Anthocyanin Synthesis and the Expression Patterns of bHLH Transcription Factor Family during Development of the Chinese Jujube Fruit (Ziziphus jujuba Mill.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Extraction and Analyses of Total Anthocyanins
2.3. Total RNA Extraction and cDNA Synthesis
2.4. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis
2.5. Sequence Bioinformatics Analysis
2.6. Analysis of ZjbHLH Gene Expression from RNA-Seq Data
3. Results
3.1. Analysis of Biological Information of the Jujube bHLH Transcription Factor Family
3.2. ZjbHLH Transcription Factor Family Expression Pattern by RNA-Seq Data
3.3. Expression of ZjGL3a, ZjGL3b and ZjTT8 Correlated with Anthocyanin Content
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Huang, J.; Zhang, C.M.; Zhao, X.; Fei, Z.J.; Wan, K.K.; Zhang, Z.; Pang, X.M.; Yin, X.; Bai, Y.; Sun, X.Q.; et al. The Jujube Genome Provides Insights into Genome Evolution and the Domestication of SweetnessAcidity Taste in Fruit Trees. PLoS Genet. 2016, 12, e1006433. [Google Scholar] [CrossRef] [Scilit]
- Gao, Q.H.; Wu, C.S.; Wang, M. The Jujube (Ziziphus jujuba Mill.) Fruit: A Review of Current Knowledge of Fruit Composition and Health Benefits. J. Agric. Food Chem. 2013, 61, 3351–3363. [Google Scholar] [CrossRef] [Scilit]
- Wojdylo, A.; Carbonell-Barrachina, A.A.; Legua, P.; Hernandez, F. Phenolic composition, ascorbic acid content, and antioxidant capacity of Spanish jujube (Ziziphus jujuba Mill.) fruits. Food Chem. 2016, 201, 307–314. [Google Scholar] [CrossRef] [Scilit]
- Petroni, K.; Tonelli, C. Recent advances on the regulation of anthocyanin synthesis in reproductive organs. Plant Sci. Int. J. Exp. Plant Biol. 2011, 181, 219–229. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Dubos, C.; Lepiniec, L. Transcriptional control of flavonoid biosynthesis by MYB-bHLH-WDR complexes. Trends Plant Sci. 2015, 20, 176–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, P.C.M.; Rould, M.A.; Weintraub, H.; Pabo, C.O. Crystal structure of MyoD bHLH domain-DNA complex Perspectives on DNA recognition and implications for transcriptional activation. Cell 1994, 77, 451–459. [Google Scholar] [CrossRef] [Scilit]
- Abe, H.; Yamaguchi-Shinozaki, K.; Urao, T.; Iwasaki, T.; Hosokawa, D.; Shinozaki, K. Role of arabidopsis MYC and MYB homologs in drought and abscisic acid-regulated gene expression. Plant Cell 1997, 9, 1859–1868. [Google Scholar] [PubMed]
- Chinnusamy, V.; Ohta, M.; Kanrar, S.; Lee, B.H.; Hong, X.; Agarwal, M.; Zhu, J.K. ICE1: A regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev. 2003, 17, 1043–1054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Y.; Deyholos, M.K. Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes. BMC Plant Biol. 2006, 6, 25. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Yang, W.; Jia, Q.; Wang, W.; Zhang, N.; Wang, X.; Wang, S. Pleurotus ostreatus bHLH transcription factors regulate plant growth and development when expressed in Arabidopsis. J. Plant Interact. 2017, 12, 542–549. [Google Scholar] [CrossRef] [Scilit]
- Makkena, S.; Lamb, R.S. The bHLH transcription factor SPATULA is a key regulator of organ size in Arabidopsis thaliana. Plant Signal Behav. 2013, 8, e24140. [Google Scholar] [CrossRef] [Scilit]
- Hyun, Y.; Lee, I. KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 2006, 61, 283–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elomaa, P.; Mehto, M.; Kotilainen, M.; Helariutta, Y.; Nevalainen, L.; Teeri, T.H. A bHLH transcription factor mediates organ, region and flower type specific signals on dihydroflavonol-4-reductase (dfr) gene expression in the inflorescence of Gerbera hybrida (Asteraceae). Plant J. 1998, 16, 93–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Escaray, F.J.; Passeri, V.; Perea-Garcia, A.; Antonelli, C.J.; Damiani, F.; Ruiz, O.A.; Paolocci, F. The R2R3-MYB TT2b and the bHLH TT8 genes are the major regulators of proanthocyanidin biosynthesis in the leaves of Lotus species. Planta 2017, 246, 243–261. [Google Scholar] [CrossRef] [Scilit]
- Patra, B.; Pattanaik, S.; Schluttenhofer, C.; Yuan, L. A network of jasmonate-responsive bHLH factors modulate monoterpenoid indole alkaloid biosynthesis in Catharanthus roseus. New Phytol. 2018, 217, 1566–1581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nemesio-Gorriz, M.; Blair, P.B.; Dalman, K.; Hammerbacher, A.; Arnerup, J.; Stenlid, J.; Mukhtar, S.M.; Elfstrand, M. Identification of Norway Spruce MYB-bHLH-WDR Transcription Factor Complex Members Linked to Regulation of the Flavonoid Pathway. Front. Plant Sci. 2017, 8, 305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ludwig, S.R.; Habera, L.F.; Dellaporta, S.L.; Wessler, S.R. Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region. Proc. Natl. Acad. Sci. USA 1989, 86, 7092–7096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bailey, P.C.; Martin, C.; Toledo-Ortiz, G.; Quail, P.H.; Huq, E.; Heim, M.A.; Jakoby, M.; Werber, M.; Weisshaar, B. Update on the basic helix-loop-helix transcription factor gene family in Arabidopsis thaliana. Plant Cell 2003, 15, 2497–2502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rushton, P.J.; Bokowiec, M.T.; Han, S.; Zhang, H.; Brannock, J.F.; Chen, X.; Laudeman, T.W.; Timko, M.P. Tobacco transcription factors: Novel insights into transcriptional regulation in the Solanaceae. Plant Physiol. 2008, 147, 280–295. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Duan, X.; Jiang, H.; Sun, Y.; Tang, Y.; Yuan, Z.; Guo, J.; Liang, W.; Chen, L.; Yin, J.; et al. Genome-wide analysis of basic/helix-loop-helix transcription factor family in rice and Arabidopsis. Plant Physiol. 2006, 141, 1167–1184. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.; Fan, H.J.; Ling, H.Q. Genome-wide identification and characterization of the bHLH gene family in tomato. BMC Genom. 2015, 16, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feller, A.; Machemer, K.; Braun, E.L.; Grotewold, E. Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J. 2011, 66, 94–116. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Qiu, J.; Ding, L.; Huang, M.; Huang, S.; Yang, G.; Yin, J. Anthocyanin biosynthesis regulation of DhMYB2 and DhbHLH1 in Dendrobium hybrids petals. Plant Physiol. Biochem. 2017, 112, 335–345. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Wang, N.; Liu, J.; Qu, C.; Wang, Y.; Jiang, S.; Lu, N.; Wang, D.; Zhang, Z.; Chen, X. The molecular mechanism underlying anthocyanin metabolism in apple using the MdMYB16 and MdbHLH33 genes. Plant Mol. Biol. 2017, 94, 149–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez, A.; Zhao, M.; Leavitt, J.M.; Lloyd, A.M. Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J. 2008, 53, 814–827. [Google Scholar] [CrossRef] [Scilit]
- Xie, X.B.; Li, S.; Zhang, R.F.; Zhao, J.; Chen, Y.C.; Zhao, Q.; Yao, Y.X.; You, C.X.; Zhang, X.S.; Hao, Y.J. The bHLH transcription factor MdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples. Plant Cell Environ. 2012, 35, 1884–1897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, T.; Song, S.; Ren, Q.; Wu, D.; Huang, H.; Chen, Y.; Fan, M.; Peng, W.; Ren, C.; Xie, D. The Jasmonate-ZIM-domain proteins interact with the WD-Repeat/bHLH/MYB complexes to regulate Jasmonate-mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell 2011, 23, 1795–1814. [Google Scholar] [CrossRef] [Scilit]
- Nakatsuka, T.; Haruta, K.S.; Pitaksutheepong, C.; Abe, Y.; Kakizaki, Y.; Yamamoto, K.; Shimada, N.; Yamamura, S.; Nishihara, M. Identification and characterization of R2R3-MYB and bHLH transcription factors regulating anthocyanin biosynthesis in gentian flowers. Plant Cell Physiol. 2008, 49, 1818–1829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, Q.; Zhang, Z.; Su, J.; Zhou, J.; Li, X. Comparative Analysis of Pigments, Phenolics, and Antioxidant Activity of Chinese Jujube (Ziziphus jujuba Mill.) during Fruit Development. Molecules 2018, 23, 1917. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Huang, J.; Li, X. Identification of appropriate reference genes for RT-qPCR analysis in Ziziphus jujuba Mill. Sci. Hortic. 2015, 197, 166–169. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Xie, T.; Chen, C.; Luan, A.; Long, J.; Li, C.; Ding, Y.; He, Y. Genome-wide organization and expression profiling of the R2R3-MYB transcription factor family in pineapple (Ananas comosus). BMC Genom. 2017, 18, 503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heim, M.A.; Jakoby, M.; Werber, M.; Martin, C.; Weisshaar, B.; Bailey, P.C. The basic helix-loop-helix transcription factor family in plants: A genome-wide study of protein structure and functional diversity. Mol. Biol. Evol. 2003, 20, 735–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimada, S.; Otsuki, H.; Sakuta, M. Transcriptional control of anthocyanin biosynthetic genes in the Caryophyllales. J. Exp. Bot. 2007, 58, 957–967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atchley, W.R.; Fitch, W.M. A natural classification of the basic helix-loop-helix class of transcription factors. Proc. Natl. Acad. Sci. USA 1997, 94, 5172–5176. [Google Scholar] [CrossRef] [Scilit]
- Starkevic, P.; Paukstyte, J.; Kazanaviciute, V.; Denkovskiene, E.; Stanys, V.; Bendokas, V.; Siksnianas, T.; Razanskiene, A.; Razanskas, R. Expression and Anthocyanin Biosynthesis-Modulating Potential of Sweet Cherry (Prunus avium L.) MYB10 and bHLH Genes. PLoS ONE 2015, 10, e0126991. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Feng, R.; Ma, R.; Shen, Z.; Cai, Z.; Song, Z.; Peng, B.; Yu, M. Genome-wide analysis of basic helix-loop-helix superfamily members in peach. PLoS ONE 2018, 13, e0195974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mao, K.; Dong, Q.; Li, C.; Liu, C.; Ma, F. Genome Wide Identification and Characterization of Apple bHLH Transcription Factors and Expression Analysis in Response to Drought and Salt Stress. Front. Plant Sci. 2017, 8, 480. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Zhao, P.; Kong, N.; Lu, R.; Pei, Y.; Huang, C.; Ma, H.; Chen, Q. Genome-Wide Identification and Characterization of the Potato bHLH Transcription Factor Family. Genes 2018, 9, 54. [Google Scholar] [CrossRef] [Scilit]
- Laurence, G.; Agnès, L.; Sandra, M.; Damien, L.; Marion, V.; Ton, T.; Pascal, G. MtbHLH1, a bHLH transcription factor involved in Medicago truncatula nodule vascular patterning and nodule to plant metabolic exchanges. New Phytol. 2011, 191, 391–404. [Google Scholar]
- Hao, Y.; Oh, E.; Choi, G.; Liang, Z.; Wang, Z. Interactions between HLH and bHLH Factors Modulate Light-Regulated Plant Development. Mol. Plant 2012, 5, 688–697. [Google Scholar] [CrossRef] [Scilit]
- Koini, M.A.; Alvey, L.; Allen, T.; Tilley, C.A.; Harberd, N.P.; Whitelam, G.C.; Franklin, K.A. High Temperature-Mediated Adaptations in Plant Architecture Require the bHLH Transcription Factor PIF4. Curr. Biol. CB 2009, 19, 408–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gabriela, T.O.; Enamul, H.; Quail, P.H. The Arabidopsis basic/helix-loop-helix transcription factor family. Plant Cell 2003, 15, 1749–1770. [Google Scholar]
- Liu, X.-F.; Yin, X.-R.; Allan, A.C.; Lin-Wang, K.; Shi, Y.-N.; Huang, Y.-J.; Ferguson, I.B.; Xu, C.-J.; Chen, K.-S. The role of MrbHLH1 and MrMYB1 in regulating anthocyanin biosynthetic genes in tobacco and Chinese bayberry (Myrica rubra) during anthocyanin biosynthesis. Plant Cell Tissue Organ Cult. PCTOC 2013, 115, 285–298. [Google Scholar] [CrossRef] [Scilit]
- Takos, A.M.; Jaffe, F.W.; Jacob, S.R.; Bogs, J.; Robinson, S.P.; Walker, A.R. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol. 2006, 142, 1216–1232. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Xu, Y.; Zhang, S.; Cao, L.; Huang, Y.; Cheng, J.; Wu, G.; Tian, S.; Chen, C.; Liu, Y.; et al. Genomic analyses of primitive, wild and cultivated citrus provide insights into asexual reproduction. Nat. Genet. 2017, 49, 765–772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castellarin, S.D.; Pfeiffer, A.; Sivilotti, P.; Degan, M.; Peterlunger, E.; Di Gaspero, G. Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit. Plant Cell Environ. 2007, 30, 1381–1399. [Google Scholar] [CrossRef] [Scilit]
- Gagné, S.; Cluzet, S.; Mérillon, J.-M.; Gény, L. ABA Initiates Anthocyanin Production in Grape Cell Cultures. J. Plant Growth Regul. 2010, 30, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Hara, M.; Oki, K.; Hoshino, K.; Kuboi, T. Enhancement of anthocyanin biosynthesis by sugar in radish (Raphanus sativus) hypocotyl. Plant Sci. 2003, 164, 259–265. [Google Scholar] [CrossRef] [Scilit]
- Do, C.B.; Cormier, F. Effects of low nitrate and high sugar concentrations on anthocyanin content and composition of grape (Vitis vinifera L.) cell suspension. Plant Cell Rep. 1991, 9, 500–504. [Google Scholar]
- Sperdouli, I.; Moustakas, M. Interaction of proline, sugars, and anthocyanins during photosynthetic acclimation of Arabidopsis thaliana to drought stress. J. Plant Physiol. 2012, 169, 577–585. [Google Scholar] [CrossRef] [Scilit]
- Holcroft, D.M.; Kader, A.A. Controlled atmosphere-induced changes in pH and organic acid metabolism may affect colour stored strawberry fruit. Postharvest Biol. Technol. 1999, 17, 19–32. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Dixon, R.A. The ‘ins’ and ‘outs’ of flavonoid transport. Trends Plant Sci. 2010, 15, 72–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poustka, F.; Irani, N.G.; Feller, A.; Lu, Y.; Pourcel, L.; Frame, K.; Grotewold, E. A trafficking pathway for anthocyanins overlaps with the endoplasmic reticulum-to-vacuole protein-sorting route in Arabidopsis and contributes to the formation of vacuolar inclusions. Plant Physiol. 2007, 145, 1323–1335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomez, C.; Conejero, G.; Torregrosa, L.; Cheynier, V.; Terrier, N.; Ageorges, A. In vivo grapevine anthocyanin transport involves vesicle-mediated trafficking and the contribution of anthoMATE transporters and GST. Plant J. 2011, 67, 960–970. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene Name | F (Primer Sequence (5′-3′)) | R (Primer Sequence (5′-3′)) | Length (bp) |
|---|---|---|---|
| ZjGL3a | GCATTCTGCTGCATTGTCTC | CCCCTTTTTGCCTTTATTTT | 194 |
| ZjGL3b | CAGCCACACCCAACCACTA | CACCACACCTCCCAGAAAG | 279 |
| ZjTT8 | ATCATCACACCCGCACAGAA | CCCAACCAAAAGAGAACCCA | 114 |
| ZjUBQ | TGGATGATTCTGGCAAAG | GTAATGGCGGTCAAAGTG | 98 |
| ZjUBQ2 | CACCCGTTACTTGCTTTC | CTCTTCCCATTGTCCTCC | 93 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, Q.; Li, X.; Du, J.; Li, X. Anthocyanin Synthesis and the Expression Patterns of bHLH Transcription Factor Family during Development of the Chinese Jujube Fruit (Ziziphus jujuba Mill.). Forests 2019, 10, 346. https://doi.org/10.3390/f10040346
Shi Q, Li X, Du J, Li X. Anthocyanin Synthesis and the Expression Patterns of bHLH Transcription Factor Family during Development of the Chinese Jujube Fruit (Ziziphus jujuba Mill.). Forests. 2019; 10(4):346. https://doi.org/10.3390/f10040346
Chicago/Turabian StyleShi, Qianqian, Xi Li, Jiangtao Du, and Xingang Li. 2019. "Anthocyanin Synthesis and the Expression Patterns of bHLH Transcription Factor Family during Development of the Chinese Jujube Fruit (Ziziphus jujuba Mill.)" Forests 10, no. 4: 346. https://doi.org/10.3390/f10040346
APA StyleShi, Q., Li, X., Du, J., & Li, X. (2019). Anthocyanin Synthesis and the Expression Patterns of bHLH Transcription Factor Family during Development of the Chinese Jujube Fruit (Ziziphus jujuba Mill.). Forests, 10(4), 346. https://doi.org/10.3390/f10040346
