Comparative Study of Two Methods of Enteric Virus Detection and Enteric Virus Relationship with Bacterial Indicator in Poyang Lake, Jiangxi, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Description of Sites
2.2. Water Sampling
2.3. Bacteriological Water Analyses
2.4. Detection of Enteric Viruses
2.4.1. Viral Concentration by the Electropositive Material Method, Nucleic acid Extraction and Taqman-q RT-PCR Detection (Tianjin’s Method)
2.4.2. Sample Concentration by the Filtration-Based method, Nucleic Acid Extraction and RT-PCR Detection (Hawaii’s Method)
- Preparatory work before starting:
- The temperature of the water bath pot is set at 55 °C;
- Solution PWR1 must be warmed at 55 °C for 5–10 min to dissolve precipitates prior to use. Solution PWR1 should be used while still warm.
- Designed extraction of both DNA and RNA:
- Add 990 µL of PWR1 and 10 µL of βME directly to the PowerWater® Bead Tube. Make sure cap is securely tightened on tube. Vortex at maximum speed for 5 min. Centrifuge the tubes 4000 rpm 4 °C for 1 min at room temperature. Transfer all the supernatant to a clean 2 mL Collection Tube (provided). Draw up the supernatant using a 1 mL pipette tip by placing it down into the beads. Centrifuge at 4000 rpm 4 °C for 1 min. Avoiding the pellet, transfer the supernatant to a clean 2 mL Collection Tube (provided);
- Add 200 µL of Solution PWR2 and vortex briefly to mix. Incubate at 4 °C for 5 min. Centrifuge the tubes at 13,000 rpm 4 °C for 1 min. Avoiding the pellet, transfer the supernatant to a clean 2 mL Collection Tube (provided);
- Add 650 µL of Solution PWR3 and 650 µL of Solution PWR4. Then vortex briefly to mix. Load 650 µL of supernatant onto a Spin Filter and centrifuge at 13,000 rpm 4 °C for 1 min. Discard the flow through and repeat until all the supernatant has been loaded onto the Spin Filter;
- Shake to mix Solution PWR5 before use. Add 650 µL of Solution PWR5 and centrifuge at 13,000 rpm 4 °C for 1 min. Discard the flow through and centrifuge again at 13,000 rpm 4 °C for 1 min to remove residual wash. Place the Spin Filter basket into a clean 2 mL Collection Tube (provided);
- Add 650 µL of Solution PWR4 and vortex briefly to mix. Centrifuge the tubes at 13,000 rpm 4 °C for 1 min. Avoiding the pellet, transfer the supernatant to a clean 2 mL Collection Tube (provided);
- Add 62 µL of Solution PWR8 (don’t shake) and incubate at 4 °C for 5 min. Centrifuge at 13,000 rpm 4 °C for 1 min. Discard the Spin Filter basket;
- A total of 60 µL of nucleic acids were extracted from each sample; 45 µL was used for RNA extraction and 15 µL was used for DNA extraction. 45 µL was treated with 5 µL of PWR6 and 4 µL of DNase I for removal of residual DNA. Incubate at room temperature for 20 min and heating for 5 min for RNA extraction prepared. RNA extraction should be used immediately or stored at −20 °C within 48 h to avoid degradation. The remaining 15 µL was stored at −80°C for viral DNA assays.
- Add 1 µL of Random Primer and 8 µL of sample RNA. Vortex briefly to mix and be warmed at 65 °C for 5 min, then ice bath for 2 min.
- Add 10 µL of 2 × ES Reaction Mix and 1 µL of Easy Script® RT/RI Enzyme Mix to every reaction system. The total volume of every reaction system is 20 µL.
- Reaction conditions is 25 °C for 10 min, 42 °C for 30 min and 85 °C for 5 min, then be used immediately for experiment or stored at −20 °C for a week.
2.5. Statistical Analyses
3. Results
3.1. The Distribution of Bacteria Indicators
3.2. Detection of Enteric Viruses through Hawaii’s Method Qualitative PCR
3.3. Detection of Enteric Viruses through Tianjin’s Method Quantitative PCR
3.4. Comparisons of the Results of the Two Methods by McNemar Test
3.5. Comparisons by Two Methods
3.6. Correlation of Enteric Viruses between Bacteriological Index in Poyang Lake
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| NoV GII | Norovirus geno-groups II |
| Eov | Enterovirus |
| Adv | Adenovirus |
| FIB | Fecal indicator bacteria |
| TC | Total coliform |
| FC | Fecal coliform |
| HCl | Hydrochloric acid |
| ACC | Aerobic bacterial count |
| PCR | Polymerase chain reaction |
| RT-PCR | Reverse transcript-polymerase chain reaction |
| BLAST | Basic local alignment search tool |
| EPA | Environmental protection agency |
References
- Forstinus, N.; Ikechukwu, N.; Emenike, M.; Christiana, A. Water and Waterborne Diseases: A Review. Int. J. Trop. Dis. Health 2016, 12, 1–14. [Google Scholar] [CrossRef]
- McClung, R.P.; Roth, D.M.; Vigar, M.; Roberts, V.A.; Kahler, A.M.; Cooley, L.A.; Hilborn, E.D.; Wade, T.J.; Fullerton, K.E.; Yoder, J.S.; et al. Waterborne disease outbreaks associated with environmental and undetermined exposures to water—United States, 2013–2014. Am. J. Transpl. 2018, 18, 262–267. [Google Scholar] [CrossRef] [PubMed]
- Aslan, A.; Xagoraraki, I.; Simmons, F.J.; Rose, J.B.; Dorevitch, S. Occurrence of adenovirus and other enteric viruses in limited-contact freshwater recreational areas and bathing waters. J. Appl. Microbiol. 2011, 111, 1250–1261. [Google Scholar] [CrossRef] [PubMed]
- Borchardt, M.A.; Bertz, P.D.; Spencer, S.K.; Battigelli, D.A. Incidence of Enteric Viruses in Groundwater from Household Wells in Wisconsin. Appl. Environ. Microbiol. 2003, 69, 1172–1180. [Google Scholar] [CrossRef] [PubMed]
- Donaldson, K.A.; Griffin, D.W.; Paul, J.H. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT–PCR. Water Res. 2002, 36, 2505–2514. [Google Scholar] [CrossRef]
- Hunter, P.R.; Neal, K. Waterborne disease. Public Health 1998, 112. [Google Scholar] [CrossRef]
- Nyagwencha, J.M.; Kaluli, J.W.; Home, P.G.; Hunja, M. Water and water-borne diseases in north Maasba district, Kenya. J. Agric. Sci. Technol. 2012, 14, 115–127. [Google Scholar]
- Hu, X.; Ding, G.; Zhang, Y.; Liu, Q.; Jiang, B.; Ni, W. Assessment on the burden of bacillary dysentery associated with floods during 2005–2009 in Zhengzhou City, China, using a time-series analysis. J. Infect. Public Health 2018, 11, 500–506. [Google Scholar] [CrossRef]
- Shen, H.; Zhang, J.; Li, Y.; Xie, S.; Jiang, Y.; Wu, Y.; Ye, Y.; Yang, H.; Mo, H.; Situ, C.; et al. The 12 Gastrointestinal Pathogens Spectrum of Acute Infectious Diarrhea in a Sentinel Hospital, Shenzhen, China. Front. Microbiol. 2016, 7, 1926. [Google Scholar] [CrossRef]
- Xu, C.; Li, Y.; Wang, J.; Xiao, G. Spatial-temporal detection of risk factors for bacillary dysentery in Beijing, Tianjin and Hebei, China. BMC Public Health 2017, 17, 743. [Google Scholar] [CrossRef]
- Hewitt, J.; Bell, D.; Simmons, G.C.; Rivera-Aban, M.; Wolf, S.; Greening, G.E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 2007, 73, 7853–7857. [Google Scholar] [CrossRef] [PubMed]
- Benedict, K.M.; Reses, H.; Vigar, M.; Roth, D.M.; Roberts, V.A.; Mattioli, M.; Yoder, J.S. Surveillance for Waterborne Disease Outbreaks Associated with Drinking Water—United States, 2013–2014. Morb. Mortal. Wkly. Rep. 2017, 66, 1216–1221. [Google Scholar] [CrossRef] [PubMed]
- Boehm, A.B.; Ashbolt, N.J.; Colford, J.M., Jr.; Dunbar, L.E.; Fleming, L.E.; Gold, M.A.; Hansel, J.A.; Hunter, P.R.; Ichida, A.M.; McGee, C.D.; et al. A sea change ahead for recreational water quality criteria. J. Water Health 2009, 7, 9–20. [Google Scholar] [CrossRef] [PubMed]
- Fleming, L.E.; Solo, G.H.; Elmir, S.; Shibata, T.; Squicciarini, D., Jr.; Quirino, W.; Van de Bogart, G. A Pilot Study of Microbial Contamination of Subtropical Recreational Waters. Fla. J. Environ. Health 2004, 184, 29–37. [Google Scholar] [PubMed]
- Wyn-Jones, A.P.; Sellwood, J. Enteric viruses in the aquatic environment. J. Appl. Microbiol. 2001, 91, 945–962. [Google Scholar] [CrossRef]
- Cabelli, V.J. Microbial indicator systems for assessing water quality. Antonie Leeuwenhoek 1982, 48, 613–618. [Google Scholar] [CrossRef]
- Islam, M.M.M.; Hofstra, N.; Islam, M.A. The Impact of Environmental Variables on Faecal Indicator Bacteria in the Betna River Basin, Bangladesh. Environ. Process. 2017, 4, 319–332. [Google Scholar] [CrossRef]
- Muscillo, M.; Carducci, A.; La Rosa, G.; Cantiani, L.; Marianelli, C. Eeteric virus detdction in adriatic seawater by cell culture, polymerase chain reaction and polyacrylamide gel electrophoresis. Water Res. 1997, 31, 5. [Google Scholar] [CrossRef]
- Wu, Z.; Zhang, D.; Cai, Y.; Wang, X.; Zhang, L.; Chen, Y. Water quality assessment based on the water quality index method in Lake Poyang: The largest freshwater lake in China. Sci. Rep. 2017, 7, 17999. [Google Scholar] [CrossRef]
- Tong, H.I.; Connell, C.; Boehm, A.B.; Lu, Y. Effective detection of human noroviruses in Hawaiian waters using enhanced RT-PCR methods. Water Res. 2011, 45, 5837–5848. [Google Scholar] [CrossRef]
- Tong, H.I.; Lu, Y. Effective detection of human adenovirus in Hawaiian waters using enhanced PCR methods. Virol. J. 2011, 8, 57. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Jin, M.; Guo, X.; Wang, X.W.; Yang, D.; Shen, Z.Q.; Qiu, Z.G.; Chen, Z.L.; Li, J.W. Development of a novel filter cartridge system with electropositive granule media to concentrate viruses from large volumes of natural surface water. Environ. Sci. Technol. 2014, 48, 6947–6956. [Google Scholar] [CrossRef] [PubMed]
- Li, J.W.; Wang, X.W.; Rui, Q.Y.; Song, N.; Zhang, F.G.; Ou, Y.C.; Chao, F.H. A new and simple method for concentration of enteric viruses from water. J. Virol. Methods 1998, 74, 99–108. [Google Scholar] [PubMed]
- He, L.; Wang, X.W.; Wang, Y.G.; Chen, Z.L.; Qiu, Z.G.; Shen, Z.Q.; Jin, M. Effect of Three Methods for Concentration of Enteric Viruses From Water. J. Prev. Med. Clin. PLA 2013, 31, 30–33. [Google Scholar] [CrossRef]
- Katayama, H.; Shimasaki, A.; Ohgaki, S. Development of a Virus Concentration Method and Its Application to Detection of Enterovirus and Norwalk Virus from Coastal Seawater. Appl. Environ. Microbiol. 2002, 68, 1033–1039. [Google Scholar] [CrossRef] [PubMed]
- Viau, E.J.; Goodwin, K.D.; Yamahara, K.M.; Layton, B.A.; Sassoubre, L.M.; Burns, S.L.; Tong, H.I.; Wong, S.H.; Lu, Y.; Boehm, A.B. Bacterial pathogens in Hawaiian coastal streams--associations with fecal indicators, land cover, and water quality. Water Res. 2011, 45, 3279–3290. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Yuan, F.; Yuan, Z.; Liu, R.; Xie, F.; Huang, L.; Liu, X.; Jiang, X.; Wang, J.; Xu, Q.; et al. Monitoring of Poyang lake water for sewage contamination using human enteric viruses as an indicator. Virol. J. 2018, 15, 3. [Google Scholar] [CrossRef] [PubMed]
- Connell, C.; Tong, H.I.; Wang, Z.; Allmann, E.; Lu, Y. New approaches for enhanced detection of enteroviruses from Hawaiian environmental waters. PLoS ONE 2012, 7, e32442. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Asahina, A.Y.; Lu, Y.; Wu, C.; Fujioka, R.S.; Loh, P.C. Potential biosentinels of human waste in marine coastal waters: Bioaccumulation of human noroviruses and enteroviruses from sewage-polluted waters by indigenous mollusks. J. Virol. Methods 2009, 158, 46–50. [Google Scholar] [CrossRef] [PubMed]
- Kageyama, T.; Shinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F.B.; Kojima, S.; Takai, R.; Oka, T.; Takeda, N.; Katayama, K. Coexistence of multiple genotypes, including newly identified genotypes, in outbreaks of gastroenteritis due to Norovirus in Japan. J. Clin. Microbiol. 2004, 42, 2988–2995. [Google Scholar] [CrossRef] [PubMed]
- Dierssen, U.; Rehren, F.; Henke-Gendo, C.; Harste, G.; Heim, A. Rapid routine detection of enterovirus RNA in cerebrospinal fluid by a one-step real-time RT-PCR assay. J. Clin. Virol. 2008, 42, 58–64. [Google Scholar] [CrossRef] [PubMed]
- Gunson, R.N.; Maclean, A.R.; Shepherd, S.J.; Carman, W.F. Simultaneous detection and quantitation of cytomegalovirus, Epstein-Barr virus, and adenovirus by use of real-time PCR and pooled standards. J. Clin. Microbiol. 2009, 47, 765–770. [Google Scholar] [CrossRef] [PubMed]
- Pusch, D.; Oh, D.Y.; Wolf, S.; Dumke, R.; Schroter-Bobsin, U.; Hohne, M.; Roske, I.; Schreier, E. Detection of enteric viruses and bacterial indicators in German environmental waters. Arch. Virol. 2005, 150, 929–947. [Google Scholar] [CrossRef] [PubMed]
- De Giglio, O.; Caggiano, G.; Bagordo, F.; Barbuti, G.; Brigida, S.; Lugoli, F.; Grassi, T.; La Rosa, G.; Lucentini, L.; Uricchio, V.F.; et al. Enteric Viruses and Fecal Bacteria Indicators to Assess Groundwater Quality and Suitability for Irrigation. Int. J. Environ. Res. Public Health 2017, 14, 558. [Google Scholar] [CrossRef] [PubMed]
- Tandukar, S.; Sherchand, J.B.; Bhandari, D.; Sherchan, S.P.; Malla, B.; Ghaju Shrestha, R.; Haramoto, E. Presence of Human Enteric Viruses, Protozoa, and Indicators of Pathogens in the Bagmati River, Nepal. Pathogens 2018, 7, 38. [Google Scholar] [CrossRef] [PubMed]
- Okoh, A.I.; Sibanda, T.; Gusha, S.S. Inadequately treated wastewater as a source of human enteric viruses in the environment. Int. J. Environ. Res. Public Health 2010, 7, 2620–2637. [Google Scholar] [CrossRef] [PubMed]
- Sinclair, R.G.; Jones, E.L.; Gerba, C.P. Viruses in recreational water-borne disease outbreaks: A review. J. Appl. Microbiol. 2009, 107, 1769–1780. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.C.; Chu, W. PCR detection of pathogenic viruses in southern California urban rivers. J. Appl. Microbiol. 2004, 97, 17–28. [Google Scholar] [CrossRef]
- Cashdollar, J.L.; Brinkman, N.E.; Griffin, S.M.; McMinn, B.R.; Rhodes, E.R.; Varughese, E.A.; Grimm, A.C.; Parshionikar, S.U.; Wymer, L.; Fout, G.S. Development and evaluation of EPA method 1615 for detection of enterovirus and norovirus in water. Appl. Environ. Microbiol. 2013, 79, 215–223. [Google Scholar] [CrossRef]
- Armanious, A.; Munch, M.; Kohn, T.; Sander, M. Competitive Coadsorption Dynamics of Viruses and Dissolved Organic Matter to Positively Charged Sorbent Surfaces. Environ. Sci. Technol. 2016, 50, 3597–3606. [Google Scholar] [CrossRef]
- Coudray-Meunier, C.; Fraisse, A.; Martin-Latil, S.; Delannoy, S.; Fach, P.; Perelle, S. A Novel High-Throughput Method for Molecular Detection of Human Pathogenic Viruses Using a Nanofluidic Real-Time PCR System. PLoS ONE 2016, 11, e0147832. [Google Scholar] [CrossRef] [PubMed]



| Location | Details |
|---|---|
| 1. Qingshan Zha | The southern branch of Gan River, Nanchang City |
| 2. Guanniao Tai | Located in the Jiangxi Provincial Nature Reserve, in the southwestern region of Poyang Lake, Nanchang City |
| 3. Tuo Shan | Located in the Jiangxi Provincial Nature Reserve, in the southwestern region of Poyang Lake, Nanchang City |
| 4. Wu Cheng | In the north-central region of Poyang Lake, Jiujiang City |
| 5. Xing Zi | In the north-central region of Jiangxi Province, Jiujiang City |
| 6. Du Kou | At the junction of Poyang Lake and Yangtze River in Jiujiang City |
| Virus | Primer | Oligo Sequence (5′ → 3′) | Length (bp) | Reference |
|---|---|---|---|---|
| NoV II | NV-II-F | CARGARBCNATGTTYAGRTGGATGAG | 98 | [22] |
| NV-II-R | TCGACGCCATCTTCATTCACA | |||
| NV-II-P | 5′-(FAM)TGGGAGGGCGATCGCAATCT(TAMRA)-3’ | |||
| EoV | EV-F | GTGGCRGTGGCTGCGYT | 204 | [22] |
| EV-R | ACCCAAAGTAGTCGGTTCCGC | |||
| EV-P | 5′-(FAM)ATTAGCCGCATTCAGGGGCCGGA(TAMRA)-3’ | |||
| AdV | Adev-F | AACTTTCTCTCTTAATAGACGCCCC | 87 | [22] |
| Adev-R | TGTCCACTAGTCCAAGAGGTGC | |||
| Adev-P | 5′-(FAM)GCTGACACGGGCACTCTTCGC(TAMRA)-3’ |
| Virus | Primer | Oligo Sequence (5′ → 3′) | Length (bp) | Reference |
|---|---|---|---|---|
| NoV II | COG2F | CARGARBCNATGTTYAGRTGGATGAG | 97 | [20,30] |
| COG2R | TCGACGCCATCTTCATTCACA | |||
| EoV | EQ-1 | ACATGGTGTGAAGAGTCTATTGAGCT | 142 | [28,31] |
| EQ-2 | CCAAAGTAGTCGGTTCCGC | |||
| AdV | ADV-F | GCCACGGTGGGGTTTCTAAACTT | 132 | [20,21,32] |
| ADV-R | GCCCCAGTGGTCTTACATGCACATC |
| Virus | Primer Set | TA a | [MgCl2] | [Primer] | BSA b | Detection Limit c | Reference |
|---|---|---|---|---|---|---|---|
| NoV II | COG2F/COG2R | 52~60 °C | 2 mM | 800 nM | + | 10−6–10−7x | [20,30] |
| EoV | EQ-1/EQ-2 | 58~60 °C | 1.5 mM | 600 nM | + | 10−7x | [28,31] |
| AdV | ADV-F/ADV-R | 60 °C | 1.5 mM | 600 nM | + | 10−6–10−7x | [20,21,32] |
| Title | Group | N | ACC | TC | FC | E. coli | ENT |
|---|---|---|---|---|---|---|---|
| Seasons | Summer | 12 | 1.45 × 103 | 0 | 0 | 0 | 4.00 |
| Autumn | 12 | 1.28 × 103 | 5.00 × 101 | 5.00 × 101 | 0 | 0 | |
| Winter | 12 | 3.15 × 102 | 0 | 0 | 0 | 2.50 × 101 | |
| Flood seasons | Rainy/wet season | 12 | 1.45 × 103 | 0 | 0 | 0 | 4.00 |
| Dry season | 24 | 3.90 × 102 | 2.50 × 101 | 0 | 0 | 0 | |
| Sampling sites | 1. Qingshan zha | 6 | 3.00 × 103 | 4.00 × 102 | 0 | 1.0 × 102 | 4.75 × 10 |
| 2. Guanniao Tai | 6 | 1.30 × 102 | 0 | 0 | 0 | 0 | |
| 3. Tuoshan | 6 | 5.25 × 102 | 2.50 × 101 | 9.25 × 10 | 0 | 0 | |
| 4. Wucheng | 6 | 1.75 × 103 | 0 | 0 | 0 | 0 | |
| 5. Xingzi | 6 | 3.68 × 102 | 2.50 × 101 | 2.50 × 101 | 0 | 5.00 | |
| 6. Dukou | 6 | 3.10 × 104 | 2.50 × 101 | 2.50 | 0 | 7.00 |
| Group | N | NoV II | ENV | AdV | |
|---|---|---|---|---|---|
| Seasons | Summer | 12 | 2 (16.67) | 9 (75.00) | 9 (75.00) |
| Autumn | 12 | 7 (58.33) | 5 (41.67) | 7 (58.33) | |
| Winter | 12 | 4 (33.33) | 8 (66.67) | 8 (66.67) | |
| Flood seasons | Rainy/wet season | 12 | 2 (16.67) | 9 (75.00) | 9 (75.00) |
| Dry season | 24 | 11 (45.83) | 13 (54.17) | 15 (62.50) | |
| Sampling sites | 1. Qingshan zha | 6 | 2 (33.33) | 2 (33.33) | 2 (33.33) |
| 2. Guanniao Tai | 6 | 3 (50.00) | 3 (50.00) | 3 (50.00) | |
| 3. Tuoshan | 6 | 1 (16.67) | 3 (50.00) | 3 (50.00) | |
| 4. Wucheng | 6 | 3 (50.00) | 4 (66.67) | 6 (100.00) | |
| 5. Xingzi | 6 | 1 (16.67) | 5 (83.33) | 5 (83.33) | |
| 6. Dukou | 6 | 3 (50.00) | 5 (83.33) | 5 (83.33) | |
| Total | 36 | 13 (36.11) | 22 (61.11) | 24 (66.67) |
| Time (Year/Month) | Site | NoV II | ENV | AdV |
|---|---|---|---|---|
| 2016/05 | 1. Qingshan zha | 9194 | 3,307,965 | 91,357 |
| 2. Guanniao Tai | 1305 | 6678 | 18,724 | |
| 3. Tuoshan | 0 | 567,784 | 39,011 | |
| 4. Wucheng | 8488 | 156,782 | 68,253 | |
| 5. Xingzi | 453,797 | 229,082 | 575,728 | |
| 6. Dukou | 4,159,765 | 456,673 | 598,343 | |
| 2016/06 | 1. Qingshan zha | 9,877,789 | 2906,864 | 668,8789 |
| 2. Guanniao Tai | 0 | 6897 | 458,765 | |
| 3. Tuoshan | 0 | 68,079 | 105,5445 | |
| 4. Wucheng | 9100 | 25,634 | 897,790 | |
| 5. Xingzi | 567,734 | 34,457 | 8,779,980 | |
| 6. Dukou | 2,345,900 | 455,648 | 899,878 | |
| 2016/10 | 1. Qingshan zha | 401,920 | 386,1981 | 1,050,365 |
| 2. Guanniao Tai | 100,295 | 7,468,484 | 556,939 | |
| 3. Tuoshan | 0 | 0 | 0 | |
| 4. Wucheng | 38,981,076 | 1,673,658 | 573,600 | |
| 5. Xingzi | 22,524,039 | 3,300,644 | 789,726 | |
| 6. Dukou | 183,514 | 2,293,564 | 428,490 | |
| 2016/11 | 1. Qingshan zha | 1,257,891 | 2,837,055 | 2,000,810 |
| 2. Guanniao Tai | 113,051 | 6,330,130 | 718,724 | |
| 3. Tuoshan | 56,680,339 | 5,741,566 | 968,012 | |
| 4. Wucheng | 857,488 | 1,391,322 | 558,253 | |
| 5. Xingzi | 55,374,097 | 2,027,416 | 755,727 | |
| 6. Dukou | 6,154,197,581 | 955,726 | 698,343 | |
| 2016/12 | 1. Qingshan zha | 102,608,660 | 538,5941 | 2,461,629 |
| 2. Guanniao Tai | 0 | 0 | 0 | |
| 3. Tuoshan | 4,935,579 | 8,003,342 | 631,161 | |
| 4. Wucheng | 0 | 0 | 1220,268 | |
| 5. Xingzi | 13,252,818 | 1,124,448 | 313,665 | |
| 6. Dukou | 743,226 | 801,767 | 164,452 | |
| 2017/01 | 1. Qingshan zha | 5869 | 0 | 721,281 |
| 2. Guanniao Tai | 0 | 678,880 | 721,281 | |
| 3. Tuoshan | 0 | 0 | 765,789 | |
| 4. Wucheng | 7899 | 778,891 | 0 | |
| 5. Xingzi | 10,100 | 898,761 | 8,793,346 | |
| 6. Dukou | 3,567,824 | 700,876 | 808,803 |
| Group | N | NoV II | ENV | AdV | |
|---|---|---|---|---|---|
| Season | Summer | 12 | 9 (75.00) | 12 (100.00) | 12 (100.00) |
| Autumn | 12 | 11 (91.67) | 11 (91.67) | 11 (91.67) | |
| Winter | 12 | 8 (66.67) | 8 (66.67) | 10 (83.33) | |
| Flood season | Rainy/wet season | 12 | 9 (75.00) | 12 (100.00) | 12 (100.00) |
| Dry season | 24 | 19 (79.17) | 19 (79.17) | 21 (87.50) | |
| Sampling site | 1. Qingshan zha | 6 | 6 (100.00) | 6 (100.00) | 6 (100.00) |
| 2. Guanniao Tai | 6 | 3 (50.00) | 5 (83.33) | 5 (83.33) | |
| 3. Tuoshan | 6 | 2 (33.33) | 4 (66.67) | 5 (83.33) | |
| 4. Wucheng | 6 | 5 (83.33) | 5 (83.33) | 5 (83.33) | |
| 5. Xingzi | 6 | 6 (100.00) | 6 (100.00) | 6 (100.00) | |
| 6. Dukou | 6 | 6 (100.00) | 6 (100.00) | 6 (100.00) | |
| Total | 36 | 28 (77.78) | 31 (86.11) | 33 (91.67) |
| Hawaii’s Method | Tianjin’s Method | p | ||
|---|---|---|---|---|
| Negative | Positive | Total | ||
| NoV II | <0.001 | |||
| Negative | 6 | 17 | 23 | |
| Positive | 2 | 11 | 13 | |
| Total | 8 | 28 | 36 | |
| ENV | 0.035 | |||
| Negative | 2 | 12 | 14 | |
| Positive | 3 | 19 | 22 | |
| Total | 5 | 31 | 36 | |
| AdV | 0.035 | |||
| Negative | 0 | 12 | 12 | |
| Positive | 3 | 21 | 24 | |
| Total | 3 | 33 | 36 | |
| Difference between Two Methods | Tianjin’s Method | Hawaii’s Method |
|---|---|---|
| 1. Volume of water sample used | 50 L | 500–2000 mL |
| 2. Final volume of eluent | 40 mL | <5 mL |
| 3. Viral concentration time | ≥6 h | ≤1 h |
| 4. Starting volume of nucleic acid | 1 mL for DNA; 140 µL for RNA; | ≤600 µL for both DNA and RNA |
| 5. Final volume of nucleic acid | 100 µL for DNA; 80 µL for RNA; | 15 µL for DNA; 45 µL for RNA; |
| 6. Kit price (Quantity: 50 Preps) | QIAamp Viral RNA Mini Kit: ¥3010 ($477.38/€390.20/£339.94) | The Power Water® RNA Isolation Kit: ¥4500 ($713.69/€583.36/£508.22) |
| UNIQ-10 Order Viral Genome DNA Extraction Kit: ¥544 ($86.28/€70.52/£61.44) |
| Enteric Virus | Spearman’s Correlation Coefficients (p-Value Is Two-Tailed) | ||||
|---|---|---|---|---|---|
| ACC | TC | FC | E. coli | ENT | |
| NV II | −0.055 (0.731) | −0.084 (0.595) | −0.162 (0.304) | −0.106 (0.506) | 0.083 (0.629) |
| EoV | 0.173 (0.273) | 0.03 5(0.828) | −0.131 (0.409) | −0.034 (0.830) | 0.076 (0.660) |
| AdV | 0.160 (0.312) | 0.075 (0.635) | 0.002 (0.988) | −0.176 (0.265) | 0.111 (0.520) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wen, X.; Zheng, H.; Yuan, F.; Zhu, H.; Kuang, D.; Shen, Z.; Lu, Y.; Yuan, Z. Comparative Study of Two Methods of Enteric Virus Detection and Enteric Virus Relationship with Bacterial Indicator in Poyang Lake, Jiangxi, China. Int. J. Environ. Res. Public Health 2019, 16, 3384. https://doi.org/10.3390/ijerph16183384
Wen X, Zheng H, Yuan F, Zhu H, Kuang D, Shen Z, Lu Y, Yuan Z. Comparative Study of Two Methods of Enteric Virus Detection and Enteric Virus Relationship with Bacterial Indicator in Poyang Lake, Jiangxi, China. International Journal of Environmental Research and Public Health. 2019; 16(18):3384. https://doi.org/10.3390/ijerph16183384
Chicago/Turabian StyleWen, Xiaotong, Huilie Zheng, Fang Yuan, Hui Zhu, Duyi Kuang, Zhiqiang Shen, Yuanan Lu, and Zhaokang Yuan. 2019. "Comparative Study of Two Methods of Enteric Virus Detection and Enteric Virus Relationship with Bacterial Indicator in Poyang Lake, Jiangxi, China" International Journal of Environmental Research and Public Health 16, no. 18: 3384. https://doi.org/10.3390/ijerph16183384
APA StyleWen, X., Zheng, H., Yuan, F., Zhu, H., Kuang, D., Shen, Z., Lu, Y., & Yuan, Z. (2019). Comparative Study of Two Methods of Enteric Virus Detection and Enteric Virus Relationship with Bacterial Indicator in Poyang Lake, Jiangxi, China. International Journal of Environmental Research and Public Health, 16(18), 3384. https://doi.org/10.3390/ijerph16183384

