of flowering signals in Arabidopsis. Dev. Cell 2008, 15, 110–120. [Google Scholar] [CrossRef]
- Ji, F.; Ma, Y.; Qi, S.; Guo, X.; Chen, J. Cloning and functional analysis of peony PlSVP gene in regulating flowering. Acta Hortic. Sin. 2022, 49, 2367–2376. [Google Scholar]
- Wu, R.M.; Walton, E.F.; Richardson, A.C.; Wood, M.; Hellens, R.P.; Varkonyi-Gasic, E. Conservation and divergence of four kiwifruit SVP-like MADS-box genes suggest distinct roles in kiwifruit bud dormancy and flowering. J. Exp. Bot. 2012, 63, 797–807. [Google Scholar] [CrossRef]
- Yang, K.; Gu, H.Y. Dynamic changes of hormone in the plants from teneral stage to blossom phase of Pinus koraiensis Fruit Forests. Sci. Silvae Sin. 2005, 41, 33–37. [Google Scholar]
- Sun, L.; Xu, Z.; Huang, W.; Wu, S.; Lin, X.; Zhu, F.; Liu, N.; Huang, M.; Chen, R.; Zeng, H. Preliminary study of differentiating smears from cancerous and non-cancerous nasopharyngeal tissue using confocal Raman spectroscopy. J. Cancer Res. Clin. Oncol. 2016, 142, 823–831. [Google Scholar] [CrossRef]
- Mo, X.; Luo, C.; Yu, H.; Chen, J.; Liu, Y.; Xie, X.; Fan, Z.; He, X. Isolation and Functional Characterization of Two SHORT VEGETATIVE PHASE Homologous Genes from Mango. Int. J. Mol. Sci. 2021, 22, 9802. [Google Scholar] [CrossRef]
- Chen, J.W.; He, X.H.; Luo, C.; Fan, Y.; Zhang, X.J.; Yu, H.X. Research Progress of Plants Flowering Suppressor Homologous Genes of SVPs. Mol. Plant Breed. 2017, 15, 4888–4898. [Google Scholar]
- Wang, J.; Jiu, S.; Xu, Y.; Sabir, I.A.; Wang, L.; Ma, C.; Xu, W.; Wang, S.; Zhang, C. SVP-like gene PavSVP potentially suppressing flowering with PavSEP, PavAP1, and PavJONITLESS in sweet cherries (Prunus avium L.). Plant Physiol. Biochem. 2021, 159, 277–284. [Google Scholar] [CrossRef]










| Gene Name | Forward and Reverse Primers (5′-3′) |
|---|---|
| PkMADS1-F | ATTGGAAAATCAGGATCCTCAG |
| PkMADS1-R | TGCGAAGATAACCCCAACTG |
| PkMADS2-F | AGAAAATGCAGTGAGCAGGAAC |
| PkMADS2-R | CGCAAAGTATTGACAACTCCTC |
| PkMADS3-F | AAAGCGACTTCGGTTGTGAG |
| PkMADS3-R | TCAAACTGATTCCTTCAAGCTC |
| PkMADS4-F | AAAGCGACTTCGGTTGTGAG |
| PkMADS4-R | CCTTCAAGCTCATCACCTCG |
| 18S-RNA-F | GAGGTAGCTTCGGGCGCAACT |
| 18S-RNA-R | GCAGGTTAGCGAAATGCGATAC |
| Protein | Number of Amino Acid (Da) | Molecular Weight | Theoretical pI | Instability Index | Aliphatic Index | Signal Peptide | Transmembrane | Grand Average of Hydropathicity | Subcellular Localization |
|---|---|---|---|---|---|---|---|---|---|
| PkMADS1 | 238 | 27,312.8 | 5.94 | 75.06 | 86.05 | None | None | −0.757 | Nuclear |
| PkMADS2 | 183 | 21,820.0 | 9.32 | 66.98 | 90.6 | None | None | −0.858 | Cytoplasm |
| PkMADS3 | 163 | 18,981.8 | 9.21 | 51.88 | 80.67 | None | None | −0.677 | Nuclear |
| PkMADS4 | 155 | 18,419.3 | 7.64 | 42.9 | 80.45 | None | None | −0.337 | Chloroplast |
| PkMADS5 | 135 | 15,516.0 | 10.11 | 47.44 | 70.67 | None | None | −0.416 | Nuclear |
| PkMADS6 | 105 | 11,838.1 | 9.72 | 72.38 | 102.19 | None | Two | 0.230 | Nuclear |
| PkMADS7 | 404 | 45,959.9 | 5.29 | 51.29 | 71.71 | None | None | −0.567 | Nuclear |
| PkMADS8 | 390 | 44,419.3 | 5.77 | 57.37 | 78.79 | None | None | −0.647 | Nuclear |
| PkMADS9 | 254 | 29,547.1 | 9.08 | 51.92 | 82.13 | One | None | −0.614 | Nuclear |
| PkMADS10 | 73 | 8432.9 | 9.93 | 37.44 | 72.19 | None | None | −0.230 | Nuclear |
| PkMADS11 | 162 | 18,845.6 | 9.71 | 42.55 | 89.63 | None | None | −0.668 | Nuclear |
| PkMADS12 | 261 | 30,022.7 | 8.91 | 43.78 | 78.39 | None | None | −0.852 | Nuclear |
| Proteins | Alpha Helix | Extended Strand | Random Coil |
|---|---|---|---|
| PkMADS1 | 55.04 | 9.24 | 33.19 |
| PkMADS2 | 66.95 | 9.84 | 18.03 |
| PkMADS3 | 65.64 | 12.27 | 19.02 |
| PkMADS4 | 80.00 | 5.81 | 11.61 |
| PkMADS5 | 54.07 | 14.81 | 31.11 |
| PkMADS6 | 44.76 | 17.14 | 38.10 |
| PkMADS7 | 40.59 | 6.44 | 52.97 |
| PkMADS8 | 41.03 | 6.67 | 52.31 |
| PkMADS9 | 55.91 | 7.87 | 36.22 |
| PkMADS10 | 28.77 | 28.77 | 42.47 |
| PkMADS11 | 59.26 | 12.35 | 28.40 |
| PkMADS12 | 48.28 | 7.66 | 44.06 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Du, J.; Hou, D.; Hao, J.; Du, J.; Zhang, H.; Zhang, L. Mining and Expression Pattern Analysis of Genes Related to the Regulation of Flowering in Korean Pine (Pinus koraiensis). Forests 2025, 16, 168. https://doi.org/10.3390/f16010168
Du J, Hou D, Hao J, Du J, Zhang H, Zhang L. Mining and Expression Pattern Analysis of Genes Related to the Regulation of Flowering in Korean Pine (Pinus koraiensis). Forests. 2025; 16(1):168. https://doi.org/10.3390/f16010168
Chicago/Turabian StyleDu, Junshuai, Dan Hou, Junfei Hao, Junping Du, Hanguo Zhang, and Lei Zhang. 2025. "Mining and Expression Pattern Analysis of Genes Related to the Regulation of Flowering in Korean Pine (Pinus koraiensis)" Forests 16, no. 1: 168. https://doi.org/10.3390/f16010168
APA StyleDu, J., Hou, D., Hao, J., Du, J., Zhang, H., & Zhang, L. (2025). Mining and Expression Pattern Analysis of Genes Related to the Regulation of Flowering in Korean Pine (Pinus koraiensis). Forests, 16(1), 168. https://doi.org/10.3390/f16010168
