Antibiogram Screening and Detection of Virulence-Associated Genes in Brucella Species Acquired from Cattle in South Africa’s Eastern Cape Province
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics and Sample Collection
2.2. Bacterial Isolation
2.3. DNA Extraction and Confirmation Bru Gene (Brucella Species)
2.4. Antibiotic Susceptibility
2.4.1. Antibiotic Susceptibility Testing
2.4.2. Multiple Antibiotic Resistance
2.5. Molecular Detection of Putative Genes of Brucella
3. Results
3.1. Bacterial Isolate Confirmation Using Polymerase Chain Reaction
3.2. Antibiogram Profile
3.3. The Phenotype of Multiple Antibiotic Resistance (MAR) and MAR Indices (MARI)
3.4. Frequency of Putative Genotypes in B. melitensis and B. abortus Isolates
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hamdy, M.E.R.; Zaki, H.M. Detection of virulence-associated genes in Brucella melitensis biovar 3, the prevalent field strain in different animal species in Egypt. Open Vet. J. 2018, 8, 112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McDermott, J.; Grace, D.; Zinsstag, J. Economics of brucellosis impact and control in low-income countries. Rev. Sci. Tech. 2013, 32, 249–261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schrire, L. Human brucellosis in South Africa. S. Afr. Med. J. 1962, 36, 342–348. [Google Scholar] [PubMed]
- Ducrotoy, M.; Bertu, W.J.; Matope, G.; Cadmus, S.; Conde-Álvarez, R.; Gusi, A.M.; Welburn, S.; Ocholi, R.; Blasco, J.M.; Moriyón, I. Brucellosis in Sub-Saharan Africa: Current challenges for management, diagnosis and control. Acta Trop. 2015, 165, 179–193. [Google Scholar] [CrossRef]
- Department of Agriculture, Forestry and Fisheries (DAFF). Brucella abortus Outbreaks in Animals from January 2015 to May 2018 across All Nine Provinces of South Africa. Image Courtesy of the Sub-Directorate; Epidemiology of Directorate Animal Health: Pretoria, South Africa, 2018. [Google Scholar]
- McDermotta, J.; Arimi, S.M. Brucellosis in sub-Saharan Africa: Epidemiology, control and impact author links open overlay. Vet. Microbiol. 2002, 90, 111–134. [Google Scholar] [CrossRef]
- Earth.org. South Africa Is Seeing a Brucellosis Outbreak in Cows, with over 400 Infected. Available online: https://earth.org/south-africa-is-seeing-a-brucellosis-outbreak-in-cows-with-over-400-infected/ (accessed on 30 June 2021).
- Amabile-Cueva, C.F. Antibiotics and Antibiotics Resistance in the Environment, 1st ed.; Taylor and Francis Group, CRC Press: London, UK, 2016. [Google Scholar] [CrossRef]
- Turkmani, A.; Ioannidis, A.; Christidou, A. In vitro susceptibilities of Brucella melitensis isolates to eleven antibiotics. Ann. Clin. Microbiol. Antimicrob. 2006, 5, 24. [Google Scholar] [CrossRef] [Green Version]
- Pappas, G.; Akritidis, N.; Bosilkovski, M.; Tsianos, E. Brucellosis. NEJM 2005, 352, 2325–2336. [Google Scholar] [CrossRef]
- Hall, W.H. Modern chemotherapy for brucellosis in humans. Rev. Infect. Dis. 1990, 12, 1060–1099. [Google Scholar] [CrossRef]
- Baykam, N.; Esener, H.; Ergönül, O.; Eren, S.; Celikbas, A.K.; Dokuzoguz, B. In vitro antimicrobial susceptibility of Brucella species. Int. J. Antimicrob. Agents 2004, 23, 405–407. [Google Scholar] [CrossRef]
- Pozo, J.S.G.; Solera, J. Treatment of human brucellosis-review of evidence from clinical trials. In Updates on Brucellosis; InTech.Open: London, UK, 2015. [Google Scholar]
- Sabry, N.A.; Farid, S.F.; Dawoud, D.M. Antibiotic dispensing in Egyptian community pharmacies: An observational study. Res. Soc. Adm. Pharm. 2014, 10, 168–184. [Google Scholar] [CrossRef]
- World Health Organization; Regional Oce for the Eastern Mediterranean. Report on the Consultative Meeting on Antimicrobial Resistance for Countries in the Eastern Mediterranean Region: From Policies to Action; World Health Organization, Regional Oce for the Eastern Mediterranean: Sharm el Sheikh, Egypt, 2013. [Google Scholar]
- Abdulah, R. Antibiotic abuse in developing countries. Pharm. Regul. A 2012, 1, 1000e106. [Google Scholar] [CrossRef] [Green Version]
- Kasim, K.; Hassan, H. Self-medication problem in Egypt: A review of current and future perspective. Int. J. Curr. Res. Rev. 2018, 10, 6. [Google Scholar]
- Gebeyehu, E.; Bantie, L.; Azage, M. Inappropriate use of antibiotics and its associated factors among urban and rural communities of bahir dar city administration, northwest ethiopia. PLoS ONE 2015, 10, e0138179. [Google Scholar] [CrossRef]
- Landers, T.F.; Cohen, B.; Wittum, T.E.; Larson, E.L. A review of antibiotic use in food animals: Perspective, policy, and potential. Public Health Rep. 2012, 127, 4–22. [Google Scholar] [CrossRef] [Green Version]
- Agunos, A.; Pierson, F.W.; Lungu, B.; Dunn, P.A.; Tablante, N. Review of nonfoodborne zoonotic and potentially zoonotic poultry diseases. Avian. Dis. 2016, 60, 553–575. [Google Scholar] [CrossRef] [Green Version]
- Godfroid, F.; Cloeckaert, A.; Taminiau, B.; Danese, I.; Tibor, A.; De Bolle, X.; Mertens, P.; Letesson, J.J. Genetic organisation of the lipopolysaccharide O-antigen biosynthesis region of Brucella melitensis 16M (wbk). Res. Microbiol. 2000, 51, 655–668. [Google Scholar] [CrossRef]
- Foster, G.; Osterman, B.S.; Godfroid, J.; Jacques, I.; Cloeckaert, A. Brucella ceti sp. nov. and Brucella pinnipedialis sp. nov. for Brucella strains with cetaceans and seals as their preferred hosts. Int. J. Syst. Evol. Microbiol. 2007, 57 Pt 11, 2688–2693. [Google Scholar] [CrossRef] [Green Version]
- Al Dahouk, S.; Tomaso, H.; Nöckler, K.; Neubauer, H.; Frangoulidis, D. Laboratory based diagnosis of brucellosis—a review of the literature. Part1: Techniques for direct detection and identification of Brucella spp. Clin. Lab. 2003, 49, 487–505. [Google Scholar]
- Scholz, H.C.; Hubalek, Z.; Sedlacek, I.; Vergnaud, G.; Tomaso, H.; Al Dahouk, S.; Nockler, K. Brucella microti sp. nov., isolated from the common vole Microtus arvalis. Int. J. Syst. Evol. 2008, 58 Pt 2, 375–382. [Google Scholar] [CrossRef] [Green Version]
- World Organisation for Animal Health (OIE). Manual of Standards for Diagnostic Tests and Vaccines. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals; Office International des Epizooties: Paris, France, 2009.
- Rhyan, J.C.; Gidlewski, T.; Roffe, T.J.; Aune, K.; Philo, L.M.; Ewalt, D.R. Pathology of brucellosis in bison from Yellowstone National Park. J. Wildl. Dis. 2001, 37, 101–109. [Google Scholar] [CrossRef] [Green Version]
- Bentley, S.; Sebaihia, M.; Thomson, N.; Holden, M.; Crossman, L.; Bell, K.; Cerdeño-Tarraga, A.; Parkhill, J. Bacterial Human Pathogen Genomes: An Overview. In Cellular Microbiology, 2nd ed.; Cossart, P., Boquet, P., Normark, S., Rappuoli, R., Eds.; ASM Press: Washington, DC, USA, 2005; pp. 35–59. [Google Scholar] [CrossRef]
- Cossart, P.; Pizarro-Cerda, J.; Lecuit, M. Emerging Infectious Diseases, Microbial Pathogens: An Overview. In Cellular Microbiology, 2nd ed.; Cossart, P., Boquet, P., Normark, S., Rappuoli, R., Eds.; ASN Press: Washington, DC, USA, 2005; Volume 11, p. 1330. [Google Scholar] [CrossRef]
- Lamontagne, J.; Butler, H.; Chaves-Olarte, E.; Hunter, J. Extensive cell envelope modulation is associated with virulence in Brucella abortus. J. Proteome Res. 2007, 6, 1519–1529. [Google Scholar] [CrossRef] [PubMed]
- He, Y. Analyses of Brucella pathogenesis, host immunity, and vaccine targets using systems biology and bioinformatics. Front. Cell. Infect. Microbiol. 2012, 2, 1–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, R.A.; Eade, C.R.; Wiedmann, M. Embracing diversity: Differences in virulence mechanisms, disease severity, and host adaptations contribute to the success of Nontyphoidal salmonella as a foodborne pathogen. Front. Microbiol. 2019, 10, 1368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seleem, M.N.; Boyle, S.M.; Sriranganathan, N. Brucella: A pathogen without classic virulence genes. Vet. Microbiol. 2008, 129, 1–14. [Google Scholar] [CrossRef]
- Cascales, E.; Christie, P.J. The versatile bacterial type IV secretion systems. Nat. Rev. Microbiol. 2003, 1, 137–149. [Google Scholar] [CrossRef] [Green Version]
- Den Hartigh, A.B.; Sun, Y.H.; Sondervan, D.; Heuvelmans, N.; Reinders, M.O.; Ficht, T.A.; Tsolis, R.M. Differential requirements for VirB1 and VirB2 during Brucella abortus infection. Infect. Immun. 2004, 72, 5143–5149. [Google Scholar] [CrossRef] [Green Version]
- Myeni, S.; Child, R.; Ng, T.W.; Kupko, J.J., III; Wehrly, T.D.; Porcella, S.F. Brucella modulates secretory trafficking via multipletype IV secretion effector proteins. PLoS Pathog. 2013, 9, e1003556. [Google Scholar] [CrossRef] [Green Version]
- Spera, J.M.; Ugalde, J.E.; Mucci, J.; Comerci, D.J.; Ugalde, R.A. A B lymphocyte mitogen is a Brucella abortus virulence factor required for persistent infection. Proc. Natl. Acad. Sci. USA 2006, 103, 16514–16519. [Google Scholar] [CrossRef] [Green Version]
- Office International des Épizooties (OIE). Manual of Diagnostic Tests and Vaccines (Mammals, Birds and Bees), 6th ed.; Office International des Épizooties: Paris, France, 2008; Volume 2, p. 66.
- Alton, G.G.; Angus, R.D.; Verger, J.M. Diagnosis of bovine brucellosis: Principles, practice and problems. Surveillance 1989, 16, 3–6. [Google Scholar]
- Carmichael, L.E. Vaccination. In Animal Brucellosis; Nielsen, K., Duncan, J.R., Eds.; CRC: Boca Raton, FL, USA, 1990; pp. 335–350. [Google Scholar]
- Khamesipour, F.; Doosti, A.; Taheri, H. Molecular detection of Brucella spp. in the semen, testis and blood samples of cattle and sheep. J. Pure Appl. Microbiol. 2013, 7, 495–500. [Google Scholar]
- Mohamed, A.G.; Ramadan, K.M.; Monem, H.A.; Toukhy Essam, E.L.; Khairy, E.A. Amos PCR as a rapid screening method for differentiation of infected and vaccinated cattle and sheep with brucellosis. Glob. Vet. 2013, 11, 748–756. [Google Scholar]
- Bauer, A.W.; Kirby, W.M.M.; Sheris, J.C.; Truck, M. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 1966, 145, 225–230. [Google Scholar] [CrossRef] [Green Version]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Information Supplement; Clinical and Laboratory Standards Institute: Wayne, NJ, USA, 2014; M100/S24. [Google Scholar]
- Ateba, C.N.; Mbewe, M.; Bezuidenhout, C.C. The Prevalence of Escherichia coli O157 strains in cattle, pigs and humans in the North-West Province, South Africa. S. Afr. J. Sci. 2008, 104, 7–8. [Google Scholar]
- Krumperman, P.H. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl. Environ. Microbiol. 1983, 46, 165–170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osundiya, O.O.; Oladele, R.O.; Oduyebo, O.O. Multiple antibiotic resistance (MAR) indices of Pseudomonas and Klebsiella species isolates in Lagos University Teaching Hospital. Afr. J. Clin. Exp. Microbiol. 2013, 14, 164–168. [Google Scholar] [CrossRef] [Green Version]
- Hashemifar, I.; Yadegar, A.; Jazi, F.M.; Amirmozafari, N. Molecular prevalence of putative virulence-associated genes in Brucella melitensis and Brucella abortus isolates from human and livestock specimens in Iran. Microb. Pathog. 2017, 105, 334–339. [Google Scholar] [CrossRef]
- Saeedzadeh, A.; Sharifiyazdi, H.; Firouzi, R. Molecular characterization of Brucella melitensis Rev.1 strain in aborted sheep and goats in Iran. Comp. Clin. Pathol. 2013, 22, 409–412. [Google Scholar] [CrossRef]
- Moreno, E.; Moriyón, I. Brucella melitensis: A nasty bug with hidden credentials for virulence. Proc. Natl. Acad. Sci. USA 2002, 99, 1–3. [Google Scholar] [CrossRef] [Green Version]
- Ugalde, J.E.; Comerci, D.J.; Leguizamón, M.S.; Ugalde, R.A. Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new live rough-phenotype vaccine. Infect. Immun. 2003, 71, 6264–6269. [Google Scholar] [CrossRef] [Green Version]
- Imaoka, K.; Kimura, M.; Suzuki, M.; Kamiyana, T.; Yamanda, A. Simultaneous detection of the genus Brucella by combinatorial PRC. Jpn. J. Infect. Dis. 2007, 60, 137–139. [Google Scholar]
- Starr, T.; Wehrly, T. Brucella Intracellular Replication Requires Trafficking through the Late Endosomal/Lysosomal Compartment. Traffic 2008, 9, 678–694. [Google Scholar] [CrossRef] [PubMed]
- Xavier, M.N.; Paixao, T.A.; Hartigh, A.B.D.; Tsolis, R.M.; Santos, R.L. Pathogenesis of Brucellosis. Open Vet. Sci. J. 2010, 4, 109–118. [Google Scholar] [CrossRef]
- Brambila-Tapia, A.J.L.; Armenta-Medina, D.; Rivera-Gomez, N.; Perez-Rueda, E. Main functions and taxonomic distribution of virulence genes in Brucella melitensis 16 M. PLoS ONE 2014, 9, e100349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herrou, J.; Willett, J.W.; Fiebig, A.; Czyż, D.M.; Cheng, J.X.; Ultee, E.; Briegel, A.; Bigelow, L.; Babnigg, G.; Kim, Y.; et al. Brucella periplasmic protein EipB is a molecular determinant of cell envelope integrity and virulence. J. Bacteriol. 2019, 201, e00134-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Awwad, E.; Adwan, K.; Farraj, M.; Essawi, T.; Rumi, I.; Manasra, A.; Danes, D. Cell envelope virulence genes among field strains of Brucella melitensis isolated in West Bank part of Palestine. Agric. Agric. Sci. Procedia 2015, 6, 281–286. [Google Scholar] [CrossRef] [Green Version]
- Neta, A.V.C.; Mol, J.P.S.; Xavier, M.N.; Paixão, T.A.; Lage, A.P.; Santos, R.L. Pathogenesis of bovine brucellosis. Vet. J. 2010, 184, 146–155. [Google Scholar] [CrossRef] [PubMed]
- Pua, Y.; Keb, Y.; Bai, F. Active efflux in dormant bacterial cells–New insights into antibiotic persistence. Drug Resist. Updates 2017, 30, 7–14. [Google Scholar] [CrossRef]
- Maves, R.C.; Castillo, R.; Guillen, A.; Espinosa, B.; Meza, R.; Espinoza, N.; Núñez, G.; Sánchez, L.; Chacaltana, J.; Cepeda, D.; et al. Antimicrobial susceptibility of Brucella melitensis isolates in Peru. Antimicrob. Agents Chemother. 2011, 55, 1279–1281. [Google Scholar] [CrossRef] [Green Version]
- Abdel-Maksoud, M.; House, B.; Wasfy, M.; Abdel-Rahman, B.; Pimentel, G.; Roushdy, G.; Dueger, E. In vitro antibiotic susceptibility testing of Brucella isolates from Egypt between 1999 and 2007 and evidence of probable rifampin resistance. Ann. Clin. Microbiol. Antimicrob. 2012, 11, 24. [Google Scholar] [CrossRef] [Green Version]
- Ghodasara, S.N.; Roy, A.; Bhanderi, B.B. In vitro antibiotic sensitivity pattern of Brucella spp. isolated from reproductive disorders of animals. Buffalo Bull. 2011, 30, 188–194. [Google Scholar]
- Adzitey, F.; Rusul, G.; Huda, N.; Cogan, T.; Corry, J. Prevalence, antibiotic resistance and RAPD typing of Campylobacter species isolated from ducks, their rearing and processing environments in Penang, Malaysia. Int. J. Food. Microbiol. 2012, 154, 197–205. [Google Scholar] [CrossRef] [PubMed]
- Razzaq, M.S.; Alsaadi, M.A.; Al-yassari, A. Molecular Study of virulence genes of Brucella isolated from human clinical cases in Babylon Province. JUBPAS 2014, 22, 1531–1544. [Google Scholar]
- Taguchi, Y.; Imaoka, K.; Kataoka, M.; Uda, A.; Nakatsu, D.; Horii-Okazaki, S.; Kunishige, R.; Kano, F.; Murata, M. Yip1A, a novel host factor for the activation of the IRE1 pathway of the unfolded protein response during Brucella infection. PLoS Pathog. 2015, 11, e1004747. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Li, M.; Li, Z.Q.; Shi, J.X.; Zhang, Y.; Deng, X.M.; Liu, L.B.; Wang, Z.; Qi, Y.Y.; Zhang, H. Deletion of the Type IV Secretion System Effector VceA Promotes Autophagy and Inhibits Apoptosis in Brucella-Infected Human Trophoblast Cells. Curr. Microbiol. 2019, 76, 510–519. [Google Scholar] [CrossRef]
- Derakhshandeh, A.; Firouzi, R.; Goudarztalejerd, A. Detection of virulence genes (bvfA, virB and ure) in Brucella melitensis isolated from aborted fetuses of sheep and goats. Iran. J. Microbiol. 2013, 5, 402–405. [Google Scholar]
- Salcedo, S.P.; Marchesini, M.I.; Degos, C.; Terwagne, M.; Von Bargen, K.; Lepidi, H.; Herrmann, C.K.; Santos Lacerda, T.L.; Imbert, P.R.C.; Pierre, P.; et al. BtpB, a novel Brucella TIR-containing effector protein with immune modulatory functions. Front. Cell. Infect. Microbiol. 2013, 3, 28. [Google Scholar] [CrossRef] [Green Version]
- Radhakrishnan, G.K.; Harms, J.S.; Splitter, G.A. Modulation of microtubule dynamics by a TIR domain protein from the intracellular pathogen Brucella melitensis. Biochem. J. 2011, 439, 79–83. [Google Scholar] [CrossRef] [Green Version]
- Felix, C.; Türköz, B.K.; Ranaldi, S.; Koelblen, T.; Terradot, L.; O’Callaghan, D.; Vergunst, A.C. The Brucella TIR domain containing proteins BtpA and BtpB have a structural WxxxE motif important for protection against microtubule depolymerisation. Cell Commun. Signal 2014, 12, 53. [Google Scholar] [CrossRef] [Green Version]
- Khan, A.U.; Shell, W.S.; Melzer, F.; Sayour, A.E.; Ramadan, E.S.; Elschner, M.C.; Moawad, A.A.; Roesler, U.; Neubauer, H.; El-Adawy, H. Identification, genotyping and antimicrobial susceptibility testing of Brucella spp. isolated from livestock in Egypt. Microorganisms 2019, 7, 603. [Google Scholar] [CrossRef] [Green Version]
- Gheibi, A.; Khanahmad, H.; Kashfi, K.; Sarmadi, M.; Khorramizadeh, M.R. Development of new generation of vaccines for Brucella abortus. Heliyon 2018, 4, e01079. [Google Scholar] [CrossRef] [Green Version]
- Almiron, M.; Martinez, M.; Sanjuan, N.; Ugalde, R.A. Ferrochelatase is present in Brucella abortus and is critical for its intracellular survival and virulence. Infect. Immun. 2001, 69, 6225–6230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alcantara, R.B.; Read, R.D.; Valderas, M.W.; Brown, T.D.; Roop, R.M. Intact purine biosynthesis pathways are required for wild-type virulence of Brucella abortus 2308 in the BALB/c mouse model. Infect. Immun. 2004, 72, 4911–4917. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferguson, G.P.; Datta, A.; Baumgartner, J.; Roop, R.M.; Carlson, R.W.; Walker, G.C. Similarity to peroxisomal-membrane protein family reveals that Sinorhizobium and Brucella BacA affect lipid-A fatty acids. Proc. Natl. Acad. Sci. USA 2004, 101, 5012–5017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trant, C.G.; Lacerda, T.L.; Carvalho, N.B.; Azevedo, V.; Rosinha, G.M.; Salcedo, S.P.; Gorvel, J.P.; Oliveira, S.C. The Brucella abortus phosphoglycerate kinase mutant is highly attenuated and induces protection superior to that of vaccine strain 19 in immunocompromised and immunocompetent mice. Infect. Immun. 2010, 78, 2283–2291. [Google Scholar] [CrossRef] [Green Version]
- Conde-Alvarez, R.; Arce-Gorvel, V.; Gil-Ramirez, Y.; Iriarte, M.; Grillo, M.J.; Gorvel, J.P.; Moriyon, I. Lipopolysaccharide as a target for brucellosis vaccine design. Microb. Pathog. 2013, 58, 29–34. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequence (5′-3′) | PCR Conditions | Amplicon Size (bp) | Reference |
---|---|---|---|---|
VirB5 | VirB5-F: ATTCTCAGCTTCGCATTC VirB5-R: TCACCGCTTCGTAGAGAT | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 56 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 274 | [47] |
BtpA | BtpA-F: CTATCAGGCTAAGCAATTC BtpA-R: CGTAGGAAACTTTATGCC | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 56 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 458 | [47] |
BtpB | BtpB-F: TTAACCAGCACGAATACACG BtpB-R: CTACGATCAGTTTGCAGCG | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 61 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 579 | [47] |
VceC | VceC-F: CGCAAGCTGGTTCTGATC VceC-R: TGTGACGGGTAATTTGAAGC | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 61 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 482 | [47] |
BetB | BetB-F: GCTCGAAACGCTGGATAC BetB-R: AGGCGATGATTGACGAGC | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 60 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 393 | [47] |
BPE275 | BPE275-F: TGTCGCGGTCTATGTCTATC BPE275-R: AATGAGGACGGGCTTGAG | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 59 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 466 | [47] |
VirB2 | VirB2-F: GCTGTCGCGGATTCTACC VirB2-R: CGGAATGCCATCTTGTAAC | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 60 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 198 | [47] |
BSPB | BSPB-F: TATCCATGGTATATGCGCC BSPB-R: ATAAAGGCCGGGAATGAC | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 62 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 336 | [47] |
PrpA | PrpA-F: AACCTCAATGGATCGACC PrpA-R: ACGGTCGATAGCCTTGTC | Denaturation at 94 °C for 4 min, then 30 cycles of heat denaturation at 94 °C for 60 s, primer annealing at 58 °C for 45 s, and DNA extension at 72 °C for 1 min. To complete the synthesis of all strands, a last extension at 72 °C for 10 min is required. | 672 | [47] |
Antibiotics | Cattle | Total (%) | Goats | Total (%) | Sheep | Total (%) | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
S | I | R | S | I | R | S | I | R | S | I | R | S | I | R | S | I | R | |
Ciprofloxacin (10 µg) | 9 | 0 | 65 | 12 | 0 | 88 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 | 0 | 0 |
Rifampicin (5 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 |
Amoxicillin (10 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 |
Doxycycline (30 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 0 | 4 | 29 | 0 | 12 | 88 | 0 | 0 | 16 | 0 | 0 | 100 |
Tetracycline (5 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 0 | 7 | 26 | 0 | 21 | 79 | 0 | 7 | 9 | 0 | 44 | 56 |
Trimethoprim–sulfamethoxazole (2.5 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 | 0 | 0 |
Ampicillin (10 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 |
Erythromycin (15 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 |
Ofloxacin (5 µg) | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 | 0 | 0 |
Cefixime (5 µg) | 61 | 0 | 13 | 82 | 0 | 18 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 | 0 | 0 |
Moxifloxacin (5 µg) | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 | 0 | 0 |
Gentamicin (10 µg) | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 | 0 | 0 |
Penicillin G (10 units) | 0 | 0 | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 |
Levofloxacin (5 µg) | 74 | 0 | 0 | 100 | 0 | 0 | 33 | 0 | 0 | 0 | 0 | 100 | 16 | 0 | 0 | 100 | 0 | 0 |
Cefoxitin (30 µg) | 0 | 0 | 74 | 0 | 0 | 100 | 33 | 0 | 0 | 100 | 0 | 0 | 16 | 0 | 0 | 100 | 0 | 0 |
Antibiotic Code | Antibiotype | Number of Antibiotics | MARI |
---|---|---|---|
A1 | ER PGR RPR AR APR | 5 | 0.3 |
A2 | ER PGR RPR AR DXTR APR | 6 | 0.5 |
A3 | ER PGR RPR AR DXTR TR APR | 7 | 0.5 |
A4 | ER PGR RPR AR DXTR TR SXTR APR FOXR | 9 | 0.6 |
A5 | CIPR ER PGR RPR AR DXTR TR TSR APR | 9 | 0.6 |
A6 | CIPR ER PGR RPR AR DXTR TR SXTR APR CFMR FOXR | 11 | 0.7 |
Target Strains | Number (%) | Number of Putative Virulence Genes in Studied Strains | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
VirB5 | BtpA | BtpB | VceC | BetB | BPE275 | VirB2 | BSPB | PrpA | ||
B. melitensis | 49 (40.8) | 3 (6.1) | 2 (4.1) | 1 (2) | 9 (18.4) | 17 (34.7) | 3 (6.1) | 0 | 14 (28.6) | 0 |
B. abortus | 71 (59.2) | 10 (14.1) | 24 (33.8) | 5 (7) | 71 (100) | 71 (100) | 70 (98.6) | 65 (91.5) | 71 (100) | 4 (5.6) |
TOTAL | 120 (100) | 13 (11) | 26 (22) | 6 (5) | 80 (67) | 88 (73) | 73 (61%) | 65 (54) | 85 (70.8) | 4 (3) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Manafe, R.P.; Bhembe-Magadaza, N.L.; Green, E. Antibiogram Screening and Detection of Virulence-Associated Genes in Brucella Species Acquired from Cattle in South Africa’s Eastern Cape Province. Int. J. Environ. Res. Public Health 2022, 19, 2813. https://doi.org/10.3390/ijerph19052813
Manafe RP, Bhembe-Magadaza NL, Green E. Antibiogram Screening and Detection of Virulence-Associated Genes in Brucella Species Acquired from Cattle in South Africa’s Eastern Cape Province. International Journal of Environmental Research and Public Health. 2022; 19(5):2813. https://doi.org/10.3390/ijerph19052813
Chicago/Turabian StyleManafe, Rudzani P., Nolwazi L. Bhembe-Magadaza, and Ezekiel Green. 2022. "Antibiogram Screening and Detection of Virulence-Associated Genes in Brucella Species Acquired from Cattle in South Africa’s Eastern Cape Province" International Journal of Environmental Research and Public Health 19, no. 5: 2813. https://doi.org/10.3390/ijerph19052813