Analysis of the Alternative Splicing Events of Exogenous δ-Aminolevulinic Acid under NaCl Stress in Wild Jujube Seedlings

Abstract

Salt injury, as an abiotic stress factor, seriously affects the quality and yield of crops. This study was conducted by analyzing alternative splicing in the control (CK), δ-aminolevulinic acid (ALA), NaCl, and ALA + NaCl treatments of wild jujube (Zizyphus spinosus (Bunge)Hu) using RNA-seq. It was found that the unique differential alternative splicing is closely related to the alleviation of salt stress and the analyzed intermediates of chlorophyll synthesis and chlorophyll content in the leaves. The results showed that the content and synthesis of chlorophyll were reduced and disrupted in wild jujube leaves under NaCl stress, and the exogenous spraying of ALA could alleviate the effect of NaCl stress on the content of chlorophyll. RNA-seq indicated that the alternative splicing of genes was dominated by exon skipping in all the experimental treatments. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses revealed that the CK and ALA + NaCl comparison groups were primarily enriched in porphyrin and chlorophyll metabolism, chloroplast, and energy metabolism pathways. It is hypothesized that ALA treatment can alleviate the effects of salt stress on chlorophyll by altering the alternative splicing of genes related to photosynthesis, chlorophyll metabolism, and energy metabolism in wild jujube. In addition, the verification of alternative splicing genes related to chlorophyll metabolism in wild jujube revealed that treatment with ALA significantly upregulated the expression of HEMH, UROIII, and ChlD genes in the leaves under salt stress and increased the content of the chlorophyll biosynthetic intermediates endogenous ALA, porphobilinogen, protoporphyrin IX, Mg-protoporphyrin IX, and protochlorophyllide, which served to alleviate the effects of NaCl stress on chlorophyll in wild jujube.

1. Introduction

Jujube (Ziziphus jujuba Mill) is a plant in the family Rhamnaceae and has been cultivated for a long time. Currently, the area in which jujube is cultivated in Xinjiang has reached 400,000 hectares, making it the number one forest fruit industry in Xinjiang. This achieves the dual effect of increasing income and improving the ecological environment in the region. However, large areas of saline soils are scattered throughout Xinjiang, which have serious effects on the growth and development of jujube trees and the yield and quality of their fruits [1]. The growth of resistant rootstocks and the selective use of exogenous substances are the most effective measures to improve soil salinity. Wild jujube is rich in resistance genes and as an excellent rootstock for jujube, it is strongly adaptable, tolerant to drought and salinity, and has a deep and wide developed root system [2]. δ-Aminolevulinic acid (ALA) is an essential precursor for the formation of tetrapyrrole ring pigments, such as chlorophyll [3]. ALA plays a role in the regulation of plant growth by participating in various mechanisms in the plant. It has been shown that low concentrations of ALA can regulate the growth and development of plants and improve their cold resistance and salt tolerance among others [4]. This has been primarily reported in tomato (Solanum lycopersicon) [5], grape (Vitis vinifera) [6,7], and apple (Malus domestica) [8,9]. Current studies on improving the resistance to salt stress in wild jujube by spraying exogenous ALA solution under NaCl stress primarily focus on the physiological level, such as the contents of osmoregulatory substances and antioxidants and changes in the activities of enzyme, but there are no reports of such analysis on the molecular level.

Plant alternative splicing (AS) was first identified in the leaves of spinach (Spinacia oleracea) and Arabidopsis thaliana [10] and it refers to the transcription of the same mRNA precursor that produces two or more mature mRNAs by different splicing processes. Alternative splicing allows the genes of an organism to be transcribed to produce different transcripts, which are further translated to produce proteins with different structures and functions, and making it is an important molecular mechanism for the formation of genomic and proteomic diversity [11]. Alternative splicing in plants has been reported to be involved in multiple processes in abiotic stress responses [12,13], and the response of plants to salt stress is a particularly complex process. The osmotic pressure, antioxidant system, salt overly sensitive (SOS) and abscisic acid (ABA) cell signaling pathways, WRKY, ERF, NAC, and other transcription factor families that regulate the initiation of genes related to salt tolerance are closely related to the response to salt stress [14,15,16,17,18]. For example, the differentially expressed OsIM1 gene was isolated from the rice (Oryza sativa) salt tolerance mutant m-20, and OsIM2 generated from the AS of OsIM1 precursor mRNA resulted in a change in the gene ratio between salt-sensitive and salt-tolerant varieties, which produces different effects in response to salt adversity [19]. Moreover, the salt and ABA-sensitive lsm4 mutant exhibits mis-splicing [20]. In addition, the AS that occurs in splicing factors can also affect the response to salt stress [21]. These suggest that alternative splicing has a very important regulatory role in response to plant growth and development, as well as abiotic stresses [22].

In this study, the transcriptomes of wild jujubes treated with the CK, ALA, NaCl, and ALA + NaCl were sequenced by measuring the content of chlorophyll and performing RNA-seq, and we compared the unique differential alternative splicing genes among different treatments to provide a new perspective to explore the genetic regulatory mechanism used by ALA to alleviate salt stress in jujube and a theoretical basis to alleviate salt stress in agricultural production. This will provide a new perspective on the genetic regulation of ALA in alleviating salt stress in wild jujube, and thus lay a theoretical foundation for alleviating salt stress in agriculture.

2. Materials and Methods

2.1. Experimental Materials

The test material was wild jujube (Zizyphus spinosus (Bunge)Hu) seeds, harvested from Jia County, Yulin, northern Shanxi, China. The exogenous ALA was provided by Xi’an Tianfeng Biotechnology Co., Xi’an, China.

2.1.1. Culture Conditions

Neat and uniform jujube seeds were selected and soaked in water at room temperature for 24 h. The soaked jujube seeds were treated with 0.5% potassium permanganate for 30 min, rinsed thoroughly with sterile distilled water, and placed in a germination box lined with two layers of moist filter paper, which was placed in a 26 °C artificial climate chamber (RXZ intelligent type, Ningbo Jiangnan Instrument Factory, Zhejiang, China). The seeds were incubated in the dark. When the seedlings grew two true leaves, the uniformly growing jujube seedlings were suspended in hydroponic boxes of 19 cm × 13 cm × 11 cm (L × W × H) with 2-cm thick foam plates, and each box was placed in a light incubator with 500 mL of one-half Hoagland nutrient solution. The cultural environment was established as a photoperiod of 14 h/10 h. The light intensity was 20% (6600 lx), the temperature was 25 °C (day)/18 °C (night), and the relative humidity was 80%. The nutrient solution was changed every 3 days to ensure that the plants grew normally.

2.1.2. Treatment of the Experimental Materials

Jujube seedlings of uniform size that had grown to the sixth fully expanded leaf were selected for the experimental study with four treatments as follows: (1) foliar spray with distilled water: CK (control), denoted as A; (2) foliar spray with 100 mg L⁻¹ ALA (ALA), denoted as B; (3) foliar spray with distilled water (NaCl) with the addition of 150 mmol L⁻¹ NaCl, denoted as C; and (4) addition of 150 mmol L⁻¹ NaCl and foliar spray of 100 mg L⁻¹ ALA (NaCl + ALA), denoted as D. The concentrations of NaCl (150 mmol L⁻¹) and ALA (100 mg L⁻¹) were determined by previous experiments [23]. The treatments were applied at 10:00 am (China standard time) each day. Each treatment was replicated three times, with one replication for each 15 sour date seedlings. To avoid the salt stress effect, the target concentration was gradually increased with a gradient of 50 mmol L⁻¹ NaCl per day, and all the treatments reached the target concentration on the same day, which was then recorded as d 0. Chang et al. [24] showed that the hydroponic live seedlings of the wild jujube were more significantly injured by salt stress on the sixth day of treatment. In this experiment, a single sampling was conducted at this time. The leaves of 15 seedlings from each replicate were mixed and wrapped in tinfoil for storage at −80 °C

2.2. Measurement of the Contents of Chlorophyll and Its Intermediates

The leaves of jujube seedlings at 24 h, 48 h, and 72 h were sliced, placed in a test tube with 20 mL of 1:1 acetone:anhydrous ethanol (v/v), capped, and extracted in the dark for 24 h. The absorbance values were measured at 470, 645, and 663 nm [25]. The endogenous content of ALA was determined from the leaves treated for 72 h as described by Wu et al. [26]. The contents of protoporphyrin IX (Proto IX), Mg-protoporphyrin IX (Mg-Proto IX), and protochlorophyllide (Pch) were determined as described by Hodgins and Van Huystee [27]. The content of porphobilinogen (PBG) was determined as described by Bogorad [28].

2.3. RNA Extraction, Library Construction and Sequencing

The RNA library was constructed and sequenced by Shanghai Composites Bioinformatics (Shanghai, China), and the RNA (excluding small RNA) was extracted from wild jujube leaves using a Total Plant RNA Extraction Kit (DP432, TianGen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. After the total RNA was qualified by quality control, eukaryotic cell mRNA was enriched using magnetic beads with Oligo (dT). After enrichment, the mRNA was broken into short fragments by adding fragmentation buffer. Double-stranded cDNA was then synthesized by reverse transcription using six-base random hexamers with mRNA as the template. The double-stranded cDNA was purified using AMPure XP beads (Beckman Coulter, Brea, CA, USA), and the purified double-stranded cDNA was end-repaired, A-tailed, and sequenced. The selected double-stranded cDNAs were then enriched by PCR to construct cDNA libraries. After the library was qualified, high-throughput sequencing was performed using Illumina Hiseq2500 (Compsen Biotechnology Co., Beijing, China).

2.4. Measurement of the Expression of Genes Related to Chlorophyll Biosynthesis

The RNA of wild jujube leaves was extracted using a TaKaRa MiniBEST Plant RNA Extraction Kit (Code No. 9769; Dalian, China), and quantitative PCR (qPCR) was performed using the one-step quantitative method SYBR PrimeScript RT-PCR kit (Code No. RR066A) following the manufacturer’s instructions. The primer design sequences are shown in

Table 1. Primers for qRT PCR.

	Forward Primer	Reverse Primer
HEMH	TAATTCCGCTTCGCCGCTCATC	AGGCTGAACATCGTCCAGAGTCTC
UROIII	CTGTGCCTTCTTGTCCGCTACTTC	CTTGCCATTCTTCCCACGCTCTC
ChlD	GCAGAGAAGAGTGGTGATGTTGGTC	GCCTTGGTGTATCAGCAGTAGTAGC
NYC1	GCTGTTTTGGGAGGTGTTGGTTTG	GCCAGTACAACTCCAGTGCTCATC
18SrRNA	CAAAGCAAGCCTACGCTCTGT	CTATGAAATACGAATGCCCCC

Note: HEMH: ferrochelatase-2; UROIII: uroporphyrinogen-III synthase; NYC1: probable chlorophyll(ide) b reductase NYC1; ChlD: magnesium-chelatase subunit ChlD.

, and the relative level of expression of the genes involved in chlorophyll metabolism of jujube was calculated by the 2^−△△CT method using 18sRNA as the internal reference gene.

2.5. Statistical Analysis

Microsoft Excel 2010(Microsoft Corp., Redmond, WA, USA) and SPSS 19.0(IBM) were used for statistical and multiple comparison analysis of the obtained data. Origins 2018 software (OriginLab Inc., Northampton, MA, USA) was plotted. Data in the graphs are expressed as mean ± standard deviation (Mean ± SD). Data from each index were used with more than three replications.

2.5.1. Identification of Alternative Splicing Events

After the raw data were obtained by sequencing, they were quality controlled to remove low quality and contaminated sequences. The sequences of the quality-controlled high-quality data were then sequenced against the reference date genome using HISAT2 (https://www.ncbi.nlm.nih.gov/GCF_000826755.1_ZizJuj_1.1_genomic.fna) (accessed on 20 July 2022) [29]. rMATs software was used to analyze the alternative splicing analysis of the RNA-seq data. This software can obtain p-values and FDR values to compare between different samples or different subgroups. It can automatically detect and analyze all the types of alternative splicing events from RNA-seq data. rMATS software classifies alternative splicing events as follows: exon skipping (SE), intron retention (RI), alternative 5′splice site (A5SS), alternative 3′splice site (A3SS), and mutually exclusive exon (MXE).

2.5.2. Functional Annotation and Enrichment Analysis of the Alternative Splice Genes

The rMATS software was used to analyze the differential alternative splicing that was specific to the control and treatment. FDR < 0.05 is usually used as a screening criterion for differential AS events. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) signaling pathway enrichment analysis were performed for treatment-specific differentially alternative splice genes using TBools software. In addition, hypergeometric tests were applied to identify genes that were significantly enriched in alternative splice genes compared with those in the whole genomic background.

3. Results

3.1. Effect of Exogenous ALA on the Chlorophyll Content of Jujube Seedlings under NaCl Stress

Compared with the CK, the contents of chlorophyll a (Chl a), chlorophyll b (Chl b), and total chlorophyll of jujube seedlings increased after 24 h. This indicates that the plants can alleviate the disturbance of the external environment through their own regulation within a short period of time. Treatment with NaCl reduced the contents of Chl a, Chl b, and total chlorophyll of jujube seedlings at 48 h and 72 h. Compared with the NaCl treatment, the NaCl + ALA treatment increased the contents of Chl a, Chl b, and total chlorophyll of jujube seedlings during the whole treatment period. Thus, the chlorophyll content of jujube seedlings under NaCl stress was reduced, and its synthesis was prevented. The effect of NaCl stress on the chlorophyll content of jujube seedlings could be alleviated by spraying exogenous ALA (Figure 1).

3.2. Sequencing Quality Analysis

In this study, the jujube leaves treated with the CK, ALA, NaCl, and NaCl + ALA were used as transcriptome sequencing samples, and the transcriptome databases of the CK and treated groups were constructed. The Q20 values of all the samples sequenced >97%. The Q30 values > 93%, and the GC contents > 41%. This indicated that the sequencing results were accurate, and the overall data quality was relatively high (

Table 2. Quality summary of sequencing data.

Sample	Clean Base (G)	Error Rate (%)	Percentage of Bases with Phred Values Greater than 20 and 30 to the Total Number of Bases Q20 (%) Q30 (%)		Number of G/C Bases as a Percentage of the Total Number of Bases GC Content (%)
A-1	11.46	0.03	97.46	93.14	41.75
A-2	13.65	0.03	97.85	94.01	44.05
A-3	11.99	0.03	97.66	93.54	41.58
B-1	11.81	0.03	97.58	93.34	43.28
B-2	12.93	0.03	97.81	93.98	43.75
B-3	12.24	0.03	97.84	94.08	42.42
C-1	11.69	0.03	97.55	93.46	41.78
C-2	12.92	0.03	97.72	93.78	42.79
C-3	11.34	0.03	97.75	93.85	42.83
D-1	11.98	0.03	98.04	94.52	42.31
D-2	13.07	0.03	97.91	94.16	43.02
D-3	11.84	0.03	97.43	93.25	41.41

). The transcriptome sequences of wild jujube were compared with the winter date sequences of the date reference genome published by NCBI (https://www.ncbi.nlm.nih.gov/GCF_000826755.1_ZizJuj_1.1_genomic.fna) (accessed on 25 July 2022). Genomic localization analysis was performed (

Table 3. Mapping of wild jujube transcriptome to reference genes.

Sample	Total Reads	Total Mapped	Mapping Rate (%)	Multiple Mapped	% of Reads Mapped to Multiple Loci	Uniquely Mapped	% of Reads Mapped to Unique Loci
A-1	38,214,548	34,835,669	91.16	5,052,402	13.22	29,783,267	77.94
A-2	45,512,838	41,786,926	91.81	5,851,882	12.86	35,935,044	78.96
A-3	39,967,417	36,688,376	91.80	5,145,188	12.87	31,543,188	78.92
B-1	39,356,003	36,031,996	91.55	5,277,867	13.41	30,754,129	78.14
B-2	43,088,377	39,568,358	91.83	5,752,816	13.35	33,815,542	78.48
B-3	40,790,163	36,912,375	90.49	5,412,930	13.27	31,499,445	77.22
C-1	38,979,318	35,374,366	90.75	5,239,216	13.44	30,135,150	77.31
C-2	43,072,244	38,672,215	89.78	5,750,831	13.35	32,921,384	76.43
C-3	37,799,291	34,009,911	89.97	5,153,749	13.63	28,856,162	76.34
D-1	39,941,654	36,855,317	92.27	5,272,635	13.20	31,582,682	79.07
D-2	39,454,369	35,729,624	90.56	5,248,463	13.30	30,481,161	77.26
D-3	43,555,391	39,851,171	91.50	5,856,798	13.45	33,994,373	78.05

), and the alignment efficiency (total mapped) of clean reads to the reference genome for 12 samples ranged from 89.78% to 92.27%.

3.3. Identification of Alternative Splicing Event Types

Alternative splicing analyzed by rMATs software revealed that the major type of each type of variable splicing occurring in the comparison group of CK and the treatments was exon skipping (SE), followed by A3SS and MXE. A5SS and RI were much less prevalent. The number of variably spliced genes was highest in the CK vs. NaCl comparison group, followed by the CK vs. NaCl + ALA comparison group and the CK vs. ALA comparison group. This indicates that the more active state of variable splicing events in wild jujube appeared after treatment with NaCl (Figure 2).

3.4. Analysis of the Number of Alternative Splicing Genes Common to and Specific to the CK and Each Treatment Comparison Group

A comparative analysis of the commonality and specificity of alternative splicing events between the CK and treatment groups of jujube showed that there were differences in the alternative splicing events after different treatments, and the number of alternative splicing genes varied between treatments.

The number of genes specific to the CK and ALA comparison group, CK and NaCl comparison group, and CK and ALA + NaCl comparison group were 252, 827, and 302, respectively, and the CK and NaCl comparison group had the highest number of specific genes. The number of alternative splice genes was the highest in the CK vs. As shown in Figure 3B, there were 142 differentially spliced genes in the CK compared with the three treatment groups, accounting for 6.63% of the total number of differentially spliced genes (2142). A total of 102, 880, and 263 genes were unique to the CK compared with ALA, the CK compared with NaCl, and the CK compared with ALA + NaCl, respectively. The CK versus NaCl comparison group had the highest number of alternative splicing differential genes, and the type of alternative splicing events increased with SE as the main type, and the number of genes increased by 623 followed by A3SS and RI. The number of differential genes increased by 13 and 8, respectively, indicating that alternative splicing events increased after the NaCl treatment of acid dates. The number of genes for alternative splicing events in the CK versus ALA + NaCl comparison group was significantly higher than that in the CK versus ALA. The number of alternative splicing event genes in the CK vs. ALA + NaCl comparison group was significantly higher than that in the CK vs. ALA comparison group. This was presumably because the exogenously applied ALA responded to salt stress, thus affecting the alternative splicing gene expression and acting to alleviate salt stress (Figure 3).

3.5. GO Annotation and KEGG Functional Enrichment Analysis of the Alternative Splice Genes of the CK and Each Treatment Comparison Group of Acid Jujube

GO functional enrichment analysis was performed for the alternative splice genes of CK and each treatment comparison group of jujube, which primarily involved biological processes, cellular components, and molecular functions in the GO functional classification system. The list of entries with the most significantly enriched genes was selected. The differentially alternative splice genes of each treatment comparison group of acid jujube were compared to the KEGG database for the enrichment of metabolic pathways. The metabolic pathways that were significantly enriched by differentially alternative splice genes in each treatment comparison group were screened by p-value ≤0.05.

3.5.1. GO Annotation and KEGG Functional Enrichment Analysis of Differentially Alternative Splice Genes Specific to the CK and ALA Comparison Groups

Entries with significant enrichment of the differentially alternative splice genes specific to the CK versus ALA comparison group included molecular functions. Kinase activity was dominant, including protein serine/threonine kinase activity. Fewer entries were enriched in the cellular fractions, and they were primarily in the plasma membrane. In biological processes, signaling pathway, transmembrane receptor protein serine/threonine kinase signaling pathway, and other GO entries were identified. The most significantly enriched genes were in the pathways of lipid acid metabolism, DNA replication, fatty acid biosynthesis (

Table 4. CK versus ALA comparator group-specific differential alternative splicing genes significantly enriched in GO entries and KEGG pathway.

GO Number	GO Description	Gene Number	p- Value	GO Category	Pathway Name	Gene Number	p- Value
GO: 0004674	Protein serine/threonine kinase activity	16	0.0019	Molecular Function	Lipoic acid metabolism	1	0.0125
GO: 0005886	Plasma membrane	35	0.0265	Cellular components	DNA replication	2	0.0203
GO: 0007178	Transmembrane receptor protein serine/threonine kinase signaling pathway	7	0.0045	Biological processes	Fatty acid biosynthesis	2	0.0272

).

3.5.2. GO Annotation and KEGG Functional Enrichment Analyses of Differentially Alternative Spliced Genes Specific to the CK Versus NaCl Comparison Group

The specific differentially alternative splice genes that were significantly enriched in the CK vs. NaCl comparison group were analyzed. Among the molecular functions, enzymatic activities were dominant, including nucleotidyl transferase activity, transferase activity of transferring phosphorus-containing groups, and peptidase activity. Among the cellular components, organelles and endoplasmic reticulum were dominant, including the cytoplasm, cytoplasmic fraction, endoplasmic reticulum membrane, and endoplasmic reticulum subluminal plug. Among the biological processes, most of the genes were enriched in GO entries for metabolic processes, including organic matter metabolism, cellular protein metabolism, protein metabolism; photosynthesis regulation; and protein hydrolysis. The most significantly enriched genes were the spliceosomes, followed by transport, and more genes are significantly enriched in the genetic information processing, translation, and transcription pathways (

Table 5. CK versus NaCl comparator group-specific differential alternative splicing genes significantly enriched in GO entries and KEGG pathway.

GO Number	GO Description	Gene Number	p- Value	GO Category	Pathway Name	Gene Number	p- Value
GO: 0016779	Nucleotidyl transferase activity	12	0.0015	Molecular Function	Spliceosome	20	0.0019
GO: 0016772	Transferase activity of transferring phosphorus-containing groups	63	0.0048	Molecular Function	RNA transfer	20	0.002
GO: 0044444	Cytoplasmic fraction	283	0.0000003	Cellular components	Genetic Information Processing	100	0.0022
GO: 0005789	Endoplasmic reticulum membrane	29	0.0000068	Cellular components	Translation	48	0.0034
GO: 1901564	Organic nitrogen complex metabolic process	186	0.0000002	Biological processes	Transcription	24	0.0138

).

3.5.3. Analysis of GO Annotation and KEGG Functional Enrichment of Differentially Spliced Genes Specific to the CK vs. NaCl + ALA Comparative Group

The entries of CK and NaCl + ALA comparative group-specific differential alternative splicing genes that were enriched showed that among the molecular functions, the transferase activity was dominant. Among the cellular components, endocysts and chloroplasts were primarily dominant, including the endocyst fraction, as well as the chloroplast endocyst membrane. In biological processes, most of the genes were enriched to GO entries, such as double-strand break repair. The most enriched genes were in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors, followed by polysaccharide synthesis and metabolism, and more genes were significantly enriched in pathways, such as porphyrin and chlorophyll metabolism, and phosphatidylinositol signal transduction system (

Table 6. CK versus NaCl + ALA comparator group-specific differential alternative splicing genes significantly enriched in GO entries and KEGG pathway.

GO Number	GO Description	Gene Number	p- Value	GO Category	Pathway Name	Gene Number	p- Value
GO: 0016740	Transferase activity	37	0.0197	Molecular Function	(GPI)-anchored biosynthesis	4	0.0005
GO: 0044436	Vesicle fraction	9	0.0015	Cellular components	Polysaccharide synthesis and metabolism	5	0.0256
GO: 0009535	Chloroplast vesicle-like membranes	7	0.0067	Cellular components	Porphyrin and chlorophyll metabolic processes	3	0.0261
GO: 0006302	Double-strand break repair	9	0.0015	Biological processes	Phosphatidylinositol signaling system	4	0.0283

).

3.6. Annotation Information of the Genes Related to the Chlorophyll Metabolism Pathways

The analysis of four genes related to chlorophyll synthesis among the differentially alternative splice genes specific to ALA + NaCl treatment in jujube and identification of their annotation information on the reference genome of jujube revealed that these genes primarily encoded chelatase genes, porphyrin synthase genes, and chlorophyll b reductase genes (

Table 7. Annotation information of chlorophyll-related genes in differentially alternative splice genes specific to ALA + NaCl treatment of wild jujube.

Gene ID	Gene Annotation	Abbreviations	AS Event Types
LOC107412374	ferrochelatase-2	HEMH	MXE, SE
LOC107410856	magnesium-chelatase subunit ChlD	ChlD	SE
LOC107420915	uroporphyrinogen-III synthase	UROIII	MXE, SE, A3SS
LOC107431821	probable chlorophyll(ide) b reductase NYC1	NYC1	SE

). This indicated that the alleviation of salt stress by ALA was closely associated with the genes that were related to the process that affected chlorophyll synthesis.

3.7. Expression of Chlorophyll-Related Metabolites and Genes of Enzymes in the Leaves of Jujube Seedlings under NaCl Stress for 72 h by Exogenous ALA

As shown in Figure 4, compared with the CK, the exogenous spraying of ALA increased the contents of endogenous ALA, PBG, Proto IX, Mg-Proto IX, and Pchl and upregulated the expression of genes HEMH, UROIII, and ChlD in the leaves of jujube seedlings. Treatment with NaCl decreased the contents of PBG, Proto IX, Mg-Proto IX, and Pch, and downregulated the levels of expression of HEMH, UROIII, and ChlD genes, while it upregulated the levels of expression of the endogenous ALA and NYC1 genes. Compared with the NaCl treatment, the NaCl + ALA treatment significantly increased the contents of endogenous ALA, PBG, Proto IX, Mg-Proto IX, and Pch. It upregulated the levels of expression of the genes HEMH, UROIII, and ChlD and downregulated the expression of NYC1 genes in the leaves of jujube seedlings. It was shown that exogenous ALA upregulated the expression of genes related to the synthesis of chlorophyll in jujube seedling leaves, thus increasing the content of chlorophyll biosynthetic intermediates and alleviating the damage of chlorophyll in jujube by NaCl stress.

4. Discussion

Chlorophyll is the primary photosynthetic pigment, and when plants are subjected to biotic or abiotic stresses, the content of chlorophyll is an important indicator of the degree to which they are affected by the stress [30,31,32]. In this experiment, the chlorophyll content of wild jujube seedling leaves decreased under NaCl stress, and spraying exogenous ALA significantly increased the contents of Chl a, Chl b, and total chlorophyll of the wild jujube seedling leaves, indicating that salt stress inhibits chlorophyll synthesis. Spraying exogenous ALA alleviated the effect of NaCl stress on the chlorophyll content of wild jujube seedling leaves. This result is consistent with the findings on the germination of maize (Zea mays) seeds and the growth of seedlings under salt stress [33], and similar results were also seen regarding tomato [34,35,36] and other plants.

Alternative splicing is an important regulatory mechanism during the process of gene expression in plants and plays an important role in the generation of potential genomic information in a wide range of eukaryotes, and it is an important post-transcriptional regulatory mechanism that increases protein diversity and affects the stability of mRNA [37]. In recent years, the research and analysis of plant transcriptome sequencing revealed that the most represented alternative splice types in species, such as cotton (Gossypium hirsutum), wheat (Triticum aestivum), A. thaliana, and maize, are all RI [38,39,40], the most represented type in species, such as Staphylinia cypress, is A3SS [41], and the most represented types in asparagus (Asparagus officinale) are A3SS and SE [12]. In this study, alternative splice genes for the exogenous spraying of ALA to alleviate salt stress in wild jujube were analyzed using RNA-seq. The results showed that each type of alternative splicing occurred in the CK and treatment groups with exon skipping (SE) as the major type, and Wei et al. [42] found that the SE type accounted for the most alternative splicing events in the full-length transcriptome analysis of jujube split fruit. Thus, it is clear that the largest proportion of SE events during the exogenous spraying of ALA to alleviate salt stress in jujube is owing to differences between species, and salt treatment is a factor that exacerbates the generation of more alternative splicing events. Differential alternative splicing genes that are specific to the three comparison groups were primarily enriched in GO entries related to metabolic processes, cellular components, and substance binding. It has been shown that the GO entries related to metabolic processes, cellular components are associated with response to salt stress [43,44,45], further suggesting that alternative splicing plays a very important role in the response to salt stress.

In this study, differentially alternative splicing genes specific to wild jujube after ALA + NaCl treatment were analyzed by GO and KEGG and found to be primarily enriched in GO entries for transferase activity and chloroplast and DNA metabolic processes. A KEGG analysis revealed enrichment in porphyrin and chlorophyll metabolism, glycosylphosphatidylinositol (GPI) anchor biosynthesis, and the phosphatidylinositol signal transduction system. Wang et al. [46] suggested that exogenous δ-aminolevulinic acid facilitates the conversion of the porphyrin compound ferrous heme and promotes the seed germination of pakchoi (Brassica campestris ssp. chinensis var. communis Tsen et Lee cv. Hanxiao) in a high salt environment. In this experiment, under salt stress, sprayed exogenous ALA was significantly enriched in the porphyrin and chlorophyll metabolic pathways and chloroplast, probably because salt stress reduced the binding capacity between the pigments and pigment proteins, disrupting the thylakoid membrane ultrastructure, leading to the disintegration of chloroplasts and promoting the degradation of chlorophyll. Meanwhile, spraying ALA could promote the conversion of Chla to Chlb and avoid the degradation of chlorophyll, allowing the chlorophyll content to increase [47].

The biosynthesis of chlorophyll in higher plants can be divided into two stages. The first stage is the biosynthesis from L-glutamyl-tRNA to protoporphyrin IX. The starting key step is the synthesis of L-glutamyl-tRNA to δ-aminolevulinic acid, which is the rate-limiting step in the synthesis process and the key site for the regulation of the raw chlorophyll material. This process is regulated by the activity of glutamyl-tRNA reductase [48], followed by the generation of PBG from ALA in a condensation reaction. This forms uroporphyrinogen III with four pyrrole rings by the interconnection of four PBGs, which, in turn, removes the carboxyl group to generate. The second stage is the gradual biosynthesis of protoporphyrin IX into chlorophyll. There are two major synthetic pathways in the synthesis of tetrapyrroles that utilize protoporphyrin IX as the substrate. One is Mg-protoporphyrin IX, which is later catalyzed by six enzymes, and finally synthesized as chlorophyll [49]. Zhang et al. [50] showed that the content of uroporphyrinogen III and its preceding precursors for chlorophyll synthesis increased significantly in tomato leaves under salt stress, while the content of its following precursors decreased significantly, indicating that salt stress reduced the conversion of uroporphyrinogen III to protoporphyrin IV in the chlorophyll synthesis pathway in tomato. Jing et al. [51] grew golden berry (Physalis peruviana) seedlings in the shade. They then analyzed the pathway of chlorophyll biosynthesis in the leaves under low light conditions during shade and found that the accumulation of chlorophyll originated from the increase of uroporphyrinogen III, particularly the increase of uroporphyrinogen III synthase activity, which transformed the leaves of golden berry from golden to green. The analysis of expression of chlorophyll-related metabolites and genes in this study showed that spraying ALA significantly upregulated the expression of contents of endogenous ALA, PBG, Proto IX, Mg-Proto IX, and Pch and the HEMH, UROIII, and ChlD genes in jujube leaves under salt stress. ALA may regulate the expression of genes related to the synthesis of chlorophyll in jujube leaves at the transcriptional level. In turn, ALA may affect the synthesis of intermediates in chlorophyll metabolism, further promote chlorophyll synthesis, accelerate the process of carbon assimilation in photosynthetic organs, and improve the ability of jujube to maintain photosynthetic levels under salt stress.

5. Conclusions

In this experiment, the changes in chlorophyll and its metabolite contents of wild jujube leaves after different treatments were investigated, and the alternative splicing genes that alleviate salt stress in wild jujube after spraying exogenous ALA were elucidated using the RNA-Seq technique. The results indicated that treatment with ALA could alleviate salt stress by altering porphyrin and chlorophyll metabolic processes, chloroplasts, membrane structure, and the alternative splicing of genes related to energy metabolism. Furthermore, under salt stress, ALA treatment increased the endogenous contents of ALA, PBG, Proto IX, Mg-Proto IX, and Pch and upregulated the expression of HEMH, UROIII, and ChlD in the leaves of jujube seedlings, indicating that exogenous ALA can increase the intermediates of chlorophyll biosynthesis by upregulating the expression of genes related to the enzymes that synthesize chlorophyll in the leaves of jujube seedlings. The results suggest that exogenous ALA can improve the ability of jujube to maintain photosynthetic levels under salt stress by upregulating the expression of these enzymes in jujube seedlings, which alleviates the damage of chlorophyll by NaCl stress, promotes chlorophyll synthesis, and accelerates carbon assimilation in photosynthetic organs. The results of this study provide a theoretical basis for a comprehensive understanding of the regulatory mechanism of exogenous ALA in alleviating the response to salt stress.