Exposure to Endocrine Disrupters and Nuclear Receptor Gene Expression in Infertile and Fertile Women from Different Italian Areas
Abstract
:1. Introduction
2. Methods
2.1. Areas under Study
2.2. Study Subjects
- n = 49 infertile and n = 13 fertile women in the Department of Women Health and Territorial Medicine of “Sapienza” University “Sant’Andrea” Hospital, Rome;
 - n = 38 infertile and n = 22 fertile women in the Department of Biomedical Sciences and Advanced Therapies, Section of Obstetrics and Gynaecology, University of Ferrara;
 - n = 23 infertile and n = 8 fertile women in the Infertility Center S.T.S. (Sterility Therapy and Study) of Sora.
 
2.3. Collection and Storage of Samples
2.4. Chemical Analysis of Biomarker of Exposure
2.4.1. PFOS/PFOA
2.4.2. DEHP/MEHP
2.4.3. BPA
2.4.4. Data Quality Assurance and Quality Control
2.5. Gene Expression Analysis of Nuclear Receptors
| Gene | RefSeq Accession | Sequence 5’ to 3’ | Amplicon Length (bp) | |
|---|---|---|---|---|
| GAPDH | NM_002046.4 | forward | ACTCCTCCACCTTTGACGCT | 273 | 
| reverse | CTTCAAGGGGTCTACATGGC | |||
| ERα | NM_000125.3 | forward | ACTGCGGGCTCTACTTCATC | 275 | 
| reverse | GGCTGTTCCCAACAGAAGAC | |||
| ERβ | NM_001040275.1 | forward | CTCTTTTGCCTGAAGCAACG | 269 | 
| reverse | CTGGGCAGTTAAGGAGACCA | |||
| AR | NM_000044.3 | forward | CCCATCTATTTCCACACCCA | 259 | 
| reverse | GCAAAGTCTGAAGGTGCCAT | |||
| PPARγ | NM_138712.3 | forward | GATGACAGCGACTTGGCAAT | 269 | 
| reverse | AGGAGCGGGTGAAGACTCAT | |||
| AhR | NM_001621.4 | forward | TTCCACCTCAGTTGGCTTTG | 233 | 
| reverse | GGACTCGGCACAATAAAGCA | |||
| PXR | NM_003889.3 | forward | GGCCACTGGCTATCACTTCA | 343 | 
| reverse | GGTTTTCATCTGAGCCTCCA | 
2.6. Statistical Analysis
| Areas | Metropolitan (Rome) | Urban (Ferrara) | Rural (Sora) | |||
|---|---|---|---|---|---|---|
| Indicators | 1–10 employees | 1–10 employees | 1–10 employees | |||
| Agricultural enterprises | 393 | 1684 | 4 | |||
| Textile industries | 206 | 40 | 4 | |||
| Petroleum refinery | 16 | 0 | 0 | |||
| Manufactures of chemicals | 121 | 12 | 4 | |||
| Manufactures of articles of rubber | 0 | 0 | 0 | |||
| Manufacture of articles of plastics | 0 | 0 | 0 | |||
| Sanitation and waste management | 39 | 2 | 0 | |||
| Population | 2,724,347 | 134,464 | 26,542 | |||
| Surface (km2) | 1307.71 | 404.36 | 71.82 | |||
| Population density (inhabitants/km2) | 2083.30 | 332.54 | 369.56 | |||
3. Results
3.1. Areas Characterization
3.2. Biomarkers of Exposure
| Chemicals | PFOS | PFOA | MEHP | BPA | |||||
|---|---|---|---|---|---|---|---|---|---|
| Areas | infertile | fertile | infertile | fertile | infertile | fertile | infertile | fertile | |
| Total | mean | 3.5 | 2.2 | 1.8 | 1.7 | 37.9 | 13.1 | 10.6 | 4.8 | 
| (110 infertile; | median | <0.4 | <0.4 | <0.4 | <0.4 | 8.3 | 3.3 | <0.5 | <0.5 | 
| 43 fertile) | 25th p # | <0.4 | <0.4 | <0.4 | <0.4 | <2 | <2 | <0.5 | <0.5 | 
| 75th p | 0.86 | <0.4 | 3.7 | 3.3 | 26.8 | 11.3 | 9.4 | <0.5 | |
| %>LOD | 30.00% | 20.90% | 40.90% | 34.90% | 62.70% | 58.10% | 41.80% | 23.30% | |
| Metropolitan | mean | 6.9 | 4.5 | 0.6 | <0.4 | 75.3 | 32.3 | 19.5 | 7.3 | 
| (49 infertile; | median | <0.4 | <0.4 | <0.4 a | <0.4 a | 23.1 a | 12.1 a | 14.9 a,* | <0.5 * | 
| 13 fertile) | 25th p | <0.4 | <0.4 | <0.4 | <0.4 | <2 | <2 | <0.5 | <0.5 | 
| 75th p | 2.9 | <0.4 | <0.4 | <0.4 | 127.4 | 18.2 | 25.8 | <0.5 | |
| %>LOD | 30.6% | 7.7% | 10.2% | 0.0% | 69.4% | 69.2% | 71.4% | 23.1% | |
| Urban | mean | 0.8 | 1.3 | 3.2 | 2.6 | 8.4 | 6.2 | 1.7 | 2.2 | 
| (38 infertile; | median | <0.4 | <0.4 | 3.6 b | 1.1 b | 4.4 b | 3.7 a | <0.5 b | <0.5 | 
| 22 fertile) | 25th p | <0.4 | <0.4 | <0.4 | <0.4 | <2 | <2 | <0.5 | <0.5 | 
| 75th p | 0.6 | <0.4 | 4.9 | 5.2 | 9.4 | 5.6 | 3.8 | 5.4 | |
| %>LOD | 26.3% | 22.7% | 71.1% | 50.0% | 73.7% | 72.7% | 26.3% | 27.3% | |
| Rural | mean | 1 | 1.2 | 2.1 | 1.9 | 7.2 | <2 | 6 | 7.8 | 
| (23 infertile; | median | <0.4 | <0.4 | 2.2 b | 1.6 b | <2 b | <2 b | <0.5 b | <0.5 | 
| 8 fertile) | 25th p | <0.4 | <0.4 | <0.4 | <0.4 | <2 | <2 | <0.5 | <0.5 | 
| 75th p | 0.9 | 1.6 | 3.7 | 3.2 | 18.6 | <2 | <0.5 | <0.5 | |
| %>LOD | 34.8% | 37.5% | 56.5% | 50.0% | 30.4% | 0.0% | 4.4% | 12.5% | |
| Chemicals | Total (n = 153) | Metropolitan area (n = 62) | Urban area (n = 60) | Rural area (n = 31) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| OR | 95% CI | OR | 95% CI | OR | 95% CI | OR | 95% CI | |||||
| PFOS | 1.6 | 0.7 | 4.3 | 5.3 | 0.7 | 241.1 | 1.2 | 0.3 | 5.3 | 0.9 | 0.1 | 7.3 | 
| PFOA | 1.3 | 0.6 | 2.9 | ND | - | - | 2.5 | 0.7 | 8.4 | 1.3 | 0.2 | 8.9 | 
| MEHP | 1.2 | 0.6 | 2.6 | 1.0 | 0.2 | 4.4 | 1.1 | 0.3 | 3.9 | ND | - | - | 
| BPA | 2.4 * | 1.0 | 5.9 | 8.3 * | 1.7 | 52.1 | 1.0 | 0.3 | 3.8 | 0.3 | 0.0 | 28.5 | 
3.3. Nuclear Receptors Gene Expression
| Nuclear Receptors | ERα | ERβ | AR | PPARγ | AhR | PXR | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Areas | infertile | fertile | infertile | fertile | infertile | fertile | infertile | fertile | infertile | fertile | infertile | fertile | |
| Total | mean | 0.1138 | 0.0151 | 0.0937 | 0.0122 | 0.1086 | 0.0142 | 0.0003 | 0.0008 | 0.0256 | 0.0047 | 0.1015 | 0.0122 | 
| (98 infertile ; | median | 0.0082 | 0.0007 | 0.0081 | 0.0017 | 0.0087 | 0.001 | 0.0001 | 0.0002 | 0.0021 | 0.0012 | 0.0067 | 0.0004 | 
| 41 fertile) | 25th p # | 0.0005 | 0.0003 | 0.0011 | 0.0009 | 0.0008 | 0.0005 | 0.0001 | 0.0001 | 0.0009 | 0.0007 | 0.0002 | 0.0002 | 
| 75th p | 0.0636 | 0.0058 | 0.0413 | 0.0071 | 0.0636 | 0.0099 | 0.0003 | 0.0002 | 0.0081 | 0.0022 | 0.0998 | 0.0043 | |
| Metropolitan | mean | 0.2582 | 0.0282 | 0.2143 | 0.0216 | 0.2439 | 0.0232 | 0.0004 | 0.0003 | 0.0589 | 0.0068 | 0.2231 | 0.0195 | 
| (41 infertile ; | median | 0.0647 a,* | 0.0007 a,* | 0.0591 a,* | 0.0013 * | 0.0593 a,* | 0.0008 * | 0.0002 | 0.0002 | 0.009 a,* | 0.0013 * | 0.0998 a,* | 0.0004 a,* | 
| 13 fertile) | 25th p | 0.0256 | 0.0004 | 0.0132 | 0.0008 | 0.0186 | 0.0005 | 0.0000 | 0.0001 | 0.0041 | 0.0007 | 0.0170 | 0.0003 | 
| 75th p | 0.2963 | 0.0059 | 0.2398 | 0.0098 | 0.2707 | 0.0099 | 0.0003 | 0.0002 | 0.0265 | 0.0039 | 0.2698 | 0.0043 | |
| Urban | mean | 0.0158 | 0.0125 | 0.0107 | 0.0105 | 0.0177 | 0.0137 | 0.0002 | 0.0013 | 0.0022 | 0.0048 | 0.0228 | 0.0124 | 
| (35 infertile ; | median | 0.0012 b | 0.0014 a | 0.0017 b | 0.0022 a | 0.0015 b | 0.0022 a | 0.0001 | 0.0002 | 0.0016 b | 0.0013 a | 0.0006 b | 0.0007 a | 
| 20 fertile) | 25th p | 0.0004 | 0.0005 | 0.0009 | 0.0015 | 0.0005 | 0.0009 | 0.0001 | 0.0001 | 0.0004 | 0.0009 | 0.0002 | 0.0003 | 
| 75th p | 0.0233 | 0.0156 | 0.0176 | 0.0089 | 0.0243 | 0.0157 | 0.0002 | 0.0003 | 0.0025 | 0.0024 | 0.0344 | 0.0137 | |
| Rural | mean | 0.0004 | 0.0003 | 0.0011 | 0.0011 | 0.0009 | 0.0007 | 0.0002 | 0.0001 | 0.0009 | 0.0008 | 0.0003 | 0.0001 | 
| (22 infertile ; | median | 0.0004 c | 0.0004 b | 0.0010 c | 0.0010 b | 0.0008 c | 0.0006 b | 0.0001 | 0.0001 | 0.0008 b | 0.0006 b | 0.0002 c | 0.0001 b | 
| 8 fertile) | 25th p | 0.0003 | 0.0002 | 0.0006 | 0.0009 | 0.0005 | 0.0004 | 0.0001 | 0.0001 | 0.0004 | 0.0004 | 0.0001 | 0.0001 | 
| 75th p | 0.0006 | 0.0004 | 0.0015 | 0.0012 | 0.0011 | 0.0008 | 0.0002 | 0.0002 | 0.0011 | 0.0014 | 0.0002 | 0.0002 | |
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Zegers-Hochschild, F.; Adamson, G.D.; de Mouzon, J.; Ishihara, O.; Mansour, R.; Nygren, K.; Sullivan, E.; van der Poel, S.; International Committee for Monitoring Assisted Reproductive Technology; World Health Organization. The International Committee for Monitoring Assisted Reproductive Technology (ICMART) and the World Health Organization (WHO) revised glossary on ART terminology, 2009. Hum. Reprod. 2009, 24, 2683–2687. [Google Scholar]
 - Mascarenhas, M.N.; Flaxman, S.R.; Boerma, T.; Vanderpoel, S.; Stevens, G.A. National, regional, and global trends in infertility prevalence since 1990: A systematic analysis of 277 health surveys. PLoS Med. 2012, 9, e1001356. [Google Scholar] [CrossRef]
 - Caserta, D.; Maranghi, L.; Mantovani, A.; Marci, R.; Maranghi, F.; Moscarini, M. Impact of endocrine disruptor chemicals in gynaecology. Hum. Reprod. Update 2008, 14, 59–72. [Google Scholar] [PubMed]
 - Caserta, D.; Mantovani, A.; Marci, R.; Fazi, A.; Ciardo, F.; La Rocca, C.; Maranghi, F.; Moscarini, M. Environment and women’s reproductive health. Hum. Reprod. Update 2011, 17, 418–433. [Google Scholar] [PubMed]
 - Bonde, J.P.; Toft, G.; Rylander, L.; Rignell-Hydbom, A.; Giwercman, A.; Spano, M.; Manicardi, G.C.; Bizzaro, D.; Ludwicki, J.K.; Zvyezday, V.; et al. Fertility and markers of male reproductive function in inuit and European populations spanning large contrasts in blood levels of persistent organochlorines. Environ. Health Perspect. 2008, 116, 269–277. [Google Scholar]
 - Wojtyniak, B.J.; Rabczenko, D.; Jonsson, B.A.; Zvezday, V.; Pedersen, H.S.; Rylander, L.; Toft, G.; Ludwicki, J.K.; Goralczyk, K.; Lesovaya, A.; et al. Association of maternal serum concentrations of 2,2’, 4,4’5,5’-Hexachlorobiphenyl (CB-153) and 1,1-Dichloro-2,2-Bis (P-Chlorophenyl)-Ethylene (P,P’-DDE) levels with birth weight, gestational age and preterm births in inuit and European populations. Environ. Health 2010, 9. [Google Scholar] [CrossRef]
 - Benford, D.; de Boer, J.; Carere, A.; di Domenico, A.; Johansson, N.; Schrenk, D.; Schoeters, G.; de Voogt, P.; Dellatte, E. Opinion of the scientific panel on contaminants in the food chain on perfluorooctane sulfonate (PFOS), perfluorooctanoic acid (PFOA) and their salts. EFSA J. 2008, 1–131. [Google Scholar] [CrossRef]
 - United Nations Environment Programme. Stockholm Convention on Persistent Organic Pollutants. The 9 New POPs; COP 4; United Nations Environment Programme: Geneva, Switzerland, 2010. [Google Scholar]
 - European Food Safety Authority. Results of the monitoring of perfluoroalkylated substances in food in the period 2000–2009. EFSA J. 2011, 9, 2016–2050. [Google Scholar] [CrossRef]
 - European Food Safety Authority. Perfluoroalkylated substances in food: Occurrence and dietary exposure. EFSA J. 2012, 10, 2743. [Google Scholar] [CrossRef]
 - Governini, L.; Orvieto, R.; Guerranti, C.; Gambera, L.; de Leo, V.; Piomboni, P. The impact of environmental exposure to perfluorinated compounds on oocyte fertilization capacity. J. Assist. Reprod. Genet. 2011, 28, 415–418. [Google Scholar] [PubMed]
 - Fei, C.; McLaughlin, J.K.; Lipworth, L.; Olsen, J. Maternal levels of perfluorinated chemicals and subfecundity. Hum. Reprod. 2009, 24, 1200–1205. [Google Scholar] [PubMed]
 - Louis, G.M.; Peterson, C.M.; Chen, Z.; Hediger, M.L.; Croughan, M.S.; Sundaram, R.; Stanford, J.B.; Fujimoto, V.Y.; Varner, M.W.; Giudice, L.C.; et al. Perfluorochemicals and endometriosis: The ENDO study. Epidemiology 2012, 23, 799–805. [Google Scholar]
 - Benninghoff, A.D.; Bisson, W.H.; Koch, D.C.; Ehresman, D.J.; Kolluri, S.K.; Williams, D.E. Estrogen-Like activity of perfluoroalkyl acids in vivo and interaction with human and rainbow trout estrogen receptors in vitro. Toxicol. Sci. 2011, 120, 42–58. [Google Scholar] [PubMed]
 - Bjork, J.A.; Wallace, K.B. Structure-activity relationships and human relevance for perfluoroalkyl acid-induced transcriptional activation of peroxisome proliferation in liver cell cultures. Toxicol. Sci. 2009, 111, 89–99. [Google Scholar] [PubMed]
 - Takacs, M.L.; Abbott, B.D. Activation of mouse and human peroxisome proliferator-activated receptors (alpha, beta/delta, gamma) by perfluorooctanoic acid and perfluorooctane sulfonate. Toxicol. Sci. 2007, 95, 108–117. [Google Scholar] [PubMed]
 - Ren, H.; Vallanat, B.; Nelson, D.M.; Yeung, L.W.Y.; Guruge, K.S.; Lam, P.K.S.; Lehman-McKeeman, L.D.; Corton, J.C. Evidence for the involvement of xenobiotic-responsive nuclear receptors in transcriptional effects upon perfluoroalkyl acid exposure in diverse species. Reprod. Toxicol. 2009, 27, 266–277. [Google Scholar] [PubMed]
 - Latini, G. Monitoring phthalate exposure in humans. Clin. Chim. Acta 2005, 361, 20–29. [Google Scholar] [PubMed]
 - European Commission. Commission Regulation (EU) No. 10/2011 of 14 January 2011 on plastic materials and articles intended to come into contact with food. Off. J. Eur. Union L 2011, 12, 1–89. [Google Scholar]
 - Cobellis, L.; Latini, G.; de Felice, C.; Razzi, S.; Paris, I.; Ruggieri, F.; Mazzeo, P.; Petraglia, F. High plasma concentrations of di-(2-ethylhexyl)-phthalate in women with endometriosis. Hum. Reprod. 2003, 18, 1512–1515. [Google Scholar] [PubMed]
 - Itoh, H.; Iwasaki, M.; Hanaoka, T.; Sasaki, H.; Tanaka, T.; Tsugane, S. Urinary phthalate monoesters and endometriosis in infertile Japanese women. Sci. Total Environ. 2009, 408, 37–42. [Google Scholar] [PubMed]
 - Kim, S.H.; Chun, S.; Jang, J.Y.; Chae, H.D.; Kim, C.; Kang, B.M. Increased plasma levels of phthalate esters in women with advanced-stage endometriosis: A prospective case-control study. Fertil. Steril. 2011, 95, 357–359. [Google Scholar] [PubMed]
 - Lovekamp-Swan, T.; Davis, B.J. Mechanisms of phthalate ester toxicity in the female reproductive system. Environ. Health Perspect. 2003, 111, 139. [Google Scholar] [PubMed]
 - Ritter, S. Debating BPA’s toxicity. Chem. Eng. News 2011, 89, 5–13. [Google Scholar]
 - European Food Safety Authority. Draft scientific opinion on the risks to public health related to the presence of bisphenol A (BPA) in foodstuffs. EFSA J. 2014, in press. [Google Scholar]
 - Ehrlich, S.; Williams, P.L.; Missmer, S.A.; Flaws, J.A.; Berry, K.F.; Calafat, A.M.; Ye, X.; Petrozza, J.C.; Wright, D.; Hauser, R. Urinary bisphenol a concentrations and implantation failure among women undergoing in vitro fertilization. Environ. Health Perspect. 2012, 120, 978–983. [Google Scholar] [PubMed]
 - Cobellis, L.; Colacurci, N.; Trabucco, E.; Carpentiero, C.; Grumetto, L. Measurement of bisphenol A and bisphenol B levels in human blood sera from healthy and endometriotic women. Biomed. Chromatogr. 2009, 23, 1186–1190. [Google Scholar] [PubMed]
 - Kandaraki, E.; Chatzigeorgiou, A.; Livadas, S.; Palioura, E.; Economou, F.; Koutsilieris, M.; Palimeri, S.; Panidis, D.; Diamanti-Kandarakis, E. Endocrine disruptors and polycystic ovary syndrome (PCOS): Elevated serum levels of bisphenol A in women with PCOS. J. Clin. Endocrinol. Metab. 2011, 96, E480–E484. [Google Scholar] [PubMed]
 - Rubin, B.S. Bisphenol A: An endocrine disruptor with widespread exposure and multiple effects. J. Steroid Biochem. Mol. Biol. 2011, 127, 27–34. [Google Scholar] [PubMed]
 - Sui, Y.; Ai, N.; Park, S.H.; Rios-Pilier, J.; Perkins, J.T.; Welsh, W.J.; Zhou, C. Bisphenol A and its analogues activate human pregnane X receptor. Environ. Health Perspect. 2012, 120, 399–405. [Google Scholar] [PubMed]
 - Caserta, D.; Ciardo, F.; Bordi, G.; Guerranti, C.; Fanello, E.; Perra, G.; Borghini, F.; La Rocca, C.; Tait, S.; Bergamasco, B.; et al. Correlation of endocrine disrupting chemicals serum levels and white blood cells gene expression of nuclear receptors in a population of infertile women. Int. J. Endocrinol. 2013, 2013, 510703. [Google Scholar] [CrossRef]
 - Governini, L.; Guerranti, C.; Focardi, S.; Cuppone, A.; Stendardi, A.; de Leo, V.; Piomboni, P. Impact of environmental exposure to perfluorinated compounds on sperm DNA quality. Syst. Biol. Reprod. Med. 2009, 2, 41–55. [Google Scholar]
 - Vandenberg, L.N.; Gerona, R.R.; Kannan, K.; Taylor, J.A.; van Breemen, R.B.; Dickenson, C.A.; Liao, C.; Yuan, Y.; Newbold, R.R.; Padmanabhan, V.; et al. A round robin approach to the analysis of bisphenol a (BPA) in human blood samples. Environ. Health 2014, 13, 25. [Google Scholar] [CrossRef]
 - European Food Safety Authority. Management of left-censored data in dietary exposure assessment of chemical substances. EFSA J. 2010, 8, 1557. [Google Scholar]
 - Wens, B.; de Boever, P.; Verbeke, M.; Hollanders, K.; Schoeters, G. Cultured human peripheral blood mononuclear cells alter their gene expression when challenged with endocrine-disrupting chemicals. Toxicology 2013, 303, 17–24. [Google Scholar] [PubMed]
 - Koch, H.M.; Calafat, A.M. Human body burdens of chemicals used in plastic manufacture. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2009, 364, 2063–2078. [Google Scholar] [PubMed]
 - Lathi, R.B.; Liebert, C.A.; Brookfield, K.F.; Taylor, J.A.; vom Saal, F.S.; Fujimoto, V.Y.; Baker, V.L. Conjugated bisphenol A (BPA) in maternal serum in relation to miscarriage risk. Fertil. Steril. 2014, 102, 123–128. [Google Scholar] [PubMed]
 - Specht, I.O.; Toft, G.; Hougaard, K.S.; Lindh, C.H.; Lenters, V.; Jönsson, B.A.; Heederik, D.; Giwercman, A.; Bonde, J.P.E. Associations between serum phthalates and biomarkers of reproductive function in 589 adult men. Environ. Int. 2014, 66, 146–156. [Google Scholar] [PubMed]
 - Lind, P.M.; Zethelius, B.; Lind, L. Circulating levels of phthalate metabolites are associated with prevalent diabetes in the elderly. Diabetes Care 2012, 35, 1519–1524. [Google Scholar] [PubMed]
 - Olsén, L.; Lind, L.; Lind, P.M. Associations between circulating levels of bisphenol A and phthalate metabolites and coronary risk in the elderly. Ecotoxicol. Environ. Saf. 2012, 80, 179–183. [Google Scholar] [PubMed]
 - Sprague, B.L.; Trentham-Dietz, A.; Hedman, C.J.; Wang, J.; Hemming, J.D.; Hampton, J.M.; Buist, D.S.; Bowles, E.J.A.; Sisney, G.S.; Burnside, E.S. Circulating serum xenoestrogens and mammographic breast density. Breast Cancer Res. 2013, 15. [Google Scholar] [CrossRef]
 - Aris, A. Estimation of bisphenol A (BPA) concentrations in pregnant women, fetuses and nonpregnant women in eastern townships of Canada. Reprod. Toxicol. 2014, 45, 8–13. [Google Scholar] [PubMed]
 - Ye, X.; Zhou, X.; Hennings, R.; Kramer, J.; Calafat, A.M. Potential external contamination with bisphenol A and other ubiquitous organic environmental chemicals during biomonitoring analysis: An elusive laboratory challenge. Environ. Health Perspect. 2013, 121, 283–286. [Google Scholar] [PubMed]
 - Völkel, W.; Colnot, T.; Csanády, G.A.; Filser, J.G.; Dekant, W. Metabolism and kinetics of bisphenol A in humans at low doses following oral administration. Chem. Res. Toxicol. 2002, 15, 1281–1287. [Google Scholar] [PubMed]
 - Vandenberg, L.N.; Hunt, P.A.; Myers, J.P.; vom Saal, F.S. Human exposures to bisphenol A: Mismatches between data and assumptions. Rev. Environ. Health 2013, 28, 37–58. [Google Scholar] [PubMed]
 - Stahlhut, R.W.; Welshons, W.V.; Swan, S.H. Bisphenol A data in NHANES suggest longer than expected half-life, substantial nonfood exposure, or both. Environ. Health Perspect. 2009, 117, 784–789. [Google Scholar] [PubMed]
 - Vandenberg, L.N.; Chahoud, I.; Heindel, J.J.; Padmanabhan, V.; Paumgartten, F.J.; Schoenfelder, G. Urinary, circulating, and tissue biomonitoring studies indicate widespread exposure to bisphenol A. Environ. Health Perspect. 2010, 118, 1055–1070. [Google Scholar] [PubMed]
 - Fu, P.; Kawamura, K. Ubiquity of bisphenol A in the atmosphere. Environ. Pollut. 2010, 158, 3138–3143. [Google Scholar] [PubMed]
 - Takeuchi, T.; Tsutsumi, O.; Ikezuki, Y.; Takai, Y.; Taketani, Y. Positive relationship between androgen and the endocrine disruptor, bisphenol A, in normal women and women with ovarian dysfunction. Endocr. J. 2004, 51, 165–169. [Google Scholar] [PubMed]
 - Ehrlich, S.; Williams, P.L.; Missmer, S.A.; Flaws, J.A.; Ye, X.; Calafat, A.M.; Petrozza, J.C.; Wright, D.; Hauser, R. Urinary bisphenol a concentrations and early reproductive health outcomes among women undergoing IVF. Hum. Reprod. 2012, 27, 3583–3592. [Google Scholar] [PubMed]
 - Itoh, H.; Iwasaki, M.; Hanaoka, T.; Sasaki, H.; Tanaka, T.; Tsugane, S. Urinary bisphenol-A concentration in infertile Japanese women and its association with endometriosis: A cross-sectional study. Environ. Health Prev. Med. 2007, 12, 258–264. [Google Scholar] [PubMed]
 - Caserta, D.; Bordi, G.; Ciardo, F.; Marci, R.; La Rocca, C.; Tait, S.; Bergamasco, B.; Stecca, L.; Mantovani, A.; Guerranti, C. The influence of endocrine disruptors in a selected population of infertile women. Gynecol. Endocrinol. 2013, 29, 444–447. [Google Scholar] [PubMed]
 - Koch, H.; Bolt, H.; Angerer, J. Di (2-Ethylhexyl) phthalate (DEHP) metabolites in human urine and serum after a single oral dose of deuterium-labelled DEHP. Arch. Toxicol. 2004, 78, 123–130. [Google Scholar] [PubMed]
 - Högberg, J.; Hanberg, A.; Berglund, M.; Skerfving, S.; Remberger, M.; Calafat, A.M.; Filipsson, A.F.; Jansson, B.; Johansson, N.; Appelgren, M. Phthalate diesters and their metabolites in human breast milk, blood or serum, and urine as biomarkers of exposure in vulnerable populations. Environ. Health Perspect. 2008, 116, 334–339. [Google Scholar] [PubMed]
 - Reinsberg, J.; Wegener-Toper, P.; van der Ven, K.; van der Ven, H.; Klingmueller, D. Effect of mono-(2-ethylhexyl) phthalate on steroid production of human granulosa cells. Toxicol. Appl. Pharmacol. 2009, 239, 116–123. [Google Scholar] [PubMed]
 - Gupta, R.K.; Singh, J.M.; Leslie, T.C.; Meachum, S.; Flaws, J.A.; Yao, H.H. Di-(2-Ethylhexyl) phthalate and mono-(2-ethylhexyl) phthalate inhibit growth and reduce estradiol levels of antral follicles in vitro. Toxicol. Appl. Pharmacol. 2010, 242, 224–230. [Google Scholar] [PubMed]
 - Eschauzier, C.; Raat, K.J.; Stuyfzand, P.J.; de Voogt, P. Perfluorinated alkylated acids in groundwater and drinking water: Identification, origin and mobility. Sci. Total Environ. 2013, 458–460, 477–485. [Google Scholar] [PubMed]
 - Loos, R.; Locoro, G.; Huber, T.; Wollgast, J.; Christoph, E.H.; de Jager, A.; Manfred Gawlik, B.; Hanke, G.; Umlauf, G.; Zaldívar, J. Analysis of perfluorooctanoate (PFOA) and other perfluorinated compounds (PFCs) in the River Po Watershed in N-Italy. Chemosphere 2008, 71, 306–313. [Google Scholar] [PubMed]
 - Wilhelm, M.; Angerer, J.R.; Fromme, H.; Hölzer, J. Contribution to the evaluation of reference values for PFOA and PFOS in plasma of children and adults from Germany. Int. J. Hyg. Environ. Health 2009, 212, 56–60. [Google Scholar] [PubMed]
 - Ericson, I.; Gómez, M.; Nadal, M.; van Bavel, B.; Lindström, G.; Domingo, J.L. Perfluorinated chemicals in blood of residents in Catalonia (Spain) in relation to age and gender: A pilot study. Environ. Int. 2007, 33, 616–623. [Google Scholar] [PubMed]
 - Ingelido, A.M.; Marra, V.; Abballe, A.; Valentini, S.; Iacovella, N.; Barbieri, P.; Porpora, M.G.; Domenico, A.d.; Felip, E.D. Perfluorooctanesulfonate and perfluorooctanoic acid exposures of the Italian general population. Chemosphere 2010, 80, 1125–1130. [Google Scholar] [PubMed]
 - Lee, H.J.; Chattopadhyay, S.; Gong, E.Y.; Ahn, R.S.; Lee, K. Antiandrogenic effects of bisphenol A and nonylphenol on the function of androgen receptor. Toxicol. Sci. 2003, 75, 40–46. [Google Scholar] [PubMed]
 - Guo, C.; Ni, X.; Zhu, P.; Li, W.; Zhu, X.; Sun, K. Induction of progesterone receptor A form attenuates the induction of cytosolic phospholipase a2alpha expression by cortisol in human amnion fibroblasts. Reproduction 2010, 139, 915–922. [Google Scholar] [PubMed]
 - Hurst, C.H.; Waxman, D.J. Environmental phthalate monoesters activate pregnane X receptor-mediated transcription. Toxicol. Appl. Pharmacol. 2004, 199, 266–274. [Google Scholar] [PubMed]
 - Mnif, W.; Pascussi, J.M.; Pillon, A.; Escande, A.; Bartegi, A.; Nicolas, J.C.; Cavailles, V.; Duchesne, M.J.; Balaguer, P. Estrogens and antiestrogens activate hPXR. Toxicol. Lett. 2007, 170, 19–29. [Google Scholar] [PubMed]
 - Stygar, D.; Westlund, P.; Eriksson, H.; Sahlin, L. Identification of wild type and variants of oestrogen receptors in polymorphonuclear and mononuclear leucocytes. Clin. Endocrinol. Oxf. 2006, 64, 74–81. [Google Scholar] [PubMed]
 
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
La Rocca, C.; Tait, S.; Guerranti, C.; Busani, L.; Ciardo, F.; Bergamasco, B.; Stecca, L.; Perra, G.; Mancini, F.R.; Marci, R.; et al. Exposure to Endocrine Disrupters and Nuclear Receptor Gene Expression in Infertile and Fertile Women from Different Italian Areas. Int. J. Environ. Res. Public Health 2014, 11, 10146-10164. https://doi.org/10.3390/ijerph111010146
La Rocca C, Tait S, Guerranti C, Busani L, Ciardo F, Bergamasco B, Stecca L, Perra G, Mancini FR, Marci R, et al. Exposure to Endocrine Disrupters and Nuclear Receptor Gene Expression in Infertile and Fertile Women from Different Italian Areas. International Journal of Environmental Research and Public Health. 2014; 11(10):10146-10164. https://doi.org/10.3390/ijerph111010146
Chicago/Turabian StyleLa Rocca, Cinzia, Sabrina Tait, Cristiana Guerranti, Luca Busani, Francesca Ciardo, Bruno Bergamasco, Laura Stecca, Guido Perra, Francesca Romana Mancini, Roberto Marci, and et al. 2014. "Exposure to Endocrine Disrupters and Nuclear Receptor Gene Expression in Infertile and Fertile Women from Different Italian Areas" International Journal of Environmental Research and Public Health 11, no. 10: 10146-10164. https://doi.org/10.3390/ijerph111010146
APA StyleLa Rocca, C., Tait, S., Guerranti, C., Busani, L., Ciardo, F., Bergamasco, B., Stecca, L., Perra, G., Mancini, F. R., Marci, R., Bordi, G., Caserta, D., Focardi, S., Moscarini, M., & Mantovani, A. (2014). Exposure to Endocrine Disrupters and Nuclear Receptor Gene Expression in Infertile and Fertile Women from Different Italian Areas. International Journal of Environmental Research and Public Health, 11(10), 10146-10164. https://doi.org/10.3390/ijerph111010146
        
