Characterization of Aminoglycoside Resistance and Virulence Genes among Enterococcus spp. Isolated from a Hospital in China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Isolation and Identification
2.2. Susceptibility Testing
2.3. Amplification of Virulence and Resistance Genes
| Gene | Description | Sequence(5 '-3') | Amplicon Size (bp) | Ref. |
|---|---|---|---|---|
| ace | Collagen-binding protein | GGAATGACCGAGAACGATGGC | 616 | [8] |
| GCTTGATGTTGGCCTGCTTCCG | ||||
| asa1 | Aggregation substance | CACGCTATTACGAACTATGA | 375 | [10] |
| TAAGAAAGAACATCACCACGA | ||||
| ylA | Cytolysin | ACTCGGGGATTGATAGGC | 688 | [8] |
| GCTGCTAAAGCTGCGCTT | ||||
| efaA | Endocarditis antigen | CGTGAGAAAGAAATGGAGGA | 499 | [7] |
| CTACTAACACGTCACGAATG | ||||
| esp | Enterococcal surface protein | AGATTTCATCTTTGATTCTTGG | 510 | [10] |
| AATTGATTCTTTAGCATCTGG | ||||
| gelE | Gelatinase | TATGACAATGCTTTTTGGGAT | 213 | [10] |
| AGATGCACCCGAAATAATATA | ||||
| hyl | Hyaluronidase | ACAGAAGAGCTGCAGGAAATG | 276 | [10] |
| GACTGACGTCCAAGTTTCCAA | ||||
| aac(6')-Ie-aph(2")-Ia | AAC(6')-APH(2'') | AGGAATTTATCGAAAATGGTAGAAAAG | 369 | [6] |
| CACAATCGACTAAAGAGTACCAATC | ||||
| aph(3')-IIIa | APH(3') | GGCTAAAATGAGAATATCACCGG | 523 | [6] |
| CTTTAAAAAATCATACAGCTCGCG | ||||
| ant(4')-Ia | ANT(4') | CAAACTGCTAAATCGGTAGAAGCC | 294 | [6] |
| GGAAAGTTGACCAGACATTACGAACT | ||||
| aph(2")-Ic | APH(2') | CCACAATGATAATGACTCAGTTCCC | 444 | [11] |
| CCACAGCTTCCGATAGCAAGAG | ||||
| aph(2")-Ib | APH(2') | CTTGGACGCTGAGATATATGAGCAC | 867 | [12] |
| GTTTGTAGCAATTCAGAAACACCCTT | ||||
| aph(2")-Id | APH(2') | GGTGGTTTTTACAGGAATGCCATC | 642 | [11] |
| CCCTCTTCATACCAATCCATATAACC | ||||
| ant(3")-III | ANT(3') | CACGCTATTACGAACTATGA | 284 | [11] |
| TAAGAAAGAACATCACCACGA | ||||
| ant(6')-Ia | ANT(6') | ACTCGGGGATTGATAGGC | 597 | [11] |
| GCTGCTAAAGCTGCGCTT |
2.4. Statistical Analyses
3. Results
3.1. Antimicrobial Susceptibility
3.2. Distribution of Virulence Genes
| Anti-Microbial Agent | HLAR (119) | HLAS (41) | P1 | P2 | P3 | P4 | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| E.faecium (82) | E.faecalis (27) | Others (10) | E.faecium (23) | E.faecalis (8) | Others (10) | |||||||||||||||||
| R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | |||||
| AMP * | 80 (97.6) | 0 (0) | 2 (2.4) | 1 (3.7) | 0 (0) | 26 (96.3) | 2 (20) | 0 (0) | 8 (80) | 22 (95.7) | 0 (0) | 1 (4.3) | 0 (0) | 0 (0) | 8 (100) | 3 (30) | 0 (0) | 7 (70) | 0.00 | 0.00 | 1.00 | 1.00 |
| G * | 80 (97.6) | 0 (0) | 2 (2.4) | 1 (3.7) | 0 (0) | 26 (96.3) | 2 (20) | 0 (0) | 8 (80) | 22 (95.7) | 0 (0) | 1 (4.3) | 0 (0) | 0 (0) | 8 (100) | 1 (10) | 0 (0) | 9 (90) | 0.00 | 0.00 | 1.00 | 1.00 |
| LEF * | 80 (97.6) | 0 (0) | 2 (2.4) | 15 (55.6) | 0 (0) | 12 (44.4) | 7 (70) | 0 (0) | 3 (30) | 23 (100) | 0 (0) | 0 (0) | 2 (25) | 0 (0) | 6 (75) | 3 (30) | 0 (0) | 7 (70) | 0.00 | 0.00 | 1.00 | 0.26 |
| ERY * | 80 (97.6) | 0 (0) | 2 (2.4) | 23 (85.2) | 3 (11.1) | 1 (3.7) | 9 (90) | 0 (0) | 1 (10) | 18 (78.3) | 4 (17.4) | 1 (4.3) | 2 (25) | 3 (37.5) | 3 (37.5) | 8 (80) | 1 (10) | 1 (10) | 1.00 | 0.07 | 1.00 | 0.04 |
| CIP * | 80 (97.6) | 0 (0) | 2 (2.4) | 15 (55.6) | 4 (14.8) | 8 (29.6) | 8 (80) | 1 (10) | 1 (10) | 23 (100) | 0 (0) | 0 (0) | 1 (12.5) | 2 (25) | 5 (62.5) | 3 (30) | 2 (20) | 5 (50) | 0.00 | 0.00 | 1.00 | 0.20 |
| LZD * | 3 (3.7) | 0 (0) | 79 (96.3) | 0 (0) | 0 (0) | 27 (100) | 0 (0) | 0 (0) | 10 (100) | 0 (0) | 0 (0) | 23 (100) | 0 (0) | 0 (0) | 8 (100) | 0 (0) | 0 (0) | 10 (100) | 0.57 | -- | 0.82 | -- |
| Q/D * | 8 (9.8) | 6 (7.3) | 68 (82.9) | -- | -- | -- | 7 (70) | 2 (20) | 1 (10) | 3 (13.0) | 2 (8.7) | 18 (78.3) | -- | -- | -- | 5 (50) | 2 (20) | 3 (30) | -- | -- | 0.84 | -- |
| TET * | 36 (43.9) | 1 (1.2) | 45 (54.9) | 20 (74.1) | 1 (3.7) | 6 (22.2) | 10 (100) | 0 (0) | 0 (0) | 12 (52.2) | 0 (0) | 11 (47.8) | 4 (50) | 0 (0) | 4 (50) | 8 (80) | 0 (0) | 2 (20) | 0.00 | 1.00 | 0.55 | 0.27 |
| RIF * | 64 (78.1) | 7 (8.5) | 11 (13.4) | 8 (29.6) | 5 (18.5) | 14 (51.9) | 1 (10) | 0 (0) | 9 (90) | 16 (69.6) | 5 (21.7) | 2 (8.7) | 1 (12.5) | 1 (12.5) | 6 (75) | 3 (30) | 0 (0) | 7 (70) | 0.00 | 0.00 | 0.80 | 0.45 |
| CHL * | 4 (4.9) | 3 (3.7) | 75 (91.5) | 2 (7.4) | 0 (0) | 25 (92.6) | 0 (0) | 1 (10) | 9 (90) | 1 (4.3) | 1 (4.3) | 21 (91.4) | 1 (12.5) | 1 (12.5) | 6 (75) | 0 (0) | 0 (0) | 10 (100) | 1.00 | 0.57 | 1.00 | 0.46 |
| TEC * | 15 (18.3) | 18 (22.0) | 49 (59.7) | 0 (0) | 1 (3.7) | 26 (96.3) | 0 (0) | 0 (0) | 10 (100) | 1 (4.3) | 1 (4.3) | 21 (91.4) | 1 (12.5) | 0 (0) | 7 (87.5) | 0 (0) | 0 (0) | 10 (100) | 0.00 | 1.00 | 0.00 | 0.94 |
| VAN * | 43 (52.4) | 0 (0) | 39 (47.6) | 2 (7.4) | 1 (3.7) | 24 (88.9) | 0 (0) | 0 (0) | 10 (100) | 2 (8.7) | 0 (0) | 21 (91.3) | 1 (12.5) | 0 (0) | 7 (87.5) | 0 (0) | 0 (0) | 10 (100) | 0.00 | 1.00 | 0.00 | 1.00 |
3.3. Distribution of Aminoglycoside Resistance Genes
3.4. Correlation between Aminoglycoside Resistance Genes and Virulence Genes
4. Discussion
| No.of Isolates | Phenotype | Genotype | No.of Virulence Genes | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| aac(6')-Ie-aph(2'') | aph(2'')-Id | aph(3')-IIIa | ant(6')-Ia | ace | hyl | cylA | esp | gelE | efaA | asa1 | ||
| 22 | R* | + | 4 | 9 | 1 | 12 | 5 | 4 | 3 | |||
| 10 | R | + | 2 | 2 | 5 | 7 | 3 | 4 | 4 | |||
| 7 | R | + | + | 1 | 4 | 0 | 5 | 1 | 1 | 1 | ||
| 2 | R | + | + | 0 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| 15 | R | + | + | 7 | 4 | 7 | 6 | 5 | 7 | 7 | ||
| 2 | R | + | + | + | 0 | 2 | 0 | 0 | 0 | 0 | 0 | |
| 32 | R | + | + | + | 1 | 13 | 1 | 28 | 4 | 2 | 3 | |
| 29 | R | 4 | 2 | 9 | 8 | 5 | 7 | 7 | ||||
| total | 119 | 19 | 36 | 23 | 67 | 23 | 25 | 25 | ||||
| 9 | S * | + | 0 | 3 | 0 | 5 | 2 | 0 | 0 | |||
| 6 | S | + | 1 | 2 | 3 | 2 | 1 | 2 | 1 | |||
| 5 | S | + | + | 0 | 2 | 2 | 0 | 2 | 1 | 1 | ||
| 1 | S | + | + | 1 | 0 | 0 | 1 | 0 | 1 | 1 | ||
| 20 | S | 3 | 3 | 3 | 6 | 7 | 4 | 3 | ||||
| total | 41 | 5 | 10 | 8 | 14 | 12 | 8 | 6 | ||||

5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Soheili, S.; Ghafourian, S.; Sekawi, Z.; Neela, V.; Sadeghifard, N.; Ramli, R.; Hamat, R.A. Wide distribution of virulence genes among Enterococcus faecium and Enterococcus faecalis clinical isolates. Sci. World J. 2014, 2014. [Google Scholar] [CrossRef]
- Garcia-Migura, L.; Liebana, E.; Jensen, L.B. Transposon characterization of vancomycin-resistant Enterococcus faecium (VREF) and dissemination of resistance associated with transferable plasmids. J. Antimicrob. Chemother. 2007, 60, 263–268. [Google Scholar]
- Tsai, H.Y.; Liao, C.H.; Chen, Y.H.; Lu, P.L.; Huang, C.H.; Lu, C.T.; Chuang, Y.C.; Tsao, S.M.; Chen, Y.S.; Liu, Y.C.; et al. Trends in susceptibility of vancomycin-resistant Enterococcus faecium to tigecycline, daptomycin, and linezolid and molecular epidemiology of the isolates: Results from the tigecycline in vitro surveillance in Taiwan (TIST) study, 2006 to 2010. Antimicrob. Agents Chemother. 2012, 56, 3402–3405. [Google Scholar]
- Valdezate, S.; Labayru, C.; Navarro, A.; Mantecón, M.A.; Ortega, M.; Coque, T.M.; García, M.; Saéz-Nieto, J.A. Large clonal outbreak of multidrug-resistant CC17 ST17 Enterococcus faecium containing Tn5382 in a Spanish hospital. J. Antimicrob. Chemother. 2009, 63, 17–20. [Google Scholar]
- Shaw, K.J.; Rather, P.N.; Hare, R.S.; Miller, G.H. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol. Rev. 1993, 57, 138–163. [Google Scholar]
- Emaneini, M.; Aligholi, M.; Aminshahi, M. Characterization of glycopeptides, aminoglycosides and macrolide resistance among Enterococcus faecalis and Enterococcus faecium isolates from hospitals in Tehran. Pol. J. Microbiol. 2008, 57, 173–178. [Google Scholar]
- Duprè, I.; Zanetti, S.; Schito, A.M.; Fadda, G.; Sechi, L.A. Incidence of virulence determinants in clinical Enterococcus faecium and Enterococcus faecalis isolates collected in Sardinia (Italy). J. Med. Microbiol. 2003, 52, 491–498. [Google Scholar]
- Creti, R.; Imperi, M.; Bertuccini, L.; Fabretti, F.; Orefici, G.; Di Rosa, R.; Baldassarri, L. Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J. Med. Microbiol. 2004, 53, 13–20. [Google Scholar]
- Zou, L.K.; Wang, H.N.; Zeng, B.; Li, J.N.; Li, X.T.; Zhang, A.Y.; Zhou, Y.S.; Yang, X.; Xu, C.W.; Xia, Q.Q. Erythromycin resistance and virulence genes in Enterococcus faecalis from swine in China. New Microbiol. 2011, 34, 73–80. [Google Scholar]
- Billström, H.; Lund, B.; Sullivan, A.; Nord, C.E. Virulence and antimicrobial resistance in clinical Enterococcus faecium. Int. J. Antimicrob. Agents 2008, 32, 374–377. [Google Scholar]
- Vakulenko, S.B.; Donabedian, S.M.; Voskresenskiy, A.M.; Zervos, M.J.; Lerner, S.A.; Chow, J.W. Multiplex PCR for detection of aminoglycoside resistance genes in enterococci. Antimicrob. Agents Chemother. 2003, 47, 1423–1426. [Google Scholar]
- Kao, S.J.; You, I.; Clewell, D.B.; Donabedian, S.M.; Zervos, M.J.; Petrin, J.; Shaw, K.J.; Chow, J.W. Detection of the high-level aminoglycoside resistance gene aph(2d)-Ib in Enterococcus faecium. Antimicrob. Agents Chemother. 2000, 44, 2876–2879. [Google Scholar]
- Hayakawa, K.; Martin, E.T.; Gudur, U.M.; Marchaim, D.; Dalle, D.; Alshabani, K.; Muppavarapu, K.S.; Jaydev, F.; Bathina, P.; Sundaragiri, P.R.; et al. Impact of different antimicrobial therapies on clinical and fiscal outcomes of patients with bacteremia due to vancomycin-resistant enterococci. Antimicrob. Agents Chemother. 2014, 58, 3968–3975. [Google Scholar]
- Guzek, A.; Tomaszewski, D.; Rybicki, Z.; Truszczyński, A.; Barański, M.; Korzeniewski, K. Comparison of in vitro efficacy of ertapenem, imipenem and meropenem in the infections caused by the Enterobacteriaceae strains family. Anaesthesiol. Intensive Ther. 2013, 45, 67–72. [Google Scholar]
- Casapao, A.M.; Kullar, R.; Davis, S.L.; Levine, D.P.; Zhao, J.J.; Potoski, B.A.; Goff, D.A.; Crank, C.W.; Segreti, J.; Sakoulas, G.; Cosgrove, S.E.; Rybak, M.J. Multicenter study of high-dose daptomycin for treatment of enterococcal infections. Antimicrob Agents Chemother. 2013, 57, 4190–4196. [Google Scholar]
- Stiefel, U.; Nerandzic, M.M.; Pultz, M.J.; Donskey, C.J. Gastrointestinal colonization with a cephalosporinase-producing bacteroides species preserves colonization resistance against vancomycin-resistant enterococcus and Clostridium difficile in cephalosporin-treated mice. Antimicrob. Agents Chemother. 2014, 58, 4535–4542. [Google Scholar]
- Padmasini, E.; Padmaraj, R.; Ramesh, S.S. High level aminoglycoside resistance and distribution of aminoglycoside resistant genes among clinical isolates of Enterococcus species in Chennai, India. Sci. World J. 2014, 2014. [Google Scholar] [CrossRef]
- Schouten, M.A.; Voss, A.; Hoogkamp-Korstanje, J.A. Antimicrobial susceptibility patterns of enterococci causing infections in Europe. The European VRE Study Group. Antimicrob. Agents Chemother. 1999, 43, 2542–2546. [Google Scholar]
- Zarrilli, R.; Tripodi, M.F.; Di Popolo, A.; Fortunato, R.; Bagattini, M.; Crispino, M.; Florio, A.; Triassi, M.; Utili, R. Molecular epidemiology of high-level aminoglycoside-resistant enterococci isolated from patients in a university hospital in southern Italy. J. Antimicrob. Chemother. 2005, 56, 827–835. [Google Scholar]
- Vankerckhoven, V.; van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar]
- Furtula, V.; Jackson, C.R.; Farrell, E.G.; Barrett, J.B.; Hiott, L.M.; Chambers, P.A. Antimicrobial resistance in Enterococcus spp. isolated from environmental samples in an area of intensive poultry production. Int. J. Environ. Res. Public Health. 2013, 10, 1020–1036. [Google Scholar]
- Jia, W.; Li, G.; Wang, W. Prevalence and antimicrobial resistance of Enterococcus species: A hospital-based study in China. Int. J. Environ. Res. Public Health 2014, 11, 3424–3442. [Google Scholar]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, W.; Li, J.; Wei, Q.; Hu, Q.; Lin, X.; Chen, M.; Ye, R.; Lv, H. Characterization of Aminoglycoside Resistance and Virulence Genes among Enterococcus spp. Isolated from a Hospital in China. Int. J. Environ. Res. Public Health 2015, 12, 3014-3025. https://doi.org/10.3390/ijerph120303014
Li W, Li J, Wei Q, Hu Q, Lin X, Chen M, Ye R, Lv H. Characterization of Aminoglycoside Resistance and Virulence Genes among Enterococcus spp. Isolated from a Hospital in China. International Journal of Environmental Research and Public Health. 2015; 12(3):3014-3025. https://doi.org/10.3390/ijerph120303014
Chicago/Turabian StyleLi, Wanxiang, Jing Li, Quhao Wei, Qingfeng Hu, Xiaowei Lin, Mengquan Chen, Renji Ye, and Huoyang Lv. 2015. "Characterization of Aminoglycoside Resistance and Virulence Genes among Enterococcus spp. Isolated from a Hospital in China" International Journal of Environmental Research and Public Health 12, no. 3: 3014-3025. https://doi.org/10.3390/ijerph120303014
APA StyleLi, W., Li, J., Wei, Q., Hu, Q., Lin, X., Chen, M., Ye, R., & Lv, H. (2015). Characterization of Aminoglycoside Resistance and Virulence Genes among Enterococcus spp. Isolated from a Hospital in China. International Journal of Environmental Research and Public Health, 12(3), 3014-3025. https://doi.org/10.3390/ijerph120303014
