Next Article in Journal
Altitudinal Differentiation of Forest Resilience to Drought in a Dryland Mountain
Next Article in Special Issue
Early Diagnosis of Pine Wood Nematode Disease Based on Chlorophyll Fluorescence Parameters and Organic Acids
Previous Article in Journal
Molecular Characterization and Functional Analysis of GPCR Gene Bx-srh-1 in Pinewood Nematode (Bursaphelenchus xylophilus)
Previous Article in Special Issue
Screen of Pinus massoniana for Resistance to Pinewood Nematode: In Vitro Propagation and Evaluation of Regenerated Microshoots
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 14
Issue 7
10.3390/f14071283
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning, Bioinformatics Analysis and Physiological Function of the Pine Wood Nematode Bxadh2 Gene

by
Luyang Shen
,
Jiafeng Hu
,
Yangxue Chen
,
Jiajin Tan
* and
Jianren Ye
Co-Innovation Center for Sustainable Forestry in Southern China, College of Forestry, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
Forests 2023, 14(7), 1283; https://doi.org/10.3390/f14071283
Submission received: 17 April 2023 / Revised: 16 June 2023 / Accepted: 19 June 2023 / Published: 21 June 2023
(This article belongs to the Special Issue Advance in Pine Wilt Disease)
Browse Figures
Review Reports Versions Notes

Abstract

:
In previous research, the pine wood nematode Bxadh2 gene significantly increased its expression in pine seedlings inoculated with endophytic Bacillus cereus GD2 and pine wood nematode. To explore pine wood nematode Bxadh2 gene function, we cloned and analyzed its biological information, and we preliminarily studied its physiological function through RNA interference. We found that the Bxadh2 gene’s full CDS length is 1269 bp, which encodes 422 amino acids, and presents a relatively stable hydrophobic protein. The protein encoded by the Bxadh2 gene has no signal peptide or transmembrane structure, and it is an intracellular protein that does not participate in transmembrane movement. The RNAi interference results showed that when the pine wood nematode’s Bxadh2 gene was suppressed, its survival rate and fecundity significantly decreased, indicating that the expression of the Bxadh2 gene was related to the growth and development of pine wood nematodes.

1. Introduction

Pine Wilt Disease (PWD) in pine trees is a devastating forest disease caused by the pine wood nematode (PWN) Bursaphelenchus xylophilus [1,2,3]. PWD is thought to have spread from North America [4], and Japan was the first country in Asia to report it [5,6]. To date, PWD occurs in at least eight countries around the world, including the United States, Canada, Mexico, Japan, China, Korea, Portugal and Spain [7]. PWD affects a wide range of pine species, including coastal pine (Pinus pinaster) [8], European black pine (P. nigra) [9], horsetail pine (P. massoniana) [10] and red pine (P. resinosa) [11], causing serious damage to forest ecosystems [12]. PWD spreads rapidly, has a high mortality rate, is widespread and is difficult to control; once infected, an entire tree can die within 1–3 months, causing a serious loss of ecological resources [13]. PWD pathogenesis is not yet clear and, therefore, there are no effective control methods [14,15]. There are two different views on PWD pathogenesis and toxin theory. One view is that PWN and its associated bacteria secrete or induce toxic substances that cause the host pine tree to wilt and die [16,17]. Another view is that when a pine tree is infested with PWN, toxic metabolites are produced in the host pine tree to induce nematode death [18]. Mamiya found that parenchyma cells and lipid cells in infected pine trees were affected and even died before the nematodes reached the affected area [19]. These results indicate that the cause of cell necrosis and tracheid hollowing may not be the nematode itself, but some toxic substances [19]. When a pine tree is infested with PWN, it will resist invasion by releasing a large number of secondary metabolites, such as pinene and cyclic aromatic compounds that are strongly toxic to PWN. Detoxification of harmful substances is an important process in PWN’s adaptation to environmental stresses. PWN evades the host’s defense response by migrating rapidly, secreting proteases and other molecules for defenses, and adapting to adversity through detoxification. Although the reactive oxygen species released by affected pines are strongly toxic to PWN, and terpenoids affect the reproductive rate and pathogenicity of PWN, they also disrupt cellular function and cellular integrity in the affected pines, leading to consequences such as enzyme inactivation, protein oxidation, DNA damage, lipid peroxidation and protein denaturation. Host dynamic responses to the invasion of PWN induce defenses that not only fail to protect the host but may also lead to its death. Thus, PWN detoxification is also a key factor in the development of PWD [20].
Cytochrome P450s (P450s, CYP450) are a group of structurally and functionally similar heme-binding proteins encoded by the cytochrome P450 gene superfamily and are important in endogenous chemical metabolism. P450 can catalyze a range of reactions involving endogenous and exogenous substrates; is involved in the biosynthesis and catabolism of steroids, retinoids, prostaglandins and fatty acids; and plays an important role in the detoxification of exogenous harmful substances, such as drugs and insecticides [21]. The P450 metabolic pathway is an important metabolic pathway for the degradation of toxic substances in vivo [22], which is also important for the metabolism of exogenous substances in parasitic nematodes [23]. PWN detoxification genes mainly involve the CYP450 family of enzymes, gene transferases and transporter proteins, and other related genes for detoxification [20]. Studies have shown that the PWN genome contains 76 CYP450 genes, which play an important role in the detoxification of harmful substances in nematode metabolism [4]. In a preliminary experiment on Masson pines, Chen inoculated pines with the Bacillus cereus strain GD2 mixed with AA3 and found that, compared with pines inoculated with AA3 alone, those inoculated with GD2 and AA3 suspensions had more severe disease [24]. Chen studied the effect of the Bacillus cereus strain GD2 on PWN gene expression using transcriptome sequencing [25]. According to transcriptome sequencing analysis, the BXY_1767700 gene was significantly upregulated. The NCBI blast results showed that this gene and the adh-1 gene encoding alcohol dehydrogenase belong to the dehydrogenase/reductase protein superfamily. The gene was named Bxadh2 according to the Uniprot database annotation (entry number O94038). Studies have shown that cytochrome P450 is upregulated during its participation in metabolic processes and resistance mechanisms [26]. Previous transcriptome sequencing showed that Bxadh2 gene expression was significantly upregulated and that the Bxadh2 gene was involved in the CYP450 metabolic pathway in response to exogenous substances, suggesting that Bxadh2 may be involved in PWN’s defense response to metabolize host secondary metabolites, thereby defending against the host’s mechanism.
RNA interference (RNAi) refers to double-stranded RNA (dsRNA) entering cells and being broken down into small double-stranded RNA molecules (siRNA) under endonuclease action. siRNA molecules combine with homologous mRNA, resulting in mRNA breakage. Small mRNA molecules that are broken by nucleases are degraded, resulting in target gene silencing [27]. Since the discovery in 1998 that small double-stranded RNA can effectively interfere with specific gene expressions in vivo, RNA interference technology has been widely applied in the field of gene function and cell research. Fire demonstrated for the first time the existence of the RNAi phenomenon in PWN [28]. Xu used RNAi to inhibit the expression of PWN cytochrome P450 gene and found that P450 gene interference had certain effects on PWN viability and fertility [29]. In subsequent studies, many scholars used RNAi to study the PWN gene to verify its function [30,31,32].
We selected the PWN Bxadh2 gene as our research object. To understand the structural characteristics of the gene and to elucidate the role of the Bxadh2 gene in PWN pathogenesis and ecological adaptation, we predicted its structure and bioinformation via gene cloning and bioinformatics analysis, and we used RNA interference technology to study the effects of Bxadh2 gene silencing on PWN survival and reproductive ability, elucidate the function of the Bxadh2 gene in PWN pathogenesis, and lay a theoretical foundation for further clarifying PWN molecular pathogenesis.

2. Materials and Methods

2.1. PWN Culture

AA3 was a strain isolated from infected pine trees of Pinus hwangshanensis in Anhui province. It was isolated using the Baermann funnel method [33] after inoculation onto grey grapevine spore (Botrytis cinerea) plates and incubation. PWN was placed in 15 mL sterile tubes at 3000 rpm for 3 min, the supernatant was discarded, and the PWN was disinfected with 0.1% streptomycin sulfate for 15 min. The PWN was rinsed with sterile water 3 times. A suspension with about 5000 AA3 was stored at 4 °C for later use.

2.2. Cloning of the PWN Bxadh2 Gene Coding Region

Total RNA was extracted using the Trizol method (Vazyme, Nanjing, China), and the RNA concentration and purity of each group of samples were evaluated using Nanodrop 2000. RNA integrity was checked using agarose gel electrophoresis, and the RIN values were determined using an Agilent 2100. RNA was then reverse transcribed into cDNA, and the reaction system was Anchored Oligo (dT)18 Primer, at 0.5 μg; EasyScript RT/RI Enzyme Mix, at 1 μL; gDNA Remover, at 1 μL; 2 × ES Reaction Mix, at 10 μL; total RNA, at 1 μL; and, finally, Rnase-free water, at 6 μL up to 20 μL. The reaction system was mixed well; incubated 42 °C for 30 min and then at 85 °C for 5 s; and, finally, stored at −20 °C. The primers of the Bxadh2 gene (Table 1) were designed based on the transcriptome data (Number: PRJNA690180). The cDNA of the Bxadh2 gene was amplified using PCR. The reaction system was as follows: ddH20, at 15 μL; 2 × Phanta Max Buffer a, at 25 μL; dNTP Mix, at 1 μL; Primer F, at 2 μL; Primer R, at 2 μL; Phanta Max Super-Fidelity DNA Polymerase, at 1 μL; and cDNA, at 4 μL. The reaction conditions were as follows: 95 °C for 30 s; 95 °C for 15 s; 58 °C for 15 s; 72 °C for 90 s; and 33 cycles at 72 °C for an extension of 5 min.
After the reaction, the PCR products were verified using 1% agar-agar gel electrophoresis, and the Bxadh2 gene target fragment was collected. The vector p ET-32a (+) (provided by the Forest Pathology Laboratory of Nanjing Forestry University) was mono-enzymatically cleaved with EcoR V (NEW ENGLAND Biolabs, Beijing, China) to construct the recombinant vector p ET-32a-Bxadh2. The enzyme digestion system was as follows: vector p ET-32a, at 1 μL; restriction endonuclease Ecor V, at 1 μL; 10 × NEBuffer, at 5 μL; and sterile ddH2O, at 50 μL. After running the PCR (6345CJ204527) at 37 °C for 35 min, the target fragments were recovered using a TaKaRa’s Fragment Purification Kit Ver.4.0, and the recovered products were cloned using a Vazyme’s Cloning Kit and transformed into E. coli (DH5α) receptor cells. Colony PCR was performed using the Green Taq Mix (Vazyme, Nanjing, China) and T7 primers (Forward Primer: 5′-TAATACGACTCACTATAGGG-3′, Reverse Primer: 5′-GCTAGTTATTGCTCAGCGG-3′). The PCR reaction system included Green Taq Mix, at 5 μL; F-way primer, at 1 μL; R-way primer, at 1 μL; and sterile ddH2O, at 3 μL. The PCR reaction conditions were 95 °C for 30 s; 95 °C for 15 s; 58 °C for 15 s; 72 °C for 90 s; and 33 cycles for an extension of 5 min at 72 °C; the products were validated using 1% agarose gel electrophoresis and sent to Nanjing Sijin Biotechnology Co., Ltd. for DNA sequencing.

2.3. PWN Bxadh2 Gene Bioinformatics Analysis

After confirming the PWN Bxadh2 cDNA sequence via sequencing, the gene was bioinformatically analyzed. The calculations of basic physicochemical properties, such as amino acid number, molecular mass, isoelectric point, lipid index, molecular formula, total number of atoms and instability index of the protein encoded by the PWN Bxadh2 gene, were conducted using ExPASy-ProtParam (https://web.expasy.org/protparam/, accessed on 15 January 2023). ExPASy-ProtScale (https://web.expasy.org/protscale/, accessed on 15 January 2023) was used for the predictive analysis of the affinity of the protein encoded by the PWN Bxadh2 gene, and the prediction of the transmembrane structural domain of the protein encoded by the PWN Bxadh2 gene was determined using the TMHMM Server (http://www.cbs.dtu.dk/services/TMHMM/, accessed on 15 January 2023). The signal peptide prediction of PWN Bxadh2 amino acid sequences was determined using the SignalP-5.0 Server (http://www.cbs.dtu.dk/services/SignalP/index.php, accessed on 15 January 2023), and the prediction of phosphorylation sites for the protein encoded by the PWN Bxadh2 gene was performed using the NetPhos 3.1 Server (http://www.cbs.dtu.dk/services/NetPhos/, accessed on 15 January 2023). The prediction of the secondary structure domain of the protein encoded by the PWN Bxadh2 gene was conducted using NPS@-SOPMA (https://npsa-prabi.ibcp.fr/cgibin/npsa_automat.pl?page=npsa_sopma.html, accessed on 15 January 2023), and, finally, the tertiary structure prediction of the PWN Bxadh2 protein was performed using SWISS-MODEL (SWISS-MODEL (expasy.org, accessed on 15 January 2023).

2.4. PWN Bxadh2 Gene siRNA Synthesis

RNAi primers were designed for the PWN Bxadh2 gene using the online design website BLOCK-iT™ RNAi Designer. Four single-strand Oligo DNA with T7 promoter sequences were designed for AA3 (Table 2). The sequence preparation service was provided by Nanjing Jinseri Biological Co., LTD. (Nanjing, China). Single-stranded RNA was synthesized using the In vitro Transcription T7 Kit (Code No. 6140, TaKaRa, Beijing, China) according to the manufacturer’s instructions. After being qualified by agarose gel electrophoresis, the RNA was stored at −80 °C for reserve.

2.5. Functional Verification of the Bxadh2 Gene after PWN RNAi

2.5.1. Detection of Interference Efficiency

Approximately 3000 PWNs were immersed in Bxadh2 siRNA and negative control (NC) siRNA at a concentration of 1000 ng/µL for 48 h at 20 °C and 180 rpm. The interfered PWNs were rinsed three times with sterilized deionized water, and then RNA was extracted for reverse transcription to obtain cDNA. The interference efficiency was tested using RT-q PCR, and three replicates were performed.

2.5.2. Determination of PWN Viability after RNA Interference

The PWNs immersed in the Bxadh2 siRNA and negative control (NC) siRNA solutions were adjusted to a concentration of approximately 2000 nematodes/mL and incubated at 25 °C. A total of 10 μL of the suspension was aspirated every 3 days to determine PWN survival rate, which was calculated as (number of live worms/total number of nematodes) × 100% for 3 replicates.

2.5.3. Determination of PWN Fecundity after RNA Interference

Approximately 150 nematodes of mixed-stage culture soaked in Bxadh2 siRNA and negative control (NC) siRNA were aspirated separately, inoculated onto PDA plates full of fresh grey grape spores, incubated in a constant-temperature incubator at 25 °C for 5 d, and then isolated and counted. Three replicates were performed.

2.6. Data Statistics and Analysis

IBM SPSS Statistics 24 was used for statistical analysis of the experimental data based on Student’s t-test.

3. Results and Analysis

3.1. Cloning of the PWN Bxadh2 Gene

The validation results of the PWN Bxadh2 gene clone are shown in Figure 1. The results of the gel electrophoresis of the PCR amplification products showed that the amplified fragment size was slightly above 1000 bp, which was consistent with the predicted result (1269 bp) (Figure 1A); the p ET-32a vector was successfully constructed as the recombinant vector p ET-32a-Bxadh2 (Figure 1B); and the gel electrophoresis of the colony PCR products showed bands around 2000 bp (Figure 1C). The sequencing results showed that the recombinant vector contained the Bxadh2 gene and the gene sequence was consistent with the reference sequence.

3.2. PWN Bxadh2 Gene Bioinformatics Analysis

3.2.1. Bxadh2 Physicochemical Properties

The full CDS length of the PWN Bxadh2 gene was 1269 bp, the NCBI predicted open reading frame (ORF) was 1269 bp long, and the CDS included all complete ORF frames, encoding 422 amino acids. The molecular formula of the protein encoded by the Bxadh2 gene was obtained using the ExPASy-ProtParam tool: C3709H6151N1269O1510S420, with a molecular weight of 45,389.45, a theoretical isopoint (pI) value of 8.87, hydrophilicity of 0.016, and an instability index of 31.09, showing a relatively stable class of proteins. The total number of amino acids was 422, and their distribution is shown in Figure 2.

3.2.2. Bxadh2 Hydrophilic Analysis

The analysis of the hydrophilicity of the protein encoded by the PWN Bxadh2 gene was conducted using ExPASy-ProtScale. The protein was more hydrophilic near lysine at position 43 and more hydrophobic near isoleucine at position 272 (Figure 3A). Overall, the number of hydrophobic amino acids in the Bxadh2 protein peptide chain was greater than the number of hydrophilic amino acids, indicating that the protein was hydrophobic.

3.2.3. Bxadh2 Transmembrane Domain Prediction

Membrane proteins are a kind of proteins with a unique structure, which are ubiquitous in all kinds of cells and play an important physiological function. In this study, the TMHMM server online tool was used to predict the transmembrane structural domain of the PWN Bxadh2 amino acid sequence. The protein did not have a transmembrane structural domain (Figure 3B), suggesting that PWN Bxadh2 may not be involved in transmembrane movement.

3.2.4. Bxadh2 Signal Peptide Prediction

Signal peptide is a sequence of amino acids that can be recognized by the transport system in immature proteins. Proteins containing signaling peptides can be secreted outside the cell. We used the SignalP-5.0 Server software to predict the PWN Bxadh2 amino acid sequence of the signal peptide. According to the software prediction results, the protein did not have a signal peptide sequence. Therefore, the protein encoded by the PWN Bxadh2 gene is likely to be an intracellular enzyme.

3.2.5. Bxadh2 Phosphorylation Site Prediction

Phosphorylation is one of the most important post-translational modifications in proteins, so the more amino acid phosphorylation sites are present in a polypeptide chain, the more functionality the protein exerts. We predicted the phosphorylation sites of the protein encoded by the PWN Bxadh2 gene online using the NetPhos 3.1 Server. The protein had 14 serine phosphorylation sites, 12 threonine phosphorylation sites and 4 tyrosine phosphorylation sites (Figure 4). The phosphorylation site prediction provides reference sites for future gene expression regulation and protein modification.

3.2.6. Bxadh2 Secondary and Tertiary Structure Predictions

For the predictive analysis of the secondary structure of the Bxadh2 protein, we used the online NPS@-SOPMA software. The protein had 102 α-helices, accounting for 24.17% of the secondary structure; two extended chains, accounting for 21.8% of the secondary structure; 44 β-folds, accounting for 10.43% of the secondary structure; and 184 irregular coils, accounting for 43.6% of the secondary structure (Figure 5). The SWISS-MODEL protein modeling software was used to predict the tertiary structure of the PWN Bxadh2 protein, using the yeast alcohol dehydrogenase NADH-1 (PDB database number 7kc2.1) as the modeling model, with a coverage of 82% (Figure 6).

3.3. PWN Bxadh2 Gene Function Studies

3.3.1. PWN Bxadh2 Gene Interference Efficiency

The relative gene expression of each group was calculated based on the 2−ΔΔCT method. The gene expression of the PWNs treated with the NC siRNA solution was compared with those treated with Bxadh2 siRNA. PWN gene expression was found to decrease to 44% after the Bxadh2 siRNA treatment; a Student’s t-test was conducted to analyze the significance of the difference between the two, and significant difference was obtained (Figure 7A), indicating that the interference was effective. Therefore, PWNs treated with RNA interference could be used for subsequent experimental studies.

3.3.2. Changes in PWN Activity after RNA Interference

From day 3 to day 15, the NC siRNA control group’s survival rate decreased from 88.32 to 44.39% and the viability of the Bxadh2 siRNA-treated group decreased from 73.93 to 27.19% (Figure 7B). This indicates that PWN viability was significantly reduced when the expression of the PWN Bxadh2 gene was inhibited.

3.3.3. PWN Fecundity Changes Following RNA Interference

After incubating the PWNs on grey grape spores for 5 d, the PWNs were collected using the Baermann funnel method and their fecundity was calculated. The number of nematodes in the NC siRNA control and Bxadh2 siRNA-treated groups was 8683 and 6217, respectively (Figure 7C), indicating that when the expression of the Bxadh2 gene is suppressed in PWN, its reproduction is significantly reduced.

4. Discussion

PWD is a complex disease system composed of many factors, such as PWN, host defense mechanism, vector, bacteria, fungi and the environment [34]. Its pathogenesis is complex, and the incidence rate is extremely fast. Many factors are involved in the occurrence and development of this disease, such as pine resistance, nematode and its related bacteria [35].
When a pine tree is invaded by PWN, it elicits a series of defensive responses, secreting a large number of secondary metabolites to defend itself against PWN [36]. During the parasitization of affected pine trees by PWN, detoxification of harmful substances is crucial for this nematode’s adaptation to the host’s internal environment and for its successful parasitization. Therefore, PWN must metabolize the toxins produced by the affected pine tree through detoxification genes to successfully parasitize the tree. P450 plays an important role in the synthesis and degradation of biological endogenous substances and the metabolism and detoxification of exogenous substances [37]. P450 is one of the families of supergenes associated with metabolic resistance in nematodes and plays a key role in both growth and development and pathogenicity [38]. P450 genes were found to be extensively involved in the growth, development, reproduction and metabolism of endogenous compounds in Caenorhabditis elegans. In Cryptobacterium hidradenum, a study on the RNAi of two highly similar P450 genes, cyp-31A2 and cyp-31A3, revealed some effects on its reproduction [36]. The three cytochrome P450 genes, Bma-cyp-33A1, Bma-cyp-33B1 and Bma-cyp-43A1, of C. marcescens are closely related to their growth and development. In PWN, the CYP22a1 (daf-9) gene was successfully cloned using the RACE technique, and it was confirmed that the daf-9 gene causes slow growth and development in PWN [39]. It was concluded that the cytochrome P450 pathway is the main detoxification pathway in PWN. By interfering with the expression of CYP33C9, CYP33C4 and CYP33D3 genes in the P450 family, PWN survival rate and pathogenicity are significantly reduced [40,41,42]. Previous experiments have shown that the Bxadh2 gene is associated with cytochrome P450 [25]. To investigate the Bxadh2 gene’s physiological functions in PWN, the full length of the Bxadh2 gene was successfully cloned via PCR amplification and gene bioinformatics analysis was carried out. The Bxadh2 gene, with a CDS of 1269 bp and encoding 422 amino acids, is a relatively stable intracellular protein that is hydrophobic and does not participate in transmembrane movement.
RNAi can block the expression of specific genes in vivo by inducing the degradation of homologous mRNAs through small double-stranded RNAs [43]. Numerous scholars have studied PWN gene functions using RNAi technology. Wang studied PWN BxAK1 gene function via RNAi technology and found that the down-regulation of gene expression led to a decrease in reproductive capacity and increased nematode mortality [44]. Kang performed RNAi analysis on the PWN BxVap-1 gene and found that it was closely related to PWN migration ability [45]. Feng found that when RNAi silenced the cyp-33D3 gene in PWN, the feeding rate and reproductive ability of PWN decreased. It is hypothesized that silencing the cyp-33D3 gene affects the normal meiosis of PWN embryonic cells, inhibits the synthesis of lipid substances required for eggshell formation, and increases nematode mortality, thus resulting in reduced nematode fecundity [38]. Wang inoculated disturbed PWNs on black pine and found a significant reduction in nematode pathogenicity [44], similar to previous studies on the interference of cyp-33C9 gene, bxpel1 gene and endonuclo β-1,4 glucanase gene [46,47,48]. Both the Bxadh2 and Bxadh1 genes belong PWM alcohol dehydrogenase, and when the Bxadh1 gene expression was inhibited, the survival and reproductive ability of PWNs soaked in ethanol showed a significant downward trend [49], which is consistent with the decline in survival rate and fecundity of PWNs caused by the Bxadh2 gene in this experiment. These results indicate that the Bxadh2 gene is involved in regulating PWM survival and reproductive ability. Furthermore, because it plays a role in both drug metabolism mediated by cytochrome P450 and the metabolism of xenobiotics by cytochrome P450, the P450 gene plays an important role in PWM survival and reproduction. Our study provides more data to elucidate PWM molecular pathogenesis and provides a theoretical basis for PWM biological control. Previous studies showed that when pine seedlings were co-inoculated with the Bacillus cereus strain GD2 and PWN, seedling morbidity increased and the expression of the Bxadh2 gene was significantly enhanced in the nematodes. In this experiment, nematode survival and fecundity were significantly reduced when the expression of the Bxadh2 gene was suppressed [25], but whether its pathogenicity would be affected needs further study.

5. Conclusions

We successfully cloned the Bxadh2 gene using RT-PCR and analyzed its putative function through bioinformatics analysis. It was found that the Bxadh2 gene was involved in the metabolic pathway of P450 and played a certain role in the metabolism of foreign substances. The function of the PWN Bxadh2 gene was investigated using RNAi technology, and we found that interference with the Bxadh2 gene significantly reduced PWN viability and reproductive capacity. This suggests that the Bxadh2 gene may be involved in regulating PWN survival and reproduction. Our findings not only provide data to elucidate the function of the Bxadh2 gene in PWN but also provide a reference for studying the function of other PWN genes.

Author Contributions

Conceptualization, experimental, data analysis and manuscript writing, L.S.; writing—article guidance and data analysis, J.H.; sample collection, Y.C.; guaranteeing the integrity of the entire study and approval of the final version of the manuscript, J.T. and J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (2021YFD1400900).

Data Availability Statement

The data presented in this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhu, L.H.; Ye, J.R.; Negi, S.; Xu, X.-L.; Wang, Z.-L.; Ji, J.-Y. Pathogenicity of Aseptic Bursaphelenchus xylophilus. PLoS ONE 2012, 7, e38095. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Pereira, F.; Moreira, C.; Fonseca, L.; van Asch, B.; Mota, M.; Abrantes, I.; Amorim, A. New Insights into the Phylogeny and Worldwide Dispersion of Two Closely Related Nematode Species, Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. PLoS ONE 2013, 8, e56288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Mallez, S.; Castagnone, C.; Espada, M.; Vieira, P.; Eisenback, J.D.; Mota, M.; Guillemaud, T.; Castagnone-Sereno, P. First Insights into the Genetic Diversity of the Pine Wood Nematode in Its Native Area Using New Polymorphic Microsatellite Loci. PLoS ONE 2013, 8, e59165. [Google Scholar] [CrossRef] [Green Version]
  4. Kikuchi, T.; Cotton, J.A.; Dalzell, J.J.; Hasegawa, K.; Kanzaki, N.; McVeigh, P.; Takanashi, T.; Tsai, I.J.; Assefa, S.A.; Cock, P.J.A. Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus. PLoS Pathog. 2011, 7, e1002219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Kosaka, H.; Aikawa, T.; Ogura, N.; Tabata, K.; Kiyohara, T. Pine wilt disease caused by the pine wood nematode: The induced resistance of pine trees by the avirulent isolates of nematode. Eur. J. Plant Pathol. 2001, 107, 667–675. [Google Scholar] [CrossRef]
  6. Kawai, M.; Shoda-Kagaya, E.; Maehara, T.; Zhou, Z.; Lian, C.; Iwata, R.; Yamane, A.; Hogetsu, T. Genetic structure of pine sawyer Monochamus alternatus (Coleoptera: Cerambycidae) populations in northeast Asia: Consequences of the spread of pine wilt disease. Environ. Entomol. 2006, 35, 569–579. [Google Scholar] [CrossRef]
  7. Jianren, Y. Analysis of the epidemic status, control techniques and countermeasures of pine wood nematode disease in China. For. Sci. 2019, 55, 1–10. [Google Scholar]
  8. Abelleira, A.; Picoaga, A.; Mansilla, J.P.; Aguin, O. Detection of Bursaphelenchus Xylophilus, Causal Agent of Pine Wilt Disease on Pinus pinaster in Northwestern Spain. Plant Dis. 2011, 95, 776–780. [Google Scholar] [CrossRef]
  9. Inacio, M.L.; Nobrega, F.; Vieira, P.; Bonifácio, L.; Naves, P.; Sousa, E.; Mota, M. First detection of Bursaphelenchus xylophilus associated with Pinus nigra in Portugal and in Europe. For. Pathol. 2015, 45, 235–238. [Google Scholar] [CrossRef]
  10. Zhao, L.L.; Wei, W.; Kang, L.; Sun, J.H. Chemotaxis of the pine wood nematode, Bursaphelenchus xylophilus, to volatiles associated with host pine, Pinus massoniana, and its vector Monochamus alternatus. J. Chem. Ecol. 2007, 33, 1207–1216. [Google Scholar] [CrossRef]
  11. Harmana, L.; Krusbergl, R.; Nicklew, R. Pine Wood Nematode, Bursaphelenchus xylophilus, Associated with Red Pine, Pinus resinosa, in Western Maryland. J. Nematol. 1986, 18, 575–580. [Google Scholar]
  12. Wang, M.; Wang, D.D.; Zhang, X.; Wang, X.; Liu, W.; Hou, X.; Huang, X.; Xie, B.; Cheng, X. Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants. Int. J. Parasitol. 2016, 46, 351–360. [Google Scholar] [CrossRef] [PubMed]
  13. Zhu, S.Y. The spread of pine wood nematode disease in China is serious. China For. Sci. Technol. 1992, 3, 6–7. [Google Scholar]
  14. Zhao, H.; Chen, C.; Liu, J.; Liu, P.; Liu, Q.; Jian, H. Aseptic Bursaphelenchus xylophilus does not reduce the mortality of young pine tree. For. Pathol. 2013, 43, 444–454. [Google Scholar] [CrossRef]
  15. Qiu, X.W.; Wu, X.Q.; Huang, L.; Tian, M.; Ye, J. Specifically Expressed Genes of the Nematode Bursaphelenchus xylophilus Involved with Early Interactions with Pine Trees. PLoS ONE 2013, 8, e78063. [Google Scholar] [CrossRef] [Green Version]
  16. Dang, Q.L.; Son, S.W.; Cheon, H.M.; Choi, G.J.; Choi, Y.H.; Jang, K.S.; Lim, C.H.; Kim, J.-C. Pyochelin isolated from Burkholderia arboris KRICT1 carried by pine wood nematodes exhibits phytotoxicity in pine callus. Nematology 2011, 13, 521–528. [Google Scholar] [CrossRef]
  17. Oku, H. Role of phytotoxins in pine wilt diseases. J. Nematol. 1988, 20, 245–251. [Google Scholar]
  18. Oku, H.S.T.; Kurozumi, S. Participation of toxin in wilting of Japanese pines caused by a nematode. Naturwissenschaften 1979, 66, 210. [Google Scholar] [CrossRef]
  19. Mamiya, Y. Inoculation of the first year pine (Pinus densiflora) seedlings with Bursaphelenchus lignicolus and the histopathology of diseased seedlings. J. Jpn. For. Soc. 1980, 62, 176–183. [Google Scholar]
  20. Wang, X. Study on the Pathogenesis of CYP450 Gene in Pine Wood Nematode; Chinese Academy of Forestry: Beijing, China, 2016; pp. 9–10. [Google Scholar]
  21. Schulerm, A.; Werck-Reichhart, D. Functional genomics of P450s. Annu. Rev. Plant Biol. 2003, 54, 629–667. [Google Scholar] [CrossRef]
  22. Arlt, V.M.; Stiborova, M.; Henderson, C.J.; Thiemann, M.; Frei, E.; Aimová, D.; Singh, R.; da Costa, G.G.; Schmitz, O.J.; Farmer, P.B.; et al. Metabolic activation of benzo a pyrene in vitro by hepatic cytochrome P450 contrasts with detoxification in vivo: Experiments with hepatic cytochrome P450 reductase null mice. Carcinogenesis 2008, 29, 656–665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Laing, R.; Bartley, D.J.; Morrison, A.A.; Rezansoff, A.; Martinelli, A.; Laing, S.T.; Gilleard, J.S. The cytochrome P450 family in the parasitic nematode Haemonchus contortus. Int. J. Parasitol. 2015, 45, 243–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Chen, Y.X.; Yan, Z.M.; Tan, J.J. Identification of the endophytic bacterium GD2 in Pinus sylvestris and its effect on the occurrence of pine nematode disease. Phytosanitary 2021, 5, 35. [Google Scholar] [CrossRef]
  25. Chen, Y.X.; Zhao, X.J.; Tan, J.J. Effects of the endophytic bacterium GD2 on the transcriptome of pine wood nematode (Pinus sylvestris) during host invasion. J. Huazhong Agric. Univ. 2021, 40, 9. [Google Scholar]
  26. Shen, D.P.; Zhang, X.Y.; Feng, M.T.; Jianren, Y.; Xiuwen, Q. Construction of cytochrome cyp-13A11 gene RNA interference vector and its function analysis in Pine Wood Nematode. J. Beijing For. Univ. 2021, 43, 96–102. [Google Scholar]
  27. Qiu, X.W.; Wu, X.Q.; Huang, L.; Ye, J.J. Cloning of Bxpel2 gene from pine wood nematode and construction of RNA interference vector. For. Res. 2016, 29, 283–288. [Google Scholar]
  28. Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391, 806–811. [Google Scholar] [CrossRef]
  29. Xu, X.L.; Wu, X.Q.; Ye, J.R.; Huang, L. Molecular Characterization and Functional Analysis of Three Pathogenesis-Related Cytochrome P450 Genes from Bursaphelenchus xylophilus (Tylenchida: Aphelenchoidoidea). Int. J. Mol. Sci. 2015, 16, 5216–5234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Deng, L.N.; Wu, X.Q.; Ye, J.R.; Xue, Q. Identification of Autophagy in the Pine Wood Nematode Bursaphelenchus xylophilus and the Molecular Characterization and Functional Analysis of Two Novel Autophagy-Related Genes, BxATG1 and BxATG8. Int. J. Mol. Sci. 2016, 17, 279. [Google Scholar] [CrossRef] [Green Version]
  31. Wang, D.D.; Chen, G.H.; Pan, L.M. Analysis of pine nematode ncr gene function using RNAi. J. Plant Pathol. 2018, 48, 518–526. [Google Scholar]
  32. Wang, S.X. Captive Rearing and RNA Interference of Pine Nematodes; Zhejiang Forestry College: Hangzhou, China, 2007. [Google Scholar]
  33. Viglierchio, D.R.; Schmitt, R.V. On the methodology of nematode extraction from field samples: Baermann funnel modifications. J. Nematol. 1983, 15, 438–444. [Google Scholar] [PubMed]
  34. Mamiya, Y. Pathology of the Pine Wilt Disease Caused by Bursaphelenchus xylophilus. Annu. Rev. Phytopathol. 1983, 21, 201–220. [Google Scholar] [CrossRef]
  35. Futai, K. Pine Wood Nematode, Bursaphelenchus xylophilus. Annu. Rev. Phytopathol. 2013, 51, 61–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Benenati, G.; Penkov, S.; Muller-Reichert, T.; Entchev, E.V.; Kurzchalia, T.V. Two cytochrome P450s in Caenorhabditis elegans are essential for the organization of eggshell, correct execution of meiosis and the polarization of embryo. Mech. Dev. 2009, 126, 382–393. [Google Scholar] [CrossRef]
  37. Chapple, C. Molecular-genetic Analysis of Plant Cytochrome P450-Dependent Monooxtgenases. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998, 49, 311–343. [Google Scholar] [CrossRef] [PubMed]
  38. Feng, M.T.; Shen, D.P.; Ye, J.R.; Chen, F.; Zhang, X.; Qiu, X. RNA Interference and Function of cyp-33D3 Gene in Pine wood Nematode. Res. For. Sci. 2020, 33, 32–38. [Google Scholar]
  39. Wang, D.D. Cloning and Functional Study of Dormance-Related Genes daf-3, daf-9, daf-12 and daf-16 in Pine Wood Nematodes; Jilin University: Changchun, China, 2012. [Google Scholar]
  40. Xu, C.J.; Li, C.Y.T.; Kong, A.N.T. Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch. Pharm. Res. 2005, 28, 249–268. [Google Scholar] [CrossRef]
  41. Yan, X.; Cheng, X.Y.; Wang, Y.S.; Luo, J.; Mao, Z.-C.; Ferris, V.R.; Xie, B.-Y. Comparative transcriptomics of two pathogenic pine wood nematodes yields insights into parasitic adaptation to life on pine hosts. Gene 2012, 505, 81–90. [Google Scholar] [CrossRef]
  42. Guengerichf, P. Cytochrome P450 and chemical toxicology. Chem. Res. Toxicol. 2008, 21, 70–83. [Google Scholar] [CrossRef]
  43. Niu, J.H.; Jian, H.; Xu, J.M.; Guo, Y.D.; Liu, Q. RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes. Afr. J. Biotechnol. 2010, 9, 7573–7582. [Google Scholar]
  44. Wang, X.R.; Cheng, X.; Li, Y.D.; Zhang, J.-A.; Zhang, Z.-F.; Wu, H.-R. Cloning arginine kinase gene and its RNAi in Bursaphelenchus xylophilus causing pine wilt disease. Eur. J. Plant Pathol. 2012, 134, 521–532. [Google Scholar] [CrossRef]
  45. Kang, J.S.; Koh, Y.H.; Moon, Y.S.; Lee, S.H. Molecular properties of a venom allergen-like protein suggest a parasitic function in the pine wood nematode Bursaphelenchus xylophilus. Int. J. Parasitol. 2012, 42, 63–70. [Google Scholar] [CrossRef] [PubMed]
  46. Qiu, X.W.; Yang, L.L.; Ye, J.R.; Wang, W.; Zhao, T.; Hu, H.; Zhou, G. Silencing of cyp-33C9 Gene Affects the Reproduction and Pathogenicity of the Pine Wood Nematode, Bursaphelenchus xylophilus. Int. J. Mol. Sci. 2019, 20, 4520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Kawazu, K.; Zhang, H.; Kanzaki, H. Accumulation of benzoic acid in suspension cultured cells of Pinus thunbergii Parl. in response to phenylacetic acid administration. Biosci. Biotechnol. Biochem. 1996, 60, 1410–1412. [Google Scholar] [CrossRef]
  48. Ma, H.B. Cloning and RNA Interference of the Cellulose Lineage and Its cDNA Gene of the Pine Wood Nematode; China Academy of Forestry Science: Beijing, China, 2008. [Google Scholar]
  49. Wang, L.S. Physiological Function of Alcohol Dehydrogenase Gene in Pinus sylvestris; Qingdao University: Qingdao, China, 2019. [Google Scholar]
Forests 14 01283 g001 550
Figure 1. Cloning of the PWN Bxadh2 gene. Note: (A) is PCR amplification of the full length of Bxadh2; (B) is the p ET-32a vector verified by EcoR V single digestion, with (1) showing the p ET-32a vector without restriction endonuclease digestion, and (2) showing the p ET-32a vector with EcoR V single digestion; and (C) is the colony PCR verification.
Figure 1. Cloning of the PWN Bxadh2 gene. Note: (A) is PCR amplification of the full length of Bxadh2; (B) is the p ET-32a vector verified by EcoR V single digestion, with (1) showing the p ET-32a vector without restriction endonuclease digestion, and (2) showing the p ET-32a vector with EcoR V single digestion; and (C) is the colony PCR verification.
Forests 14 01283 g001
Forests 14 01283 g002 550
Figure 2. Bxadh2 protein amino acid content of PWN.
Figure 2. Bxadh2 protein amino acid content of PWN.
Forests 14 01283 g002
Forests 14 01283 g003 550
Figure 3. Prediction of Bxadh2 protein of PWN. Note: (A) is the prediction of Bxadh2 protein hydrophilicity of PWN, and (B) is the transmembrane region prediction of Bxadh2 protein of PWN.
Figure 3. Prediction of Bxadh2 protein of PWN. Note: (A) is the prediction of Bxadh2 protein hydrophilicity of PWN, and (B) is the transmembrane region prediction of Bxadh2 protein of PWN.
Forests 14 01283 g003
Forests 14 01283 g004 550
Figure 4. Map of the phosphorylation site analysis of Bxadh2 protein of PWN.
Figure 4. Map of the phosphorylation site analysis of Bxadh2 protein of PWN.
Forests 14 01283 g004
Forests 14 01283 g005 550
Figure 5. Prediction of PWN Bxadh2 protein secondary structure. Note: Blue indicates alpha helices, red indicates extended chains, green indicates beta folding, purple indicates irregular coiling, and the horizontal axis is the amino acid position.
Figure 5. Prediction of PWN Bxadh2 protein secondary structure. Note: Blue indicates alpha helices, red indicates extended chains, green indicates beta folding, purple indicates irregular coiling, and the horizontal axis is the amino acid position.
Forests 14 01283 g005
Forests 14 01283 g006 550
Figure 6. Steric structure model of PWN Bxadh2 protein.
Figure 6. Steric structure model of PWN Bxadh2 protein.
Forests 14 01283 g006
Forests 14 01283 g007 550
Figure 7. RNAi of Bxadh2. Note: (A) shows the Bxadh2 expression level after interference. (B) shows the PWN activity changes after RNA interference. (C) shows the PWN fertility changes after RNA interference (** p < 0.01 and *** p < 0.001).
Figure 7. RNAi of Bxadh2. Note: (A) shows the Bxadh2 expression level after interference. (B) shows the PWN activity changes after RNA interference. (C) shows the PWN fertility changes after RNA interference (** p < 0.01 and *** p < 0.001).
Forests 14 01283 g007
Table
Table 1. Polymerase chain reaction (PCR) primers of Bxadh2.
Table 1. Polymerase chain reaction (PCR) primers of Bxadh2.
Forward PrimersReverse Primer
AAGGCCATGGCTGATATCGAAGAGGACCAAGATACGGAGAATTCGGATCCGATATCTCACTTCCACAAG-TCAAGGAC
Note: The underlined part is the homologous arm sequence.
Table
Table 2. RNAi primer of the Bxadh2 gene in Bursaphelenchus xylophilus.
Table 2. RNAi primer of the Bxadh2 gene in Bursaphelenchus xylophilus.
Bxadh2 (5′-3′)Negative Control (5′-3′)
Oligo—1GATCACTAATACGACTCACATAGGGGCCCAACTGTGACAACGTTTTGATCACTAATACGACTCAC-TATAGGGGGGATGTCTCACATCTTGTTT
Oligo—2CTAGTGATTATGCTGAGTGATATCCCCGGGTTGACACTGTTGCAAAACTAGTGATTATGCTGAGTGATATCCCCCCTACAGAGTGTAGAACAAA
Oligo—3AAGCCCAACTGTGACAACGTTCCCTATAGTGAGTCGTATTAGTGATCAAGGGATGTCTCACATCTTGTCCCTATAGTGAGTCGTATTAGTGATC
Oligo—4TTCGGGTTGACACTGTTGC-AAGGGATATCACTCAGCATAATCACTAGTTCCCTACAGAGTGTAGAACAGGGATATCACTCAGCATAATCACTAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shen, L.; Hu, J.; Chen, Y.; Tan, J.; Ye, J. Cloning, Bioinformatics Analysis and Physiological Function of the Pine Wood Nematode Bxadh2 Gene. Forests 2023, 14, 1283. https://doi.org/10.3390/f14071283

AMA Style

Shen L, Hu J, Chen Y, Tan J, Ye J. Cloning, Bioinformatics Analysis and Physiological Function of the Pine Wood Nematode Bxadh2 Gene. Forests. 2023; 14(7):1283. https://doi.org/10.3390/f14071283

Chicago/Turabian Style

Shen, Luyang, Jiafeng Hu, Yangxue Chen, Jiajin Tan, and Jianren Ye. 2023. "Cloning, Bioinformatics Analysis and Physiological Function of the Pine Wood Nematode Bxadh2 Gene" Forests 14, no. 7: 1283. https://doi.org/10.3390/f14071283

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop