Next Article in Journal
Analysing How Pre-Fire Habitat Legacy and Post-Fire Management Influence the Resilience of Reptiles to Fire
Next Article in Special Issue
Specificity and Sensitivity of a Rapid LAMP Assay for Early Detection of Emerald Ash Borer (Agrilus planipennis) in Europe
Previous Article in Journal
Single-Sided Microwave Near-Field Scanning of Pine Wood Lumber for Defect Detection
Previous Article in Special Issue
Attempt to Identify Sex Hormones in the Bodies of Selected Norway Spruce Bark Beetles
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Field Record of the Tropical Red-Banded Thrips Selenothrips rubrocinctus (Thripidae: Panchaetothripinae) in Europe

1
Anses, Laboratoire de la Santé des Végétaux, Unité d’Entomologie et Plantes Invasives, 755 Avenue du Campus Agropolis-CS 30016, CEDEX, FR-34988 Montferrier-sur-Lez, France
2
Dipartimento di Agraria, Università Degli Studi Mediterranea di Reggio Calabria, 89122 Reggio Calabria, Italy
3
Netherlands Food and Consumer Product Safety Authority, Laboratory of Entomology, P.O. Box 9102, 6700 HC Wageningen, The Netherlands
4
Dottore Forestale, Freelance, Via San Piniano, 26020 Palazzo Pignano, Italy
5
Regione Lombardia, Laboratorio del Servizio Fitosanitario Regionale c/o Fondazione Minoprio, Viale Raimondi 54, 22070 Vertemate con Minoprio, Italy
*
Author to whom correspondence should be addressed.
Forests 2021, 12(11), 1484; https://doi.org/10.3390/f12111484
Submission received: 11 October 2021 / Revised: 26 October 2021 / Accepted: 27 October 2021 / Published: 29 October 2021
(This article belongs to the Special Issue Diagnostics of Forest Pest Insects)

Abstract

Red-banded thrips Selenothrips rubrocinctus is a polyphagous pest widely distributed in tropical and subtropical regions. Various fruit trees such as cacao, cashew, mango, avocado, and guava in certain habitats are attacked. This is the first report of the spontaneous occurrence of outdoor populations of this species of thrips in Europe. This species has been found in northern Italy on Liquidambar styraciflua, Carpinus betulus, and other ornamental forest species in urban areas. Barcode sequences of the Italian specimens were obtained.

1. Introduction

Selenothrips rubrocinctus (Giard, 1901) (Thysanoptera: Thripidae) is a tropical and subtropical species, probably originating from northern South America [1]. It was reported from Brazil, Guiana, Ecuador, Peru, Suriname, Venezuela, but also from North and Central America (Florida, Mexico, Costa Rica, Honduras, Panama), from Asia (China, Malaya, Philippine Islands, Taiwan), Central Africa, South Africa, Australasia, and Pacific Islands [2,3]. It is the only species belonging to the genus.
First described as cacao (or cocoa) thrips due to considerable damages caused on cacao plants Theobroma cacao L. in Guadeloupe (Antilles, Caribbean), it is also known as red-banded thrips, due to the presence of two characteristic bright red bands around the abdomen at nymphal stage [4].
Selenothrips rubrocinctus is widely polyphagous, attacking a variety of tropical fruit trees and ornamental shrubs such as avocado (Persea americana Mill.), mango (Mangifera indica L.), cashew (Anacardium occidentale L.), papaya (Carica papaya L.) guava (Psidium guajava L.), mangosteen (Garcinia mangostana L.), rambutan (Nephelium lappaceum L.). S. rubrocinctus is a sporadic, but potentially serious, pest on avocado fruit in South Africa [5]. It can become a severe pest on young mango plants [6,7], but Grove et al. [2] report low population density in the orchards and good natural biological control in South Africa. In Brazil, it has been detected also on lychee (Litchi chinensis Sonn.), guanandi (Calophyllum brasiliense Cambess.) and sweetgum (Liquidambar styraciflua L.) [8,9]. Moreover, it is acknowledged as a pest on Brazilian vineyards (Vitis vinifera L.), which can reduce fruit quality and, in case of intense infestation, cause partial or total defoliation of the plants [10,11,12]. It is reported as a serious pest on Tung-oil trees (Vernicia fordii (Hemsl.) Airy Shaw) in southern China, where about eight overlapping generations can occur from mid-May to October, with a peak in late September [13]. Concerning ornamental plants, it has been reported in China on Viburnum odoratissimum Ker Gawl. and Rhododendron simsii Planch., causing serious damage to those species in urban green spaces of Hangzhou (Zhejiang Province) [14]. Etienne et al. [15] collected adult specimens and pupae from Rosa sp. leaves in Guadeloupe and Martinique, but did not record any feeding damage, which is instead documented by Walter et al. [16]. Reyes [17] includes Quercus trees, as well as Solanum lycopersicum L., in the list of plants associated to S. rubrocinctus in the Philippines.
In 2012, it was reported for the first time in Iran, with specimens collected from a forest in the Kordestan Province [18].
Adult thrips are dark brown to black in colour, with dark wings, folded along the back when at rest and a reddish pigmentation is visible in the first three and last abdominal segments. They are about 1.2 mm long. Immature stages are about 1 mm in length, bright yellow to orange, and with the first three and last abdominal segments bright red [3].
Eggs are inserted in the lower surface of the leaves and are covered with a drop of fluid that forms a black, circular shelter when dry. After hatching, two nymphal stages follow. They are able to move and feed, sucking the content out of leaf cells. A drop of faeces can often be seen at the end of the abdomen of actively-feeding nymphs. When released, faeces dry on the surface of the leaf, resulting in black spots. Resting stages (a pre-pupa and a pupa) appear after the two nymphal stages and feeding activity ceases, until adults emerge. In Florida, the life cycle is completed in about three weeks and several generations per year occur [3].
Selenothrips rubrocinctus has been intercepted several times in international trade by European plant health authorities. From 1980 until 1995, the Netherlands Plant Protection Organization found it on Codiaeum plants imported from Sri Lanka and Togo [19,20,21]. Afterwards, it was detected on Garcinia sp. from Thailand in 2005, on Codiaeum sp. from Surinam in 2011, and on Codiaeum sp. and Liriope sp. from Costa Rica in 2011, 2013, and 2014 [22]. The thrips were found by the plant health authorities of England and Wales during quarantine inspections on imported plant material: on Codiaeum sp. from Sri Lanka in 1995, on non-specified fruits from Indonesia in 1999, on Psidium guajava from Jamaica in 2003, and on Garcinia sp. from Thailand in 2005 [23]. In 2009, it was found in a glasshouse in Poland on Codiaeum variegatum (L.) A.Juss. plants imported from Sri Lanka [24]. According to Kobro [25], S. rubrocinctus larvae were intercepted in Sola, Norway, but on which plant is not reported in the publication.
In July 2015 an infestation of thrips sp. was noticed by Andrea Wojnar (Doctor of forestry, freelance) on some Liquidambar styraciflua and Koelreuteria paniculata Laxm. trees in the city centre of Palazzo Pignano, Cremona province, Italy (45°23’29.0"N 9°34’03.7"E). The trees were already in a state of vegetative stress due to water deficit and showed early leaf drop. Green areas in other adjacent municipalities were checked in order to assess the spread of the phenomenon. The general habitus of the specimens, especially of the immature stages, suggested that it could be S. rubrocinctus.
In this paper, we report the first occurrence of S. rubrocinctus in northern Italy on different forest plant species. This is the first official field record of this thrips in Europe, according to the available literature and official reports in the European Plant Protection Organization (EPPO Global Database). Until now, the known distribution of this insect was limited to tropical and subtropical regions. Also, the genetic barcoding sequences of the Italian specimens are provided.

2. Materials and Methods

2.1. Collection of Specimens and Morphological Identification

From 2016 to 2020, unofficial survey activities were carried out which confirmed the establishment of the thrips species in the area. Beside Liquidambar styraciflua and Koelreuteria paniculata, other trees species were found to be attacked. Photographs of infestation were taken with a Nikon Coolpix B700 camera (vertical and horizontal resolution of 300 pixels, width of 3264 pixels, height of 2448 pixels) and an Olympus SP560UZ camera (vertical and horizontal resolution of 72 pixels, width of 3264 pixels, height of 2448 pixels). Adult and larval specimens were collected in different municipalities in the provinces of Cremona and Lodi (Lombardia Region) on June 24, 2019. Entire leaves were taken from lower branches of Acer campestre L., Carpinus betulus L., Koelreuteria paniculata, Liquidambar styraciflua and Parrotia persica (DC.) C.A.Mey. and put in plastic bags which were then sealed. In the laboratory, after freezing at −80 °C for 1 h, thrips were transferred, using an entomological brush, into Eppendorf tubes filled with 95% ethanol, for storage. Specimens from Trescore Cremasco (Cremona) were available from a previous sample carried out in 2016. The mounting procedure used was according to Mound & Kibby [26] in Hoyers mountant for larvae and Canada Balsam for adults. Pre-pupae and pupae were collected from infested leaves, but they were not included in the identification process.
Identification keys of Wilson [27] and Mirab-Balou et al. [28] were used. The specimens were compared with NRC reference material sampled in Vietnam and from Dutch import inspections of material originating from Togo, Sri Lanka, Thailand, Costa Rica and Surinam. The genus Selenothrips is identified with the key given by Wilson [27]. Two species were originally placed in this genus, but one of these, S. glabratus Priesner, 1927, was afterwards moved to another taxon (Xestothrips) due to the smooth head and pronotum [1]. A smooth head and pronotum is a rare character within the Panchaetothripinae. The species S. rubrocinctus, shows some differences in morphology between populations in body size and forewing length [27]. These characters were measured from females of different origin, together with the length/width ratio of antennal segments. The neotype (Guadeloupe) was compared on these characters with a large and a small female from Italy and with collection material of Netherlands Food and Consumer Product Safety Authority.
Males are rarely sampled and were not compared with collection material in detail. Nevertheless, the position and size of three pairs of spines on tergite IX was compared with collection material (Cape Verde Islands and Surinam) from the Senckenberg Institut at Frankfurt am Main, Germany.
Identified specimens were deposited in the NRC collection (Wageningen, Netherlands) and at the Department of Agriculture, Mediterranean University of Reggio Calabria (Reggio Calabria, Italy).

2.2. DNA extraction and Amplification

Specimens from the same sample as above were submitted for molecular analysis in order to obtain barcode sequences. Total genomic DNA was extracted from 25 single specimens (5 first instar larvae, 20 adults) in a non-destructive way, using either the Qiagen Blood & Tissue Kit (Qiagen, Hilden, Germany) or a Chelex Extraction Protocol by Vono et al. [29]. Protocols were slightly modified. Polymerase chain reaction (PCR) was used to amplify a fragment of the mitochondrial cytochrome c oxidase gene, subunit 1 (COI), using the primers reported in Table 1.
The PCR mix had a total volume of 25 μL and contained 2.5 mM MgCl2, primer cocktail at a concentration of 200 nM, 0.1 mM dNTPs, 2 μL of genomic DNA and 1 unit of TaqDNA polymerase (GoTaq G2 Flexi, Promega, Madison, WI). The amplification profile consisted of one step of 3 min at 94 °C, 5 cycles of 30 s at 94 °C, 30 s at 45 °C and 1 min at 72 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 51 °C and 1 min at 72 °C, with a final elongation step of 10 min at 72 °C. The concentration of the DNA samples and their purity was determined by Nanodrop, and the PCR products were checked on a 1.2% agarose gel stained with GelRED® (Biotium, Fremont, CA, USA). All amplicons produced a single band and were cleaned using the ExoSAP protocol. Amplification products were sent for Sanger sequencing (GATC Biotech, Köln, Germany and BMR Genomics, Italy). Forward and reverse sequences were aligned in BioEdit version 7.2.5 [32], manually trimmed and were virtually translated into the corresponding amino acid chain to detect frame-shift mutations and stop codons using EMBOSS Transeq [33]. Edited sequences were searched against the BOLD Systems v. 4 and GenBank databases in order to determine the closest match and confirm the identification based on morphological characters. The sequences obtained were submitted to the GenBank database under the accession numbers LR812089, MT926000, MT939151and represent the first sequences of S. rubrocinctus specimens found in Europe and occurring in an outdoor environment. Voucher specimens were deposited in the collection at ANSES Laboratoire de la santé des Végétaux, Unité d’Entomologie et Plantes invasives (Montferrier-sur-Lez, France) and at the Department of Agriculture, Mediterranean University of Reggio Calabria (Reggio Calabria, Italy). To display graphically COI genetic differences among S. rubrocinctus specimens a phylogenetic tree was produced. Using Partition Finder version 2.1.1, Oxford, United Kinkgdom [34], the best-fitted model was identified, and then cluster analysis was carried out using Neighbour-Joining method [35] via MEGA: Molecular Evolutionary Genetics Analysis version 7.0 for Bigger Dataset [36]. Bootstrap analysis was performed based on 1000 resampling. The COI sequence of Caliothrips indicus (Bagnall, 1913) (KX622205) was used as an outgroup.

3. Results

3.1. Morphological Characteristics

Selenothrips rubrocinctus specimens were identified from all samples (Table 2; Figure A1, Figure A2 and Figure A3 in Appendix A). Among the other diagnostic characters that allow the identification of this species, the metascutellar triangle with two strong median setae was observed (Figure A2B in Appendix A). Ten males and 38 females were identified, resulting in a male/female ratio of 0.26. The common presence of larvae of S. rubrocinctus indicate active reproduction on the sampled host plants.
No differences in the position and size of three pairs of spines on tergite IX (Figure A2A in Appendix A) could be detected when the Italian male specimens were compared with collection material (Cape Verde Islands and Surinam) from the Senckenberg Institut.
Some female specimens from Italy displayed a relatively high body size, forewing length, and length/width ratio of antennal segments (Table 3) when compared to the description of the neotype (Guadeloupe) and collection reference specimens.

3.2. Molecular Analysis

The PCR of mt-COI produced fragments of ± 650 bp, and, after trimming, the final alignment consisted of 597 bp. The nucleotide composition of these sequences was T(U) = 29.7%, A = 37.7%, C = 14.3%, and G = 18.3%. The average A + T content was high (67.4%), which is in agreement with values usually recorded for insects [37]. The sequences showed an identity in the range of 97.8–95.8% with S. rubrocinctus sequences available from BOLD Systems and GenBank (percentage similarity and percentage identity respectively). COI sequences obtained from adult and larval specimens collected from different host plants (L. styraciflua, C. betulus, K. paniculata, A. campestre, P. persica) in different neighbouring municipalities (Bagnolo Cremasco, Cremosano, Crespiatica, Pandino, Palazzo Pignano) showed the presence of one haplotype. However, a limited number of specimens was sequenced in those locations (Table 4). In addition to haplotype 1, a second haplotype was found in the municipality of Trescore Cremasco, where the highest number of specimens was sampled and sequenced. An identity of 99.5% with the only Parabaliothrips coluckus Kudo, 1977 accession (HM246183.1) available from GenBank was found for haplotype 1. However, this accession is not associated with any publication and no voucher specimens could be retrieved, therefore it was considered as not reliable.
The Neighbour-Joining tree shows that the COI sequences of the two Italian haplotypes cluster with the reference sequences published in GenBank (Figure 1).

4. Discussion and Conclusions

Thrips are considered amongst the most successful invasive insect pests, due to their small size and cryptic habits, together with a polyphagous and opportunistic behaviour [40].
There are several examples of thrips species that managed to cross biogeographical borders, most likely with unaware human assistance, and establish in previously uncolonised regions. It is the case of Microcephalothrips abdominalis (D. L. Crawford, 1910), a mainly tropical and subtropical species, which have been present in Italy since the end of the last century [41]. This thrips has also been found in Slovenia [42], Croatia and Hungary [43], Canary Islands [44], France [45] and Bulgaria [46]. In 2006, a permanent population of Thrips hawaiiensis (Morgan, 1913) was discovered outdoors in France. This represents the first report in Europe of this thrips, which is widely distributed and common in tropical Asia and the Pacific region [47]. A few years later, permanent populations of this species were discovered outdoors in Spain [48] and Italy [49]. The global increase in temperatures on the planet, together with an intensification in the trade of goods and commodities from tropical regions, is likely to facilitate this phenomenon [50,51].
In summer 2015, the pantropical, polyphagus Selenothrips rubrocinctus was detected on Liquidambar styraciflua (Figure A4 in Appendix A) and Koelreuteria paniculata in urban areas of Palazzo Pignano, in northern Italy. The infestation has been confirmed every year since 2015 in annual surveys and affects an urban area involving several neighbouring municipalities in the provinces of Cremona and Lodi. This shows that the insect is firmly established in the area and is able to successfully survive the winters of northern Italy, even if it has not been possible yet to determine overwintering stage and mode.
The morphological identification is solid, based on two scientific publications reporting the description of the species [27,28], which is the only one belonging to the genus Selenothrips [1]. In comparing sizes of antennal segments and forewings of a large and a small Italian specimen with collection material originating from several origins (Table 3) we could not detect promising differences. Variation in body size in S. rubrocinctus is large and numbers of specimens available from different origins for study are low. However, females of S. rubrocinctus from Italy can be relatively large in size and they can have relatively long fore wings (Table 3). In 1949 in Florida the same was found from females collected on oak trees [27]. The length/width ratio of antennal segments VI and VII of the large Italian specimen is rather high. Both in Italy and in Florida, where it occurs also in the northern part of the state [3], the tropical S. rubrocinctus is in its northern distribution area, and in these regions thrips may show some adaptations in their morphology. It could be hypothesised that without clear differential characters, the size of Italian females may be an adaptation to longer winter periods and/or an adaptation to live on leaves of deciduous trees. It is also possible that these size adaptations are influenced by host plant species (deciduous trees) and/or environmental factors [52]. Altogether, our data on morphology are inadequate to give this larger form a taxonomic status.
In populations of S. rubrocinctus males are sometimes absent. Sexual and asexual (thelytoky) reproduction has been observed, but reports suggesting thelytoky are clearly more numerous, because the number of males observed is usually very low or they are not found at all. From the Italian samples, however, we observe a high male/female ratio (0.26). At present it is not clear what consequences sexual reproduction has for fecundity of populations of leaf feeding thrips. Experiments are time consuming and their results are not always applicable under field conditions. Moreover, even fecundity experiments in the laboratory [53] and the greenhouse [54] can give opposite conclusions on the significance of higher numbers of males for populations. Krueger et al. [53] found a reduction of oviposition rate and longevity for sexually reproducing Echinothrips americanus Morgan, 1913 while Xiao-Wei and al. [54] found the opposite for the same thrips species. More observations on the high male/female ratio of S. rubrocinctus in the field may possibly lead us to understand the significance of sexual reproduction for its local survival.
The molecular analysis confirms the morphological data. The phylogenetic analysis shows genetic differences within the Italian population in relation to the COI marker. Two different COI haplotypes were detected for adult and larval specimens collected from different host plants in different municipalities. Marullo et al. [55], recently demonstrated that DNA barcoding is a reliable tool for identifying genetic differences within the same thrips population. Our results revealed some genetic variation due to the presence of two haplotypes collected in the same location (Trescore Cremasco, where more specimens were collected and barcoded) and on the same host plant (C. betulus). This finding supports the hypothesis that at least two introduction events have occurred in the area over the years or that the founder population was characterised by some genetic variability since its introduction. It seems likely that those first specimens were introduced into Italy on indoor plants imported from other countries by nurseries, plant shops or private buyers. Codiaeum plants are among the most frequently imported host plants on which this species has been intercepted by European plant health authorities in the last decades [19,20,21,22,23,24]. The Italian haplotypes differ for 2.2–4.2% from the S. rubrocinctus sequences available in online genetic databases. The genetic variability within this species has never been studied, resulting in a lack of knowledge in this respect. Available barcodes are very few and information on the collection site are not always linked to the barcoded specimens in GenBank and BOLD Systems. From this data, it can be assumed that S. rubrocinctus displays a considerable genetic variability among populations throughout its distribution range. However, the results of a broader barcoding study of a significant number of S. rubrocinctus populations, sampled from summer green trees and deciduous trees throughout its distribution areas, should be conducted to confirm this genetic variability.
Few studies concerning Thysanoptera fauna associated with an urban environment have been conducted. Mirab-balou et al. [14] documents the biodiversity of thrips species in the urban green areas of Hangzhou, China, and reports high levels of damage caused by S. rubrocinctus on different plant species in urban parks, up until the early drop of the leaves. In Italy, the polyphagous behavior of this species is confirmed by the wide range of plant hosts attacked in the infested area, belonging to different botanical families (Altingiaceae, Betulaceae, Sapindaceae, Hamamelidaceae, Fagaceae, Rosaceae). The presence on Liquidambar styraciflua, Carpinus betulus, Koelreuteria paniculata, Acer campestre, Parrotia persica was confirmed by sampling and identification of specimens. The presence on other host plants was well documented through photographic material: Sorbus aucuparia L., Quercus robur L., Castanea sativa Mill., and Acer platanoides L. (Figure A5B–F in Appendix A). The simultaneous presence of different stages of the insect on the same leaves/plant proves that the thrips is able to complete its life cycle on all the above-mentioned host plant species. Attacked leaf areas show clear depigmentation and take on a silvery colour to the upper leaf surface, with distortion of the lamina and, in the most severe cases, premature leaf drop (phylloptosis). In addition, the pest covers the underside with droplets of excrement during normal trophic activity. It has been noted that plants in a state of vegetative stress due to drought or excessive canopy reduction through cutting large branches or apices seem more susceptible to infestation, as already observed by other authors [56]. A strategy for the management and the containment of this pest on tall trees in urban contexts seems difficult to achieve. It is possible that the thrips will naturally spread on a larger scale, with the risk of affecting not only forest species used in roadside plantings, public parks, and private gardens, but also plants of agricultural interest, such as Vitis vinifera, whose attractiveness to S. rubrocinctus has been documented in Brazil [10,11,12].
This is the first time that this tropical species has been found at such a high latitude in the temperate climate zone. It is likely that climate change has contributed to the establishment of outdoor S. rubrocinctus populations in northern Italy. Warming climate and the resulting changes in the composition of native biological communities (biome shifts) can facilitate invasions and the establishment of allochthonous species by increasing resource availability and habitat suitability [50,51,57].
Further studies are needed to monitor the spread and shed light on the biological cycle of S. rubrocinctus in northern Italy, in particular focusing on overwintering mode, number of generations per year, and host plant range. Although infestation alone is unlikely to lead to tree death, it is clear that severe infestations on trees already under vegetative stress can affect not only their appearance in the urban landscape but also compromise their viability through a significant reduction in their photosynthetic capacity.

Author Contributions

Conceptualisation, A.T., A.W., G.V. (Gregorio Vono) and R.M.; methodology, A.T., G.V. (Gregorio Vono), M.Z., G.V. (Gijsbertus Vierbergen) and R.M.; data curation, A.T., G.V. (Gregorio Vono), G.V. (Gijsbertus Vierbergen), M.Z. and A.W.; writing—original draft preparation, A.T., G.V. (Gregorio Vono) and G.V. (Gijsbertus Vierbergen); writing—review and editing, A.T., G.V. (Gregorio Vono), G.V. (Gijsbertus Vierbergen), R.M., M.Z. and A.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are openly available in GenBank.

Acknowledgments

The authors are thankful to Andrea Tantardini (Dottore Agronomo, freelance at LabAgr, Como, Italy; formerly Regione Lombardia, Laboratorio del Servizio Fitosanitario Regionale c/o Fondazione Minoprio) for the initial cooperation and preliminary identification of specimens in 2015; Giorgio Rampinini (Dottore Agronomo, freelance, Legnano, Italy) for sampling and supplying specimens from Trescore Cremasco. The authors are grateful to Andrea Vesmanis (Senckenberg Institut, Frankfurt am Main, Germany) for the investigation on morphological character-states of S.rubrocinctus male specimens slides preserved in the Thysanoptera collection of the Museum. The authors would like to express their gratitude to Philippe Reynaud (Anses Laboratoire de la santé des Végétaux, Unité d’Entomologie et Plantes invasives, Montferrier-sur-Lez, France) for his careful reading and bibliographical advice.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Figure A1. Male (A) and female (B) of S. rubrocinctus in microscopic slide; specimen collected from Carpinus betulus at Bagnolo Cremasco, 2019. Photos G. Vierbergen.
Figure A1. Male (A) and female (B) of S. rubrocinctus in microscopic slide; specimen collected from Carpinus betulus at Bagnolo Cremasco, 2019. Photos G. Vierbergen.
Forests 12 01484 g0a1
Figure A2. (A) tergites VII-X of male S. rubrocinctus; specimen collected from Carpinus betulus at Bagnolo Cremasco, 2019; (B) thoracial nota of female S. rubrocinctus, specimen collected from Liquidambar styraciflua at Pandino, 2019. Photos G. Vierbergen.
Figure A2. (A) tergites VII-X of male S. rubrocinctus; specimen collected from Carpinus betulus at Bagnolo Cremasco, 2019; (B) thoracial nota of female S. rubrocinctus, specimen collected from Liquidambar styraciflua at Pandino, 2019. Photos G. Vierbergen.
Forests 12 01484 g0a2
Figure A3. (A) larva I of S. rubrocinctus in microscopic slide, specimen collected from Liquidambar styraciflua at Crespiatica, 2019; (B) larva II of S. rubrocinctus in microscopic slide, specimen collected from Koelreuteria paniculata at Cremosano, 2019. Photos G. Vierbergen.
Figure A3. (A) larva I of S. rubrocinctus in microscopic slide, specimen collected from Liquidambar styraciflua at Crespiatica, 2019; (B) larva II of S. rubrocinctus in microscopic slide, specimen collected from Koelreuteria paniculata at Cremosano, 2019. Photos G. Vierbergen.
Forests 12 01484 g0a3
Figure A4. (A,B) Symptoms of S. rubrocinctus infestation on the lower and upper side of Liquidambar styraciflua leaves (Pandino, 2019); (C,D) effects of intense S. rubrocinctus infestation on Liquidambar styraciflua (Palazzo Pignano, 2015). Photos A. Wojnar.
Figure A4. (A,B) Symptoms of S. rubrocinctus infestation on the lower and upper side of Liquidambar styraciflua leaves (Pandino, 2019); (C,D) effects of intense S. rubrocinctus infestation on Liquidambar styraciflua (Palazzo Pignano, 2015). Photos A. Wojnar.
Forests 12 01484 g0a4
Figure A5. Symptoms of S. rubrocinctus infestation on the lower and upper side of leaves on different host plants: (A) Carpinus betulus (Bagnolo Cremasco, 2015); (B) Acer platanoides (Palazzo Pignano, 2019); (C) Sorbus aucuparia (Palazzo Pignano, 2018); (D) Quercus robur (Palazzo Pignano, 2015); (E,F) Castanea sativa (Palazzo Pignano, 2015). Photos A. Wojnar.
Figure A5. Symptoms of S. rubrocinctus infestation on the lower and upper side of leaves on different host plants: (A) Carpinus betulus (Bagnolo Cremasco, 2015); (B) Acer platanoides (Palazzo Pignano, 2019); (C) Sorbus aucuparia (Palazzo Pignano, 2018); (D) Quercus robur (Palazzo Pignano, 2015); (E,F) Castanea sativa (Palazzo Pignano, 2015). Photos A. Wojnar.
Forests 12 01484 g0a5

References

  1. Mound, L.A.; Marullo, R. The Thrips of Central and South America: An Introduction. Mem. Entomol. Int. 1996, 6, 1–488. [Google Scholar]
  2. Grove, T.; Giliomee, J.H.; Pringle, K.L. Thrips (Thysanoptera) species associated with mango trees in South Africa. Afr. Entomol. 2001, 9, 153–162. [Google Scholar]
  3. Denmark, H.A.; Wolfenbarger, D.O. Redbanded Thrips, Selenothrips rubrocinctus (Giard) (Insects: Thysanoptera: Thripidae); Entomology Circular No. 108; Division of Plant Industry, Florida Department of Agriculture and Consumer Service: Gainesville, FL, USA, 2013.
  4. Giard, A. Sur un Thrips (Physopus rubrocincta n. sp.) nuisible au cacaoyer.(Thys.). Bull. Soc. Entomol. Fr. 1901, 6, 263–265. [Google Scholar] [CrossRef]
  5. Dennill, G.B.; Erasmus, M.J. Basis for a practical technique for monitoring thrips in avocado orchards. Crop. Prot. 1992, 11, 89–91. [Google Scholar] [CrossRef]
  6. Hill, D.S. Agricultural Insect Pests of the Tropicsand their Control, 1st ed.; Cambridge University Press: Cambridge, UK, 1975; p. 528. [Google Scholar]
  7. Peng, R.K.; Christian, K. The weaver ant, Oecophylla smaragdina (Hymenoptera: Formicidae), an effective biological control agent of the red-banded thrips, Selenothrips rubrocinctus (Thysanoptera: Thripidae) in mango crops in the Northern Territory of Australia. Int. J. Pest. Manag. 2004, 50, 107–114. [Google Scholar] [CrossRef]
  8. Sánchez-Soto, S.; Nakano, O. Primeiro registro de Selenothrips rubrocinctus (Giard)(Thysanoptera: Thripidae) atacando lichia no Brasil. Neotrop. Entomol. 2004, 33, 395–396. [Google Scholar] [CrossRef]
  9. Lima, É.F.B.; Thomazini, M.; Santos, R.S.; Lopes, E.N.; Saito, L.; Zucchi, R.A. New findings of thrips (Thysanoptera: Thripidae) on plants in Brazil. Fla. Entomol. 2016, 99, 146–150. [Google Scholar] [CrossRef]
  10. Haji, F.N.P.; Moreira, A.N.; Ferreira, R.C.F.; Lopes, L.D.M.; de Alencar, J.A.; Barbosa, F.R. Monitoramento e determinação do nível de ação para tripes na cultura da uva. Embrapa Semiárido-Circ. Técnica 2001, 70, 1–8. [Google Scholar]
  11. Nali, L.R.; Barbosa, F.R.; de Carvalho, C.A.L.; dos Santos, J.B.C. Eficiência de inseticidas naturais e tiametoxam no controle de tripes em videira e seletividade para inimigos naturais. Pestic. Rev. Ecotoxicologia Meio Ambiente 2004, 14, 103–108. [Google Scholar] [CrossRef]
  12. Moreira, A.N.; Oliveira, J.V.D.; Oliveira, J.E.D.M.; Torres, J.B.; Souza, G.; França, S. Sampling technique for thrips in vineyards. Rev. Bras. Frutic. 2017, 39, 1–13. [Google Scholar] [CrossRef]
  13. Wang, W.X. Bionomics and control of Selenothrips rubrocinctus. Acta Entomol. Sinica 1984, 27, 81–86. [Google Scholar]
  14. Mirab-Balou, M.; Tong, X.L.; Chen, X.X. Thrips species diversity in urban green spaces of Hangzhou (Zhejiang Province), China. J. Entomol. Acarol. Res. 2014, 46, 85–89. [Google Scholar] [CrossRef]
  15. Etienne, J.; Ryckewaert, P.; Michel, B. Thrips (Insecta: Thysanoptera) of Guadeloupe and Martinique: Updated check-list with new information on their ecology and natural enemies. Fla. Entomol. 2015, 298–304. [Google Scholar] [CrossRef]
  16. Walter, N.T.; Adeleye, V.O.; Muthomi, P.K.; Rojas, R.J.O.; Strzyzewski, I.; Funderburk, J.; Martini, X. Toxicity of different insecticides against two thrips (Thysanoptera: Thripidae) pests of concern in Central America. Fla. Entomol. 2018, 101, 627–633. [Google Scholar] [CrossRef]
  17. Reyes, C.P. Thysanoptera (Hexapoda) of the Philippine islands. Raffles Bull. Zool. 1994, 42, 107–507. [Google Scholar]
  18. Mirab-Balou, M.; Chen, X. The subfamily Panchaetothripinae (Thysanoptera: Thripidae) in Iran, with the first report of genus Selenothrips Karny. Entomotaxonomia 2012, 34, 22–29. [Google Scholar]
  19. Vierbergen, G. International movement, detection and quarantine of Thysanoptera pests. In Thrips Biology and Management, 1st ed.; Parker, B.L., Skinner, M., Levis, T., Eds.; Plenum Press: New York, NY, USA; London, UK, 1995; Volume 276, pp. 119–132. [Google Scholar]
  20. Netherlands Plant. Protection Service NPPS. Interceptions at import. Interceptions of plant parasitic insect and mite species. In Netherlands Plant Protection Service Annual Report 1994; Netherlands Plant Protection Service: Utrecht, The Netherlands, 1995; pp. 127–129. [Google Scholar]
  21. Netherlands Plant Protection Service NPPS. Interceptions at import. Interceptions of plant parasitic insect and mite species. In Netherlands Plant Protection Service Annual Report 1995; Netherlands Plant Protection Service: Utrecht, The Netherlands, 1996; pp. 118–121. [Google Scholar]
  22. Vierbergen, G. Netherlands Food and Consumer Product Safety Authority, Laboratory of Entomology, P.O. Box 9102, 6700 HC Wageningen, The Netherlands. Unpublished work. 2021. [Google Scholar]
  23. Collins, D.W. Thysanoptera of Great Britain: A revised and updated checklist. Zootaxa 2010, 2412, 21–41. [Google Scholar] [CrossRef]
  24. Łabanowski, G. Organizmy Inwazyjne Wykrywane w Polskich Szklarniach. Wciornastki (Thripidae) Instrukcja Rozpoznawania na Podstawie Wyglądu i Objawów Żerowania, 1st ed.; Instytut Ogrodnictwa: Skierniewice, Poland, 2012; pp. 1–40. [Google Scholar]
  25. Kobro, S. On the Norwegian thrips fauna (Thysanoptera). Nor. J. Entomol. 2003, 50, 17–32. [Google Scholar]
  26. Mound, L.A.; Kibby, G. Thysanoptera. An. Identification Guide, 2nd ed.; CAB International: Wallingford, UK, 1998; pp. 1–70. [Google Scholar]
  27. Wilson, T.H. A monography of the subfamily Panchaetothripinae (Thysanoptera: Thripidae). In Monografía de la Subfamilia Panchaetothripinae (Thysanoptera: Thripidae), 1st ed.; Memoirs of the American Entomological Institute: Ann Arbor, MI, USA, 1975; Volume 23, pp. 1–354. [Google Scholar]
  28. Mirab-Balou, M.; Wang, Z.; Tong, X. Review of the Panchaetothripinae (Thysanoptera: Thripidae) of China, with two new species descriptions. Can. Entomol. 2017, 149, 141–158. [Google Scholar] [CrossRef]
  29. Vono, G.; Bonsignore, C.P.; Gullo, G.; Marullo, R. Olive production threatened by a resurgent pest Liothrips oleae (Costa, 1857) (Thysanoptera: Phlaeothripidae) in Southern Italy. Insects 2020, 11, 887. [Google Scholar] [CrossRef]
  30. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
  31. EPPO. PM 7/129 (1) DNA barcoding as an identification tool for a number of regulated pests. EPPO Bull. 2016, 46, 501–537. [Google Scholar] [CrossRef]
  32. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  33. Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef]
  34. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Boil. Evol. 2017, 34, 772–773. [Google Scholar] [CrossRef] [PubMed]
  35. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
  36. Kumar, S.; Stecher, G.; Tamura, K. MEGA 7: Molecular Evolutionary Genetics Analysis version 7.0 for biggest databases. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  37. Simon, C.; Frati, F.; Beckenbach, A.; Crespi, B.; Liu, H.; Flook, P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994, 87, 651–701. [Google Scholar] [CrossRef]
  38. Buckman, R.S.; Mound, L.A.; Whiting, M.F. Phylogeny of thrips (Insecta: Thysanoptera) based on five molecular loci. Syst. Entomol. 2013, 38, 123–133. [Google Scholar] [CrossRef]
  39. Ramage, T.; Martins-Simoes, P.; Mialdea, G.; Allemand, R.; Duplouy, A.; Rousse, P.; Davies, N.; Roderick, G.K.; Charlat, S. A DNA barcode-based survey of terrestrial arthropods in the Society Islands of French Polynesia: Host diversity within the SymbioCode Project. Eur. J. Taxon. 2017, 272, 1–13. [Google Scholar] [CrossRef][Green Version]
  40. Morse, J.G.; Hoddle, M.S. Invasion biology of thrips. Annu. Rev. Entomol. 2006, 51, 67–89. [Google Scholar] [CrossRef] [PubMed]
  41. Strapazzon, A. Italian faunal records 368. Boll. Soc. Entomol. Ital. 1999, 131, 259. [Google Scholar]
  42. Trdan, S. After the first record of Microcephalothrips abdominalis (Crawford) in Slovenia: Presentation of the species and evaluation of its potential economic importance. Zb. Bioteh. Fak. Univ. Ljubl. Kmet. Supl. 2002, 79, 309–316. [Google Scholar]
  43. Vierbergen, G.; Cean, M.; Szeller, I.B.; Jenser, G.; Masren, T.; Simala, M. Spread of two thrips pests in Europe: Echinothrips americanus and Microcephalothrips abdominalis (Thysanoptera: Thripidae). Acta Phytopathol. Entomol. Hung. 2006, 41, 287–296. [Google Scholar] [CrossRef]
  44. Zur-Strassen, R. Die Terebranten Thysanoptera Europas und des Mittelmeergebietes; Die Tierwelt Deutschands Verlag Goecke & Evers: Keltern, Germany, 2003; pp. 1–277. [Google Scholar]
  45. Pizzol, J.; Nammour, D.; Voisin, S.; Ziegler, M.; Desneux, N.; Poncet, C.; Reynaud, P. Survey of thrips species in horticultural greenhouses in Southern France. Acta Hortic. 2012, 952, 785–792. [Google Scholar] [CrossRef]
  46. Trencheva, K.; Popov, A.; Trenchev, G. Composite thrips, Microcephalothrips abdominalis, a new alien species for Bulgarian fauna. Plant Prot. Sci. 2020, 56, 132–134. [Google Scholar] [CrossRef]
  47. Reynaud, P.; Balmes, V.; Pizzol, J. Thrips hawaiiensis (Morgan, 1913) (Thysanoptera: Thripidae), an Asian pest thrips now established in Europe. Bull. OEPP 2008, 38, 155–160. [Google Scholar] [CrossRef]
  48. Goldarazena, A. First record of Thrips hawaiiensis (Morgan, 1913) (Thysanoptera: Thripidae), an Asian pest thrips in Spain. Bull. OEPP 2011, 41, 170–173. [Google Scholar] [CrossRef]
  49. Marullo, R.; de Grazia, A. Thrips hawaiiensis a pest thrips from Asia newly introduced into Italy. Bull. Insectology 2017, 70, 27–30. [Google Scholar]
  50. Diez, J.M.; D’Antonio, C.M.; Dukes, J.S.; Grosholz, E.D.; Olden, J.D.; Sorte, C.J.; Blumental, D.M.; Early, R.; Ibáñez, I.; Jones, S.J.; et al. Will extreme climatic events facilitate biological invasions? Front. Ecol. Environ. 2012, 10, 249–257. [Google Scholar] [CrossRef]
  51. Early, R.; Bradley, B.A.; Dukes, J.S.; Lawler, J.J.; Olden, J.D.; Blumenthal, D.M.; Gonzales, P.; Grosholz, E.D.; Ibáñez, I.; Miller, L.P.; et al. Global threats from invasive alien species in the twenty-first century and national response capacities. Nat. Commun. 2016, 7, 1–9. [Google Scholar] [CrossRef]
  52. Fennah, R.G. The influence of environmental stress on the cacao tree in predetermining the feeding sites of cacao thrips, Selenothrips rubrocinctus (Giard) on leaves and pods. Bull. Entomol. 1965, 56, 333–349. [Google Scholar] [CrossRef]
  53. Krueger, S.; Mound, L.A.; Moritz, G.B. Offspring sex ratio and development are determined by copulation activity in Echinothrips americanus Morgan 1913 (Thysanoptera: Thripidae). J. Appl. Entomol. 2016, 140, 462–473. [Google Scholar] [CrossRef]
  54. Xiao-Wei, L.; Xiao-Chen, Z.; Hong-Xue, J.; Ji-Nian, F. Comparisons of developmental and reproductive biology between parthenogenetic and sexual Echinothrips americanus (Thysanoptera: Thripidae). Environ. Entomol. 2016, 41, 706–713. [Google Scholar] [CrossRef]
  55. Marullo, R.; Mercati, F.; Vono, G. DNA Barcoding: A Reliable Method for the Identification of Thrips Species (Thysanoptera, Thripidae) Collected on Sticky Traps in Onion Fields. Insects 2020, 11, 489. [Google Scholar] [CrossRef] [PubMed]
  56. Funderburk, J.; Diffie, S.; Sharma, J.; Hodges, A.; Osborne, L. Thrips of Ornamentals in the Southeastern US; ENY-845 (IN754); Entomology & Nematology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida: Gainesville, FL, USA, 2007. [Google Scholar]
  57. Bradshaw, C.J.; Leroy, B.; Bellard, C.; Roiz, D.; Albert, C.; Fournier, A.; Barbet-Massin, M.; Salles, J.M.; Simard, F.; Courchamp, F. Massive yet grossly underestimated global costs of invasive insects. Nat. Commun. 2016, 7, 1–8. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Bootstrap consensus tree generated using the Neighbour-Joining method and general time reversible (GTR) G + I (gamma + invariant) model showing the genetic differences and relationship among S. rubrocinctus haplotypes obtained by mt-COI sequences. S. rubrocinctus sequences [38,39] available in NCBI are included and Caliothrips indicus was used as an outgroup. Species names and GenBank accession numbers are shown in the figure.
Figure 1. Bootstrap consensus tree generated using the Neighbour-Joining method and general time reversible (GTR) G + I (gamma + invariant) model showing the genetic differences and relationship among S. rubrocinctus haplotypes obtained by mt-COI sequences. S. rubrocinctus sequences [38,39] available in NCBI are included and Caliothrips indicus was used as an outgroup. Species names and GenBank accession numbers are shown in the figure.
Forests 12 01484 g001
Table 1. List of primers used to amplify the cytochrome c oxidase I (COI) region.
Table 1. List of primers used to amplify the cytochrome c oxidase I (COI) region.
Primer NameSequence (5′-3′)SourceReference
LCO-1490 (fw)GGTCAACAAATCATAAAGATATTGGFolmer et al.,1994 [30]
LCO1490puc-t1 (fw)caggaaacagctatgaccTTTCAACWAATCATAAAGATATTGGEPPO, 2016 [31]
LCO1490Hem1-t1 (fw)caggaaacagctatgaccTTTCAACTAAYCATAARGATATYGGEPPO, 2016 [31]
HCO-2198 (rv)TAAACTTCAGGGTGACCAAAAAATCAFolmer et al.,1994 [30]
HCO2198puc-t1 (rv)tgtaaaacgacggccagtTAAACTTCWGGRTGWCCAAARAATCAEPPO, 2016 [31]
HCO2198Hem1-t1 (rv)tgtaaaacgacggccagtTAAACYTCDGGATGBCCAAARAATCAEPPO, 2016 [31]
HCO2198Hem2-t1 (rv)tgtaaaacgacggccagtTAAACYTCAGGATGACCAAAAAAYCAEPPO, 2016 [31]
Table 2. Records of Selenothrips rubrocinctus sampled on 24 June 2019 in Italy (Lombardia). Samples from Trescore Cremasco were collected in 2016.
Table 2. Records of Selenothrips rubrocinctus sampled on 24 June 2019 in Italy (Lombardia). Samples from Trescore Cremasco were collected in 2016.
Sample Nr.LocationLat., Long.Host Plant Material Sampled
5683090Bagnolo Cremasco (1)45°21′39.1″ N 9°36′31.4″ ECarpinus betulus2♀, 1♂, 2 larvae II, 4 larvae I
5683146Bagnolo Cremasco (2)45°21′40.2″ N 9°36′32.2″ ECarpinus betulus4♀, 1♂
5683082Cremosano45°22′49.5″ N 9°39′13.8″ EKoelreuteria paniculata3♀, 2♂, 4 larvae II, 6 larvae I
5683121Crespiatica (1)45°21′37.7″ N 9°34′22.9″ EAcer campestre1♀, 4 larvae I
5683103 *Crespiatica (2)45°21′37.6″ N 9°34′22.4″ ELiquidambar styraciflua7♀, 2 larvae II, 6 larvae I
5683154Pandino45°24′05.3″ N 9°33′34.4″ ELiquidambar styraciflua5♀, 10 larvae I
5683138 *Palazzo Pignano (Scannabue)45°23′13.9″ N 9°35′29.2″ EParrotia persica1♂, 3 larvae I
26082016Trescore Cremasco45°24′06.1″ N 9°37′40.2″ ECarpinus betulus16♀, 5♂, 10 larvae I
* Additionally in 5683103 and 5683138 respectively 2♀ and 1♀ Haplothrips kurdjumovi Karny.
Table 3. Body length, forewing length, and width and length/width ratio of antennal segments in µm of single females of Selenothips rubrocinctus.
Table 3. Body length, forewing length, and width and length/width ratio of antennal segments in µm of single females of Selenothips rubrocinctus.
Origin *Guadeloupe
Neotype
Italy
2019(1)
Italy
2019(2)
Surinam
1960
Surinam
2011
Vietnam
2018
Indonesia
1936
Body length1300151512851457121513751415
Forewing
-length
-medial width

755
49

837
57

800
56

728
55

745
55

746
49

714
51
Antenna (l/w)
I
II
III
IV
V
VI
VII
VIII
24/28–0.9
48/36–1.3
62/26–2.4
73/24–3.0
42/24–1.8
29/22–1.3
17/13–1.3
34/6–5.7
28/31–0.9
53/36–1.5
65/27–2.4
66/26–2.5
41/25–1.6
32/20–1.6
18/11–1.6
31/6–5.24
24/25–1.0
51/33–1.5
58/30–1.9
62/26–2.4
37/26–1.4
27/22–1.2
14/13–1.1
26/6–4.3
21/32–0.7
45/42–1.1
59/29–2.0
65/26–2.5
40/25–1.6
28/23–1.2
15/13–1.2
29/6–4.8
21/24–0.8
46/34–1.4
55/26–2.1
68/25–2.7
42/23–1.8
26/20–1.3
13/13–1.0
24/6–4.0
22/25–0.9
45/36–1.3
60/26–2.3
61/25–2.4
38/25–1.5
29/26–1.1
13/10–1.3
26/6–4.3
22/28–0.8
45/33–1.4
58/27–2.1
63/23–2.7
38/23–1.7
29/19–1.5
11/>8–<1.4
26/>3–<8.7
Total length329334299302295294292
* Guadaloupe, French West Indies, Wilson (1975), others: collection Netherlands Food and Consumer Product Safety Authority. Italy (1), 5683121, Crespatica, 24-vi-2019, Acer campestre, leg. A. Wojnar, det. G. Vierbergen. Italy (2), 5683090, Bagnolo Cremasco, 24-vi-2019, Carpinus, leg. A. Wojnar, det. G. Vierbergen. Surinam, Paramaribo, x-1960, Theobroma cacao, leg. P. van Doesburg, det. W. P. Mantel. Netherlands, 4973723, Schiphol Airport (import Surinam), 1-iv-2011, Codiaeum (cuttings), leg. L. Vriens, det. G. Vierbergen. Vietnam, Hài Phòng, 8-xi-2018, Cleistocalyx operculatus, leg. Vu Hoa, det. G. Vierbergen. Indonesia, Java, Pasar Minggu, i-1936, det. F. André, confirmed H. Priesner. Grey colour to highlight the two italian specimens.
Table 4. Distribution and abundance of S. rubrocinctus haplotypes in relation to host-plant and location. GenBank accession numbers related to the COI sequences of the analysed samples are indicated.
Table 4. Distribution and abundance of S. rubrocinctus haplotypes in relation to host-plant and location. GenBank accession numbers related to the COI sequences of the analysed samples are indicated.
HaplotypeNumber of Samples SequencedHost PlantLocation
Haplotype 11Carpinus betulusBagnolo Cremasco (1)
1Carpinus betulusBagnolo Cremasco (2)
1Koelreuteria paniculataCremosano
1Acer campestre Crespiatica (1)
1Liquidambar styracifluaCrespiatica (2)
1Liquidambar styracifluaPandino
1Parrotia persicaPalazzo Pignano (Scannabue)
12Carpinus betulusTrescore Cremasco
Haplotype 26
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Taddei, A.; Vono, G.; Vierbergen, G.; Wojnar, A.; Zugno, M.; Marullo, R. First Field Record of the Tropical Red-Banded Thrips Selenothrips rubrocinctus (Thripidae: Panchaetothripinae) in Europe. Forests 2021, 12, 1484. https://doi.org/10.3390/f12111484

AMA Style

Taddei A, Vono G, Vierbergen G, Wojnar A, Zugno M, Marullo R. First Field Record of the Tropical Red-Banded Thrips Selenothrips rubrocinctus (Thripidae: Panchaetothripinae) in Europe. Forests. 2021; 12(11):1484. https://doi.org/10.3390/f12111484

Chicago/Turabian Style

Taddei, Andrea, Gregorio Vono, Gijsbertus Vierbergen, Andrea Wojnar, Matteo Zugno, and Rita Marullo. 2021. "First Field Record of the Tropical Red-Banded Thrips Selenothrips rubrocinctus (Thripidae: Panchaetothripinae) in Europe" Forests 12, no. 11: 1484. https://doi.org/10.3390/f12111484

APA Style

Taddei, A., Vono, G., Vierbergen, G., Wojnar, A., Zugno, M., & Marullo, R. (2021). First Field Record of the Tropical Red-Banded Thrips Selenothrips rubrocinctus (Thripidae: Panchaetothripinae) in Europe. Forests, 12(11), 1484. https://doi.org/10.3390/f12111484

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop